Populus euphratica PeGRF9 gene and application thereof in plant leaf shape regulation and control
By screening out the PeGRF9 gene from the poplar genome and constructing overexpressed plants in Arabidopsis, the problem of analyzing the developmental changes of poplar leaf shape was solved, and the function of the PeGRF9 gene in leaf shape regulation was successfully identified, providing a variety of poplar leaves. Theoretical support.
Patent Information
- Application Number
- CN202411266629.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-11
- Publication Date
- 2025-01-10
AI Technical Summary
Currently, there is a lack of effective methods to analyze the mechanism of plant leaf shape development, especially the regulatory mechanism of the properties of poplar aberrant leaves.
PeGRF9 genes homologous to Arabidopsis AtGRF4 were screened from the poplar genome, and their biological functions in leaf-shaped development were identified by constructing Arabidopsis overexpression plants.
The successful determination of the role of the PeGRF9 gene in leaf shape development provides theoretical support to reveal the regulatory mechanism of the alienopsis leaves of poplar, providing a new analytical method for plant leaf shape changes.
Smart Images
Figure CN119286879A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of plant genetic engineering, and in particular to a Populus euphratica PeGRF9 gene and application thereof in regulating plant leaf shape. Background Art
[0002] Plant leaves are one of the important nutritional organs of the aboveground part of plants. They are also an important place for plants to exchange substances with the external environment. Leaves can synthesize organic matter through photosynthesis, decompose organic matter through respiration, and store some nutrients. In addition, plant leaves can perform transpiration, which reduces the temperature of the leaves and prevents high temperature from damaging leaf cells. Some leaves also have a reproductive function. The morphology of leaves on the same plant of most plants in nature is basically the same. With the changes in global climate and environment, some plants have adapted to the changes in the surrounding environment by changing their own organ structures during the long evolution. For example, the morphology of plant leaves has changed significantly, resulting in the formation of leaves of different shapes on the same plant. This phenomenon is called heteromorphic leaf nature of plants. These leaves of different shapes are called heteromorphic leaves. The phenomenon of heteromorphic leaves is common from aquatic ferns to angiosperms. Especially for plants living in two different habitats, water and land, such as the aquatic plant cranberry, in order to adapt to different environments, the underwater leaves are usually filamentous and linear, and the leaves are relatively thin, while the terrestrial leaves are exposed to the air, and the stomata and vascular bundles are relatively developed. The terrestrial plant Sabina vulgaris has only needle-shaped leaves in the early seedling stage, while mature individuals have both needle-shaped and phosphate-shaped leaves, and the distribution of different leaf shapes is related to the age of the plant. During the development of the plant, the changes in leaves are very flexible, but the relevant change mechanisms are still unclear.
[0003] Growth-regulating factors (GRFs) are a class of transcription factors unique to plants. The research on the regulatory mechanism of leaf development of herbaceous plants is relatively detailed. Most GRFs affect leaf size by positively regulating cell proliferation and expansion. GRFs are one of the several important regulatory factors of leaf growth and have the function of regulating cell proliferation in leaf organs. Compared with wild-type plants, Arabidopsis overexpressing AtGRF1 and AtGRF2 genes has increased cell proliferation, enlarged leaves and cotyledons. When the AtGRF5 gene is overexpressed, the proliferation of leaf primordium cells is enhanced, resulting in larger leaves; conversely, due to the reduction in cell number, a narrow leaf phenotype is presented. Studies have found that AtGRF4 is similar to AtGRF1 / 2 / 3 genes in expression pattern and inferred amino acid sequence. The quadruple mutant constructed by hybridizing the T-DNA insertion mutant of GRF4 with the grf1 / 2 / 3 mutant produces seedlings with smaller leaves, which indicates that AtGRF4 plays an important role in regulating Arabidopsis leaf development.
[0004] Populus euphratica Oliv. is a rare tree species unique to desert areas, with ecological characteristics such as cold resistance, drought resistance, and salt-alkali resistance. Studies have shown that Populus euphratica has heteromorphic leaves, with linear leaves (Li), lanceolate leaves (La), ovate leaves (Ov), and broad ovate leaves (Bo) appearing in different developmental stages from young plants to adult plants. The heteromorphic leaves of Populus euphratica are the result of adaptive evolution formed by long-term environmental drought stress, and have important ecological significance. Currently, there is no method that can effectively analyze the mechanism of plant leaf shape development changes. Therefore, the present invention proposes a Populus euphratica PeGRF9 gene and its application in plant leaf shape regulation to solve the problems existing in the prior art. Summary of the invention
[0005] In view of the above problems, the purpose of the present invention is to propose a Populus euphratica PeGRF9 gene and its application in plant leaf shape regulation, screen out a gene PeGRF9 involved in leaf shape development that is homologous to the Arabidopsis AtGRF4 gene from the Populus euphratica genome, and construct Arabidopsis overexpression plants, identify their phenotypes, and determine the biological function of the Populus euphratica PeGRF9 gene in leaf shape development.
[0006] In order to achieve the purpose of the present invention, the present invention is implemented by the following technical scheme: a Populus euphratica PeGRF9 gene, the nucleotide sequence of the Populus euphratica PeGRF9 gene is shown in SEQ ID NO:1, and the protein encoding sequence of the Populus euphratica PeGRF9 gene is shown in SEQ ID NO:2.
[0007] An application of the Populus euphratica PeGRF9 gene in regulating plant leaf shape comprises the following steps:
[0008] Step 1: PeGRF9 structure analysis and target gene acquisition
[0009] First, the gene structure of the PeGRF9 gene of Populus euphratica was analyzed, and the CDS sequence of the PeGRF9 gene of Populus euphratica was obtained according to the analyzed structure, and then the primers PeGRF9-F and PeGRF9-R were designed to amplify the PeGRF9 gene in Populus euphratica.
[0010] Step 2: Construction of overexpression vector
[0011] Constructing an overexpression vector specifically comprises the following steps:
[0012] A1. Gene cloning and expression vector ligation
[0013] First, the target fragment was amplified using Phanta Max high-fidelity DNA polymerase, and the amplified fragment was detected by electrophoresis. Then, the PCR product was recovered using a gel recovery kit and stored in a -4°C refrigerator. Then, the target gene PeGRF9 was reacted in 5×TEDA buffer for 30 minutes and then connected to the overexpression vector pGreen-YFP that had been digested with SmaI endonuclease.
[0014] A2. Ligation and transformation of Escherichia coli
[0015] First, thaw the E. coli Top10 competent cells on ice, pipette the recombinant plasmid into the competent cells, let it stand on ice for 20 minutes, then heat shock in a 42°C water bath for 42 seconds, let it stand on ice for 2 minutes, then add 500 μL of recovery solution, pipette the recovered bacterial solution and evenly spread it on LB solid medium containing kanamycin, and culture it upside down in a 37°C incubator for 12 to 16 hours until a single colony grows;
[0016] A3. Identification of positive bacteria
[0017] First, a single colony was picked to culture the bacterial suspension at 37°C in a shaking incubator, and PCR amplification was performed using the bacterial suspension as a template. The PCR amplification primers were PeGRF9-F and PeGRF9-R. The PCR product was verified by agarose gel electrophoresis. Then, the positive bacterial solution with the same electrophoresis band as the target gene size fragment was sent for sequencing. The plasmid was extracted from the bacterial solution with the correct sequencing result. The bacterial solution with the correct sequencing result was mixed with 50% glycerol in a volume ratio of 1:1, mixed upside down, and stored in a -80°C refrigerator.
[0018] Step 3: Transform Arabidopsis
[0019] The transformation of Arabidopsis thaliana specifically includes the following steps:
[0020] B1. Preparation of Agrobacterium infection solution
[0021] First, the constructed overexpression vector was electro-transformed into Agrobacterium competent cells GV3101-psoup, and cultured in a 28°C incubator for 2 days. The grown colonies were scraped and cultured in LB liquid medium containing kanamycin and rifampicin until OD = 1. 250 mL of 5% sucrose solution was prepared to resuspend the Agrobacterium bacterial solution. Before preparing for infection, 100 μL of silwet-L77 solution was added and mixed to complete the preparation of the infection solution.
[0022] B2. Arabidopsis thaliana culture
[0023] First, the seeds of Arabidopsis Col-0 were shaken and washed with 75% ethanol for 5 minutes, and then with 95% ethanol for 1 minute. Then, the Arabidopsis seeds were placed in a clean bench to be blown dry to complete the sterilization treatment. Then, the sterilized Arabidopsis seeds were evenly spread in 1 / 2MS culture medium, and moved to a growth chamber for culture after vernalization for 2 to 3 days at 4°C in a dark environment. After germination in the growth chamber for 7 days, seedlings with consistent growth were selected and transplanted to soil for further culture. The culture temperature was 21°C, the relative humidity was 60%, the light intensity was 80 μmol m-2 s-1, and the light time was 16 hours of light and 8 hours of darkness. When Arabidopsis grew to the flowering period, it was transformed by Agrobacterium inflorescence infection.
[0024] B3. Genetic transformation of Arabidopsis thaliana
[0025] First, cut off the fruit pods of Arabidopsis plants in full bloom, and let the inflorescence of Arabidopsis completely penetrate into the prepared infection solution for 45 seconds, and then keep it away from light and dark for 12 hours, then take out the infected Arabidopsis and culture it normally;
[0026] B4. Identification of positive transgenic Arabidopsis seedlings
[0027] First, the infected Arabidopsis thaliana was harvested to obtain T0 generation seeds, which were placed in a 30°C drying oven for 2-3 days. After the seeds were fully disinfected, the seeds were evenly spread on a 1 / 2MS medium containing hygromycin using sterilized filter paper, placed in a 4°C refrigerator for vernalization for 2 days, and then placed in a constant temperature incubator for 2 weeks. Among them, the positive seedlings that can normally grow true leaves and roots are positive seedlings, and then the positive seedlings are planted in mixed soil. After the positive seedlings mature, the seeds are harvested individually to obtain T1 generation seeds, and then the T2 generation seeds are screened in a 1 / 2MS medium containing hygromycin according to the same method. The T2 generation seeds are selected to meet the genetic segregation ratio of 3:1, and the same method is used to continue screening until the offspring do not have a segregation ratio as the T3 generation, and finally the transgenic positive seedlings are verified by PCR amplification;
[0028] Step 4: Phenotypic identification of overexpressed Arabidopsis leaves
[0029] The transformed T3 positive seedlings were transplanted and phenotypic identification was performed on the 10th day after transplanting to determine the biological function of the Populus euphratica PeGRF9 gene in leaf shape development.
[0030] A further improvement is that in the step three, the positive seedlings of the transgenic plants are subsequently screened, hygromycin with a final concentration of 25 mg / L is added to the 1 / 2MS medium, the nucleotide sequence of the primer PeGRF9-F is shown in SEQ ID NO:3, and the nucleotide sequence of the primer PeGRF9-R is shown in SEQ ID NO:4, and the positive seedlings screened by hygromycin are identified again.
[0031] The beneficial effects of the present invention are as follows: the present invention screened out for the first time a gene PeuTF06G01147.1 involved in leaf shape development which is homologous to the Arabidopsis AtGRF4 gene, namely the Populus euphratica PeGRF9 gene, from the Populus euphratica genome, and by constructing Arabidopsis overexpression plants and identifying their phenotypes, the biological function of the Populus euphratica PeGRF9 gene in leaf shape development was determined, which can effectively analyze the mechanism of plant leaf shape development changes and provide theoretical support for revealing the regulatory mechanism of Populus euphratica's heteromorphic leaves. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0033] Figure 1 It is a gene structure comparison diagram of the homologous gene sequences of the Populus euphratica and Arabidopsis thaliana GRF family in the embodiments of the present invention;
[0034] Figure 2 It is a schematic diagram of the transcription level of the PeGRF9 gene in the positive seedlings of the T3 generation after the PeGRF9 of Populus euphratica is heterologously transformed into Arabidopsis thaliana in the embodiment of the present invention;
[0035] Figure 3 It is a comparison and statistical graph of the seedling leaf phenotypes of 35S-PeGRF9-pGreen-YFP and Col-0 in the examples of the present invention. DETAILED DESCRIPTION
[0036] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0037] Embodiment 1
[0038] This embodiment provides a Populus euphratica PeGRF9 gene, the nucleotide sequence of the Populus euphratica PeGRF9 (PeuTF06G01147.1) gene is shown in SEQ ID NO:1, and the protein sequence encoded by the Populus euphratica PeGRF9 gene is shown in SEQ ID NO:2.
[0039] Embodiment 2
[0040] See also Figure 1 , Figure 2 , Figure 3 This embodiment provides a method for analyzing the role of Populus euphratica PeGRF9 gene in leaf shape development, comprising the following steps:
[0041] Step 1: PeGRF9 structure analysis and target gene acquisition
[0042] First, the gene structure of the PeGRF9 gene of Populus euphratica was analyzed, and the CDS sequence of the PeGRF9 gene of Populus euphratica was obtained according to the analyzed structure, and then the primers PeGRF9-F and PeGRF9-R were designed to amplify the PeGRF9 gene in Populus euphratica.
[0043] The nucleotide sequence of the primer PeGRF9-F in this example is shown in SEQ ID NO:3, and the nucleotide sequence of the primer PeGRF9-R is shown in SEQ ID NO:4;
[0044] PeGRF9-F: 5'-ATGGACTTCCATCTGAAGCAATGGAGAAAC-3';
[0045] PeGRF9-R: 5'-GAAACAGTGGGGCGAGACAACTGGTG-3';
[0046] Step 2: Construction of overexpression vector
[0047] A1. Gene cloning and expression vector ligation
[0048] First, the target fragment was amplified using Phanta Max Super-Fid elity DNA Polymerase, and the amplified fragment was detected by electrophoresis. Then, the PCR product was recovered using a gel recovery kit and stored in a -4°C refrigerator. Then, the target gene PeGRF9 was reacted in 5× TEDA buffer for 30 minutes and then connected to the overexpression vector pGreen-YFP (Kanr, HptII, T-DNA, CaMV 35S promoter) digested with SmaI endonuclease.
[0049] The 5×TEDA buffer in this example is composed of PEG8000 (polyethylene glycol 8000), 1M Tris-HCl (tris(hydroxymethyl)aminomethane hydrochloride), MgCl2 (magnesium oxide, MV: 203.3), 1M DTT (dithiothreitol) and T5 exonuclease (T5 exonuclease), wherein 0.25 g of PEG8000, 5 mL of Tris-HCl, 0.101 g of MgCl2, 0.5 mL of DTT and 100 μL of T5 exonuclease are used per 10 mL of 5×TEDA buffer;
[0050] A2. Ligation and transformation of Escherichia coli
[0051] First, thaw the E. coli Top10 competent cells on ice, pipette the recombinant plasmid into the competent cells, let stand on ice for 20 minutes, then heat shock in a 42°C water bath for 42 seconds, let stand on ice for 2 minutes, add 500 μL of resuscitation solution, pipette the resuscitated bacterial solution and evenly spread it on LB solid medium containing kanamycin, and culture it upside down in a 37°C incubator for 12 to 16 hours (14 hours in this embodiment) until a single colony grows;
[0052] A3. Identification of positive bacteria
[0053] First, a single colony was picked to culture the bacterial suspension at 37°C in a shaking incubator, and PCR amplification was performed using the bacterial suspension as a template. The PCR amplification primers were PeGRF9-F and PeGRF9-R. The PCR product was verified by agarose gel electrophoresis. Then, the positive bacterial solution with the same electrophoresis band as the target gene size fragment was sent for sequencing. The plasmid was extracted from the bacterial solution with the correct sequencing result. The bacterial solution with the correct sequencing result was mixed with 50% glycerol in a volume ratio of 1:1, mixed upside down, and stored in a -80°C refrigerator.
[0054] Step 3: Transform Arabidopsis
[0055] The transformation of Arabidopsis thaliana specifically includes the following steps:
[0056] B1. Preparation of Agrobacterium infection solution
[0057] First, the constructed overexpression vector was electro-transformed into Agrobacterium competent cells GV3101-psoup, and cultured in a 28°C incubator for 2 days. The grown colonies were scraped and cultured in LB liquid medium containing kanamycin and rifampicin until OD = 1. 250 mL of 5% sucrose solution was prepared to resuspend the Agrobacterium bacterial solution. Before preparing for infection, 100 μL of silwet-L77 solution was added and mixed to complete the preparation of the infection solution.
[0058] B2. Arabidopsis thaliana culture
[0059] First, use 75% ethanol as a seed washing liquid I to shake and wash the seeds of Arabidopsis Col-0 (wild type Arabidopsis) for 5 minutes, and then use 95% ethanol as a seed washing liquid II to shake and wash the Arabidopsis seeds for 1 minute, then place the Arabidopsis seeds in a clean bench to blow dry, complete the sterilization treatment, and then evenly spread the sterilized Arabidopsis seeds in 1 / 2MS (Sigma) culture medium, vernalize for 2 to 3 days (vernalization culture for 2 days in this embodiment) in a 4°C dark environment, and then move to a growth box for culture. After germination in the growth box for 7 days, select seedlings with consistent growth and transplant them into soil for further culture. The culture temperature is 21°C, the relative humidity is 60%, the light intensity is 80 μmol m-2s-1, and the light time is 16 hours of light and 8 hours of darkness. When Arabidopsis grows to the flowering stage, it is transformed by Agrobacterium inflorescence infection;
[0060] The specific preparation method of 1L 1 / 2MS (Sigma) culture medium in this embodiment is as follows: first weigh 2.2g of MS (MS culture medium), 0.5g of MES (2-morpholineethanesulfonic acid) and 10g of sucrose and dissolve them in 950mL of deionized water to prepare a mixed solution, then adjust the pH value of the mixed solution to 5.7 with 1mol / LKOH, then add 0.5g of Phytagel (plant gel) to each 250mL culture medium, then sterilize it at a temperature of 108°C for 20min, add ampicillin and fungal inhibitors with a final concentration of 20mg / L when cooled to 55°C after sterilization, and pour it into a culture dish to prepare 1L 1 / 2MS culture medium, and then screen the positive seedlings of transgenic plants, add hygromycin with a final concentration of 25mg / L, then add hygromycin with a final concentration of 25mg / L after the culture medium is cooled, and identify the positive seedlings screened by hygromycin again;
[0061] B3. Genetic transformation of Arabidopsis thaliana
[0062] First, cut off the fruit pods of Arabidopsis plants in full bloom, and let the inflorescence of Arabidopsis completely penetrate into the prepared infection solution for 45 seconds, and then keep it away from light and dark for 12 hours, then take out the infected Arabidopsis and culture it normally;
[0063] B4. Identification of positive transgenic Arabidopsis seedlings
[0064] First, the infected Arabidopsis thaliana was harvested to obtain T0 generation seeds, which were placed in a 30°C drying oven for 2-3 days. After the seeds were fully disinfected, the seeds were evenly spread on a 1 / 2MS medium containing hygromycin using sterilized filter paper, placed in a 4°C refrigerator for vernalization for 2 days, and then placed in a constant temperature incubator for 2 weeks. Among them, the positive seedlings that can normally grow true leaves and roots are positive seedlings, and then the positive seedlings are planted in mixed soil. After the positive seedlings mature, the seeds are harvested individually to obtain T1 generation seeds, and then the T2 generation seeds are screened in a 1 / 2MS medium containing hygromycin according to the same method. The T2 generation seeds are selected to meet the genetic segregation ratio of 3:1, and the same method is used to continue screening until the offspring do not have a segregation ratio as the T3 generation, and finally the transgenic positive seedlings are verified by PCR amplification;
[0065] Step 4: Phenotypic identification of overexpressed Arabidopsis leaves
[0066] The transformed T3 positive seedlings were transplanted and phenotyped on the 10th day after transplantation to determine the biological function of PeGRF9 gene in leaf shape development.
[0067] In this example, when phenotypic identification was performed on the transformed plants, the expression level of PeGRF9 in the overexpressed plants was detected by real-time fluorescence quantitative PCR, UBQ10 was used as an internal reference gene, the forward primers included UBQ10-F and PeGRF9-qF, the reverse primers included UBQ10-R and PeGRF9-qR, the nucleotide sequence of UBQ10-F was shown in SEQ ID NO:5, the nucleotide sequence of PeGRF9-qF was shown in SEQ ID NO:6, the nucleotide sequence of UBQ10-R was shown in SEQ ID NO:7, and the nucleotide sequence of PeGRF9-qR was shown in SEQ ID NO:8;
[0068] UBQ10-F: CGGAAAGCAGTTGGAGGATGG;
[0069] PeGRF9-qF: TGTTAGCCGGTGCAGCTATT;
[0070] UBQ10-R: CGGAGCCTGAGAACAAGATGAAG;
[0071] PeGRF9-qR:GCTCTTCCCCAATACCCTGT;
[0072] Using the Bio-Rad CFX96 Real-Time System, the reaction procedure was as follows:
[0073] 95℃15sec, 60℃15sec, 72℃30sec, 40 cycles, and finally the data were processed using the Comparative Ct method;
[0074] like Figure 2 As shown (expression level of PeGRF9 gene in overexpression lines (**, P<0.01)), Arabidopsis UBQ10 gene was used as the internal reference gene, and real-time quantitative PCR (Real-time PCR) was used to detect the expression level of PeGRF9 gene in wild type Arabidopsis (Wild type, Col-0) and three independent T3 generation Populus euphratica PeGRF9 gene overexpression lines (OE2, OE4 and OE5). The expression levels of PeGRF9 gene in the three Arabidopsis PeGRF9 overexpression lines were 600 times, 300 times and 900 times that of the wild type Col-0, respectively.
[0075] like Figure 3 As shown, leaves of PeGRF9-overexpressing Arabidopsis showed larger leaves and longer petioles ( Figure 3 Part A in the figure is a schematic diagram of the leaf shape comparison between 35S-PeGRF9-pGreen-YFP and Col-0); Image J was used to analyze the leaf area, leaf length, and leaf width of the PeGRF9 overexpression strain, which were significantly higher than those of the wild type Col-0, but did not affect the leaf shape index ( Figure 3 Part B in the figure is a schematic diagram showing the comparison of leaf morphological traits between 35S-PeGRF9-pGreen-YFP and Col-0).
[0076] Figure 1 Part A in the figure is the phylogenetic tree of GRFs in Populus euphratica and Arabidopsis thaliana. Figure 1 The B part in the figure is the conserved motif of GRFs in Populus euphratica and Arabidopsis thaliana. Figure 1 The C part in the sequence is the conserved domain of Populus euphratica and Arabidopsis thaliana GRFs.
[0077] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Claims
1. A Populus euphratica PeGRF9 gene, characterized in that: The nucleotide sequence of the Populus euphratica PeGRF9 gene is shown as SEQ ID NO:1, and the protein encoding sequence of the Populus euphratica PeGRF9 gene is shown as SEQ ID NO:
2.
2. An application of the Populus euphratica PeGRF9 gene in regulating plant leaf shape, characterized in that: The following steps are involved: Step 1: PeGRF9 structure analysis and target gene acquisition First, the gene structure of the PeGRF9 gene of Populus euphratica was analyzed, and the CDS sequence of the PeGRF9 gene of Populus euphratica was obtained according to the analyzed structure, and then the primers PeGRF9-F and PeGRF9-R were designed to amplify the PeGRF9 gene in Populus euphratica. Step 2: Construction of overexpression vector Constructing an overexpression vector specifically comprises the following steps: A1. Gene cloning and expression vector ligation First, the target fragment was amplified using Phanta Max high-fidelity DNA polymerase, and the amplified fragment was detected by electrophoresis. Then, the PCR product was recovered using a gel recovery kit and stored in a -4°C refrigerator. Then, the target gene PeGRF9 was reacted in 5×TEDA buffer for 30 minutes and then connected to the overexpression vector pGreen-YFP that had been digested with SmaI endonuclease. A2. Ligation and transformation of Escherichia coli First, thaw the E. coli Top10 competent cells on ice, pipette the recombinant plasmid into the competent cells, let it stand on ice for 20 minutes, then heat shock in a 42°C water bath for 42 seconds, let it stand on ice for 2 minutes, then add 500 μL of recovery solution, pipette the recovered bacterial solution and evenly spread it on LB solid medium containing kanamycin, and culture it upside down in a 37°C incubator for 12 to 16 hours until a single colony grows; A3. Identification of positive bacteria First, a single colony was picked to culture the bacterial suspension at 37°C in a shaking incubator, and PCR amplification was performed using the bacterial suspension as a template. The PCR amplification primers were PeGRF9-F and PeGRF9-R. The PCR product was verified by agarose gel electrophoresis. Then, the positive bacterial solution with the same electrophoresis band as the target gene size fragment was sent for sequencing. The plasmid was extracted from the bacterial solution with the correct sequencing result. The bacterial solution with the correct sequencing result was mixed with 50% glycerol in a volume ratio of 1:1, mixed upside down, and stored in a -80°C refrigerator. Step 3: Transform Arabidopsis The transformation of Arabidopsis thaliana specifically includes the following steps: B1. Preparation of Agrobacterium infection solution First, the constructed overexpression vector was electro-transformed into Agrobacterium competent cells GV3101-psoup, and cultured in a 28°C incubator for 2 days. The grown colonies were scraped and cultured in LB liquid medium containing kanamycin and rifampicin until OD = 1. 250 mL of 5% sucrose solution was prepared to resuspend the Agrobacterium bacterial solution. Before preparing for infection, 100 μL of silwet-L77 solution was added and mixed to complete the preparation of the infection solution. B2. Arabidopsis thaliana culture First, the seeds of Arabidopsis Col-0 were shaken and washed with 75% ethanol for 5 minutes, and then with 95% ethanol for 1 minute. Then, the Arabidopsis seeds were placed in a clean bench to be blown dry to complete the sterilization treatment. Then, the sterilized Arabidopsis seeds were evenly spread in 1 / 2MS culture medium, and moved to a growth chamber for culture after vernalization for 2 to 3 days at 4°C in a dark environment. After germination in the growth chamber for 7 days, seedlings with consistent growth were selected and transplanted to soil for further culture. The culture temperature was 21°C, the relative humidity was 60%, the light intensity was 80 μmol m-2 s-1, and the light time was 16 hours of light and 8 hours of darkness. When Arabidopsis grew to the flowering period, it was transformed by Agrobacterium inflorescence infection. B3. Genetic transformation of Arabidopsis thaliana First, cut off the fruit pods of Arabidopsis plants in full bloom, and let the inflorescence of Arabidopsis completely penetrate into the prepared infection solution for 45 seconds, and then keep it away from light and dark for 12 hours, then take out the infected Arabidopsis and culture it normally; B4. Identification of positive transgenic Arabidopsis seedlings First, the infected Arabidopsis thaliana was harvested to obtain T0 generation seeds, which were placed in a 30°C drying oven for 2-3 days. After the seeds were fully disinfected, the seeds were evenly spread on a 1 / 2MS medium containing hygromycin using sterilized filter paper, placed in a 4°C refrigerator for vernalization for 2 days, and then placed in a constant temperature incubator for 2 weeks. Among them, the positive seedlings that can normally grow true leaves and roots are positive seedlings, and then the positive seedlings are planted in mixed soil. After the positive seedlings mature, the seeds are harvested individually to obtain T1 generation seeds, and then the T2 generation seeds are screened in a 1 / 2MS medium containing hygromycin according to the same method. The T2 generation seeds are selected to meet the genetic segregation ratio of 3:1, and the same method is used to continue screening until the offspring do not have a segregation ratio as the T3 generation, and finally the transgenic positive seedlings are verified by PCR amplification; Step 4: Phenotypic identification of overexpressed Arabidopsis leaves The transformed T3 positive seedlings were transplanted and phenotypic identification was performed on the 10th day after transplanting to determine the biological function of the Populus euphratica PeGRF9 gene in leaf shape development.
3. The method for analyzing the role of Populus euphratica PeGRF9 gene in leaf shape development according to claim 2, characterized in that: In the step three, the positive seedlings of the transgenic plants are subsequently screened, and hygromycin with a final concentration of 25 mg / L is added to the 1 / 2MS medium. The nucleotide sequence of the primer PeGRF9-F is shown in SEQ ID NO:3, and the nucleotide sequence of the primer PeGRF9-R is shown in SEQ ID NO:
4. The positive seedlings screened by hygromycin are identified again.