CRISPR / Cas9 gene editing vector of wheat TaMYB44 gene and application of CRISPR / Cas9 gene editing vector

Abstract

The invention discloses a CRISPR / Cas9 gene editing vector of a wheat TaMYB44 gene and application of the CRISPR / Cas9 gene editing vector, the vector takes pBUE414 as a skeleton vector and further comprises an sgRNA expression cassette and a Cas9 expression cassette, the Cas9 expression cassette is an expression cassette for regulating Cas9 expression by a Ubi promoter, and the sgRNA expression cassette sequentially comprises the following elements from upstream to downstream: a TaU3 promoter, sgRNA1 of TaMYB44, a terminator OsU3t, a TaU3 promoter, sgRNA2 of TaMYB44 and a terminator TaU3t. By utilizing the TaMYB44 gene knockout vector provided by the invention, TaMYB44 in wheat can be quickly knocked out, and the content of high-molecular-weight glutelin in obtained wheat material grains is remarkably increased.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to wheat TaMYB44 Gene editing vectors and their application in increasing high molecular weight glutenin in wheat grains. Background Art

[0002] wheat( Triticum aestivum L.) is one of the three major food crops grown in the world. The grain contains 8%-15% protein. According to the solubility of protein in solvent, it can be divided into four categories: globulin (soluble in dilute salt), albumin (soluble in water), alcohol-soluble protein (soluble in 70% ethanol) and glutenin (soluble in dilute acid or dilute alkali). Gluten can be divided into high molecular weight glutenin (HMW-GS) and low molecular weight glutenin (LMW-GS) according to molecular weight. Although the content of high molecular weight glutenin only accounts for 10% of the grain storage protein, it plays a decisive role in the baking quality of wheat flour.

[0003] There are many cis-acting elements on the promoter of high molecular weight glutenin gene, such as PBF, bZIP, PBF, ABRE, VP1, MYB and NAC binding elements, and many transcription factors may be involved in its regulatory network. At present, there are relatively few studies on the regulation of wheat high molecular weight glutenin gene. Five promoters of high molecular weight glutenin have been reported, namely PBF, TaSPA, TaFUSCA3, TaGAMyb and TaNAC019, and three inhibitors, namely TaSHP, TaODORANT and TaSPR. Fully exploring and cloning new high molecular weight glutenin regulatory factors can provide gene resources for gene aggregation breeding, which is also a new way of wheat quality breeding. Summary of the invention

[0004] In view of the problem that there are relatively few studies on the regulation of wheat high molecular weight glutenin genes, the present invention provides a wheat TaMYB44 CRISPR / Cas9 gene editing vector and its application, which can knock out the gene in wheat by genetic transformation TaMYB44 Gene, thereby increasing the high molecular weight glutenin content of wheat.

[0005] In order to achieve the above object, the present invention provides a wheat TaMYB44 The CRISPR / Cas9 gene editing vector of the gene, the vector uses pBUE414 as a backbone vector, and also includes an sgRNA expression frame and a Cas9 expression frame, the Cas9 expression frame is an expression frame for regulating Cas9 expression by the Ubi promoter, and the sgRNA expression frame includes the following elements from upstream to downstream: TaU3 promoter, TaMYB44 sgRNA1, terminator OsU3t, promoter TaU3, TaMYB44 sgRNA2, terminator TaU3t, wherein TaMYB44 The sgRNA1 has the sequence shown in SEQ ID NO.1, TaMYB44 The sgRNA2 has the sequence shown in SEQ ID NO.2.

[0006] The second aspect of the present invention provides a method for constructing the above-mentioned vector, which comprises the following steps: 1) Design targeting TaMYB44 sgRNA1 and sgRNA2 of the gene, primers for amplifying the OsU3t and TaU3 promoter backbone sequences were designed, and the sgRNA1 and sgRNA2 sequences were connected to the 5' end of the amplification primers, respectively, and the amplification primers were TaMYB44-gR1-F0 as shown in SEQ ID NO.3 and TaMYB44-gR2-R0 as shown in SEQ ID NO.4; 2) Design primers for amplifying the PCR product shown in step 1), and connect the BsaI restriction site sequence to the 5' end of the primer, the amplification primers are TaMYB44-gR1-F shown in SEQ ID NO.5 and TaMYB44-gR2-R shown in SEQ ID NO.6; 3) The four primers TaMYB44-gR1-F0, TaMYB44-gR2-R0, TaMYB44-gR1-F and TaMYB44-gR2-R were mixed to amplify the OsU3t and TaU3 promoter backbone sequences to obtain the PCR product shown in SEQ ID NO.7; 4) The PCR product obtained in step 3) was mixed with restriction endonuclease BsaI, restriction endonuclease buffer, pBUE414 vector plasmid, T4 ligase and 10xNEB T4 Buffer to perform vector restriction enzyme digestion and ligation reaction to obtain the final vector.

[0007] The third aspect of the present invention provides a transformant of the above-mentioned vector.

[0008] The fourth aspect of the present invention provides the above-mentioned vector in knocking out wheat TaMYB44 Application to genetic effects.

[0009] The fifth aspect of the present invention provides the use of the above-mentioned vector in improving wheat quality. Further, TaMYB44 The content of high molecular weight glutenin was significantly decreased in the knockout mutant.

[0010] A sixth aspect of the present invention provides a DNA fragment, the DNA fragment consisting of TaMYB44 The guide sgRNA of the gene is composed of, and its sequence is shown in SEQ ID NO.1 and SEQ ID NO.2.

[0011] Through the above technical solution, the present invention achieves the following beneficial effects: 1) Using the method provided by the present invention TaMYB44 Gene knockout vector can quickly knock out the gene in wheat TaMYB44 , providing an effective method for gene knockout; the two sgRNAs provided in the present invention are for knocking out wheat TaMYB44 Key sites of genes; 2) The present invention uses reverse genetics to construct a knockout TaMYB44 CRISPR / Cas9 gene editing vector of the gene was used to modify the gene in wheat materials through Agrobacterium-mediated method. TaMYB44 The gene was successfully knocked out, and the content of high molecular weight glutenin in the grains of the resulting wheat material was significantly increased.

[0012] 3) The present invention clarifies TaMYB44 The influence of genes on the protein content of wheat grains can be used to create high-protein and high-gluten germplasm materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 for TaMYB44 The results of partial homologous gene sequence alignment, where the red framed lines indicate the locations of gene knockout target sgRNA1 and sgRNA2; Figure 2 This is the gel image of the PCR product of MT1T2 vector amplified using four primers; Figure 3 for TaMYB44 Detection diagram of positive colonies for gene knockout vector construction; Figure 4 for TaMYB44 Sequence variation pattern of gene knockout transgenic lines; Figure 5 for TaMYB44 Gel plots of high molecular weight gluten content in knockout transgenic lines. DETAILED DESCRIPTION

[0014] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0015] Unless otherwise specified, the terms used in the present invention generally have the meanings commonly understood by those of ordinary skill in the art. In the embodiments, various processes and methods not described in detail are conventional methods known in the art.

[0016] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0017] The wheat materials used in the present invention are all germplasm resources materials preserved in the Yangzhou University College of Agriculture-Jiangsu Provincial Germplasm Resources Bank (crops), and can be obtained and used by technicians and researchers in this field.

[0018] Example 1 TaMYB44 Design of knockout target sgRNA1 and sgRNA2 Retrieved using the Ensembl plants database TaMYB44 Partial homologous sequences TaMYB44-A, TaMYB44-B and TaMYB44-D, TaMYB44 The partial homologous sequences were compared and analyzed, and the sequences containing the PAM domain of NGG were selected in the conserved region of the first exon. Two of them were selected as targets, with a target sequence of 19 bp, named sgRNA1 and sgRNA2 respectively (see Figure 1 ).

[0019] Example 2 Construction TaMYB44 Knockout transgenic vector 1) Design primers for amplifying the vector MT1T2 containing the OsU3t and TaU3 promoter backbone sequences, and connect the sgRNA1 and sgRNA2 sequences to the 5' end of the amplification primers, respectively. The amplification primers are TaMYB44-gR1-F0 as shown in SEQ ID NO.3 and TaMYB44-gR2-R0 as shown in SEQ ID NO.4; 2) Design primers for amplifying the PCR product shown in step 1), and connect the BsaI restriction site sequence to the 5' end of the primer, the amplification primers are TaMYB44-gR1-F shown in SEQ ID NO.5 and TaMYB44-gR2-R shown in SEQ ID NO.6; 3) The four primers TaMYB44-gR1-F0, TaMYB44-gR2-R0, TaMYB44-gR1-F and TaMYB44-gR2-R were mixed to amplify the OsU3t and TaU3 promoter backbone sequences to obtain the PCR product sequence shown in SEQ ID NO.7. The product size was 964 bp (refer to Figure 2 ); Perform gel recovery experiment on PCR products to obtain single PCR fragments.

[0020] The four-primer mixture system was as follows: the final concentrations of TaMYB44-gR1-F0 and TaMYB44-gR1-R0 were 0.5 μmol / L, and the final concentrations of TaMYB44-gR1-F and TaMYB44-gR2-R were 10 μmol / L; The PCR amplification system is as follows: 20-100 ng of the vector MT1T2 plasmid containing the OsU3t and TaU3 promoter backbone sequences, 3 μL, 4 μL of the four-primer mixed system, 25 μL of 2 × PhantaTM Master Mix, and H2O added to make up to 50 μL; The reaction conditions for PCR amplification were as follows: pre-denaturation at 95°C for 3 min, followed by denaturation at 95°C for 10 sec, annealing at 58°C for 30 sec, extension at 72°C for 40 sec, for 35 cycles; and finally extension at 72°C for 5 min; stored at 15°C. The gel recovery kit is: agarose gel DNA recovery kit (enhanced); 4) Mix 2 μL of the PCR product obtained in step 3) with 1 μL of restriction endonuclease BsaI, 1.5 μL of restriction endonuclease buffer CutSmart Buffer, 2 μL of pBUE414 vector plasmid, 1 μL of T4 ligase, and 1 μL of 10xNEB T4 Buffer, add water to make up to 15 μL, perform vector restriction enzyme digestion and ligation reaction, and obtain the final vector; The above reaction procedure is: 37°C metal bath reaction for 5 hours, 50°C metal bath reaction for 5 minutes, 80°C metal bath reaction for 10 minutes; 5) The ligated system obtained in step 4) was transformed into competent E. coli.

[0021] The above transformation steps are: a) Add the ligation product obtained in step 4) to the competent cells and place on ice for 30 min; b) Heat shock at 42°C for 30 s, then immediately place in ice for 2 min; c) In a clean bench, add 500 μL of LB liquid medium without antibiotics and place in a 37°C shaker at 180 rpm for 1 h. d) 5000 rpm, 5 min, remove 400 μL of supernatant, then resuspend the bacteria and evenly spread the bacterial solution on LB plates containing 50 mg / L kanamycin; e) Incubate at 37°C overnight; g) Use a sterile yellow pipette tip to pick up a single clone and place it in 200 μL of LB liquid medium containing 50 mg / L kanamycin, and culture at 37°C, 230 rpm for 3 h; h) In a clean bench, 1 μL of bacterial solution was taken as a template for PCR amplification, and the amplification primers were 414F as shown in SEQ ID NO.23 and 414R as shown in SEQ ID NO.24; i) Run the PCR product on agarose gel for detection. Bands of 1919 bp and 1000 bp are positive clones (refer to Figure 3 ), the bacterial solution was sent to Yangzhou Lanke Biotechnology Co., Ltd. for sequencing; j) The clones with correct sequencing were re-propagated, the plasmids were extracted, and transformed into GV3101 Agrobacterium competent cells. The positive clones were selected and sent to Jiangsu Academy of Agricultural Sciences for genetic transformation. The recipient was the wheat variety Fielder.

[0022] Example 3 TaMYB44 Identification of knockout transgenic lines use TaMYB44 The specific primer pair for TaMYB44-A, a partial homologous gene located on chromosome 4A, as shown in SEQ ID NO.8 and SEQ ID NO.9, is effective for TaMYB44 The knockout transgenic line DNA was amplified and sequenced by Sanger sequencing to obtain the variant type of TaMYB44-A. TaMYB44 The specific primer pair for the partial homologous gene TaMYB44-B located on the 4B chromosome group, as shown in SEQ ID NO.10 and SEQ ID NO.11, is for TaMYB44 The knockout transgenic line DNA was amplified and sequenced by Sanger sequencing to obtain the variant type of TaMYB44-B; TaMYB44 The specific primer pair for the partial homologous gene TaMYB44-D located on the 4D chromosome group, as shown in SEQ ID NO.12 and SEQ ID NO.13, is for TaMYB44 The DNA of the knockout transgenic line was amplified and subjected to Sanger sequencing to obtain the variant type of TaMYB44-D; Obtained from the above TaMYB44 Partial homologous gene frameshift mutations lead to premature termination mutants (refer to Figure 4 ). The TaMYB44-A sequence in the wild type is shown as SEQ ID NO.14, the TaMYB44-A sequence in the mutant KO-1 is shown as SEQ ID NO.15, and the TaMYB44-A sequence in the mutant KO-2 is shown as SEQ ID NO.16; the TaMYB44-B sequence in the wild type is shown as SEQ ID NO.17, the TaMYB44-B sequence in the mutant KO-1 is shown as SEQ ID NO.18, and the TaMYB44-B sequence in the mutant KO-2 is shown as SEQ ID NO.19; the TaMYB44-D sequence in the wild type is shown as SEQ ID NO.20, the TaMYB44-D sequence in the mutant KO-1 is shown as SEQ ID NO.21, and the TaMYB44-D sequence in the mutant KO-2 is shown as SEQ ID NO.22.

[0023] Example 4 TaMYB44 Application of knockout transgenic lines in increasing high molecular weight glutenin content in wheat High molecular weight glutenin was extracted from wild type, KO-1 and KO-2 seeds and electrophoresed using SDS-PAGE gel. TaMYB44 The high molecular weight glutenin subunits Bx14, By15, Dx2 and Dy12 of wheat were significantly upregulated in the knockout transgenic lines (ref. Figure 5 ).

[0024] The specific steps of gluten extraction are as follows: 1. Reagent Preparation 1) Prolamin extraction reagent: 50% n-propanol; 2) Gluten extract A: 50% isopropanol, 20% Tris-HCl (1 M, pH 6.8), 30% H2O, 1% DTT powder (add as needed); 3) Gluten extract solution B: 50% isopropanol, 20% Tris-HCl (1 M, pH 6.8), 30% H2O, add 1.4% 4-vinylpyridine to the prepared solution (add as needed); 4) Gluten extract solution C: 62.5% Tris-HCl (1 M, pH 6.8), 0.5% mercaptoethanol, 20% glycerol, 2% SDS powder, a small amount of bromophenol blue, make up to volume with deionized water.

[0025] 2. Experimental Procedure 1) Accurately weigh 0.1000 g of flour and place it in a 2.0 mL centrifuge tube for later use; 2) Accurately add 1.5 mL of 50% n-propanol, vortex thoroughly, and place in a 65°C water bath for 30 min, vortexing every 10 min. 3) Centrifuge at room temperature, 13000 rpm for 5 min; 4) Discard the remaining supernatant; 5) Add 1 mL of 50% n-propanol to the precipitate, vortex thoroughly, and place in a 65°C water bath for 30 min, vortexing every 15 min. 6) Repeat step 3) and discard the supernatant; 7) Repeat the washing process twice and discard the supernatant completely; 8) Dry the sediment in a dryer for about 30 minutes; 9) Add 250 μL of gluten extract A, shake and mix, incubate in a 65°C water bath for 30 min, and shake once every 15 min; 10) Add 250 μL of gluten extract B, shake and mix, incubate in a 65°C water bath for 30 min, and shake once every 15 min; 11) Centrifuge, take out 100 μL of supernatant, add 100 μL of glutenin extract C for subsequent SDS-PAGE electrophoresis. The specific steps of SDS-PAGE electrophoresis are as follows: a) Gel preparation: Use the ultrafast SDS-PAGE gel preparation kit (Zhuangmeng Bio, ZD304C) to prepare gel. Take equal volumes of separation gel A solution and separation gel B solution and mix them evenly. Add 10 μL of 10% ammonium persulfate solution to every 1 mL of the mixture. After mixing evenly, inject an appropriate amount into the glass plate for gel preparation. Carefully add isopropanol to cover the separation gel. After the separation gel solidifies, pour off the upper isopropanol. Mix equal volumes of stacking gel A solution and stacking gel B solution. Add 10% ammonium persulfate solution, mix evenly, and inject into the upper layer of the separation gel. Insert the comb teeth and wait for the upper layer of gel to solidify for later use. b) Sample loading: aspirate the protein sample and inject it into the gel well; c) Electrophoresis: 120 V constant voltage, time required for electrophoresis; d) Coomassie staining: discard the upper layer of gel, place the separation gel in Coomassie brilliant blue staining solution (1 g Coomassie brilliant blue R-250 powder, 250 mL isopropanol, 100 mL glacial acetic acid, dilute to 1 L with deionized water), boil in a boiling water bath for 1 min, then pour off the staining solution, add distilled water and decolorize in a boiling water bath until the protein bands are clear.

[0026] Sequence Listing SEQ ID NO.1:ACGGGGTCGTGGAGCCCTG SEQ ID NO.2:GCTCAGCCCGGCCGTGCAG SEQ ID NO.3:GACGGGGTCGTGGAGCCCTGGTTTTAGAGCTAGAAATAGC SEQ ID NO.4:GCTCAGCCCGGCCGTGCAGCGCTTCTTGGTGCC SEQ ID NO.5:aataatggtctcAGGCgACGGGGTCGTGGAGCCCTG SEQ ID NO.6:ATTATTGGTCTCTAAAACGCTCAGCCCGGCCGTGCAG SEQ ID NO.7:AATAATGGTCTCAGGCGACGGGGTCGTGGAGCCCTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTTTCGTTTTGCATTGAGTTTTCTCCGTCGCATGTTTGCAGTTTTATTTTCCGTTTTGCATTGAAATTTCTCCGTCTCATGTTTGCAGCGTGTTCAAAAAGTACGCAGCTGTATTTCACTTATTTACGGCGCCACATTTTCATGCCGTTTGTGCCAACTATCCCGAGCTAGTGAATACAGCTTGGCTTCACACAACACTGGTGACCCGCTGACCTGCTCGTACCTCGTACCGTCGTACGGCACAGCATTTGGAATTAAAGGGTGTGATCGATACTGCTTGCTGCTCATGAATCCAAACCACACGGAGTTCAAATTCCCACAGATTAAGGCTCGTCCGTCGCACAAGGTAATGTGTGAATATTATATCTGTCGTGCAAAATTGCCTGGCCTGCACAATTGCTGTTATAGTTGGCGGCAGGGAGAGTTTTAACATTGACTAGCGTGCTGATAATTTGTGAGAAATAATAATTGACAAGTAGATACTGACATTTGAGAAGAGCTTCTGAACTGTTATTAGTAACAAAAATGGAAAGCTGATGCACGGAAAAAGGAAAGAAAAAGCCATACTTTTTTTTAGGTAGGAAAAGAAAAAGCCATACGAGACTGATGTCTCTCAGATGGGCCGGGATCTGTCTATCTAGCAGGCAGCAGCCCACCAACCTCACGGGCCAGCAATTACGAGTCCTTCTAAAAGCTCCCGCCGAGGGGCGCTGGCGCTGCTGTGCAGCAGCACGTCTAACATTAGTCCCACCTCGCCAGTTTACAGGGAGCAGAACCAGCTTATAAGCGGAGGCGCGGCACCAAGAAGCGCTGCACGGCCGGGCTGAGCGTTTAGAGACCAATAAT SEQ ID NO.8:AATGCGACACAACGCCT SEQ ID NO.9:CGGCCAGAAATCGACAG SEQ ID NO.10:GCCCGCTATATATTCAGCTCG SEQ ID NO.11:GCCAATAGCAAACACGGAAG SEQ ID NO.12:GCGCTATATAGCCAGCTCTG SEQ ID NO.13:AATACATGATTCAACAGGGGG SEQ ID NO.14: ATGATTCCAGCCGTTGCTTGCGTCGGATACGACCGCACTGACGCGATGGAGGTGCCATCGCCGATCAAGACGGGGTCGTGGAGCCCTGAGGAGGACGCGCTGCTGGTGGCCCTTGTCCGGCAGCATGGCGCGCGACGGTGGAGCGTGATCAGCGCCAGTGTCCCCGGGCGCACGGGCAAGTCATGCCGGCTGCGGTGGTGCAACCAGCTCAGCCCGGCCGTGCAGCATCGCCCCTTCACAGTGCAGGAGGATGCGCTTATCATCGCCGCGCAGGCACGCTACGGCAACAAGTGGGCCGACATCGCGCGACTCCTCCCCGGCCGCACCGACAACTCCGTCAAGAACCACTGGAACTCCAACCTCCGCAGGTGCCAGCGCCGCGCCAAGGCCATGGCCGCTGCCACTGCCGCACGTGTCGCCGCCTCCTCCTCGTCGTCTGGATCGGCTGTGAGAGCGAAGATGCAGCAGGAGGAACAAGTCATGGTGATGAACAGGTCGCCACCAGCCGTCGTGCATGGTGCAGTTACTGCTGTTATTGATGACCCGATGCCAATGCTGTCACTGACCTTGAGCCTGGGCCTGCCCCAGATGGCCGCAGATAAGGCCTCAGAGGAGGCAAAGGCAAAGGCAAAGGAAAAGACACCACCACCAGTGGGTGTGGGGGGCAATGACGTGCGACTAATGGCGGCGATACGGCAGGTGGTGAGGGAAGAGGTGGAGCGGCAGGCAGGGCAGCTCTTGTACTCGGTTGTCATGGCCACCACCGCTGCCAGGGTCGACGGGGCATCATCGTCCGATCACCCAACCAACGGCCACCACTAA SEQ ID NO.15: ATGATTCCAGCCGTTGCTTGCGTCGGATACGACCGCACTGACGCGATGGAGGTGCCATCGCCGATCAAGACGGGGTCGTGGAGCCTGAGGAGGACGCGCTGCTGGTGGCCCTTGTCCGGCAGCATGGCGCGCGACGGTGGAGCGTGATCAGCGCCAGTGTCCCCGGGCGCACGGGCAAGTCATGCCGGCTGCGGTGGTGCAACCAGCTCAGCCCGGCCGTGCAGCATCGCCCCTTCACAGTGCAGGAGGATGCGCTTATCATCGCCGCGCAGGCACGCTACGGCAACAAGTGGGCCGACATCGCGCGACTCCTCCCCGGCCGCACCGACAACTCCGTCAAGAACCACTGGAACTCCAACCTCCGCAGGTGCCAGCGCCGCGCCAAGGCCATGGCCGCTGCCACTGCCGCACGTGTCGCCGCCTCCTCCTCGTCGTCTGGATCGGCTGTGAGAGCGAAGATGCAGCAGGAGGAACAAGTCATGGTGATGAACAGGTCGCCACCAGCCGTCGTGCATGGTGCAGTTACTGCTGTTATTGATGACCCGATGCCAATGCTGTCACTGACCTTGAGCCTGGGCCTGCCCCAGATGGCCGCAGATAAGGCCTCAGAGGAGGCAAAGGCAAAGGCAAAGGAAAAGACACCACCACCAGTGGGTGTGGGGGGCAATGACGTGCGACTAATGGCGGCGATACGGCAGGTGGTGAGGGAAGAGGTGGAGCGGCAGGCAGGGCAGCTCTTGTACTCGGTTGTCATGGCCACCACCGCTGCCAGGGTCGACGGGGCATCATCGTCCGATCACCCAACCAACGGCCACCACTAA SEQ ID NO.16: ATGATTCCAGCCGTTGCTTGCGTCGGATACGACCGCACTGACGCGATGGAGGTGCCATCGCCGATCAAGACGGGGTCGTGGAGCCAGCTGGTTGCACCACCGCAGCCGGCATGACTTGCCCGTGCGCCCGGGGACACTGGCGCTGATCACGCTCCACCGTCGCGCGCCATGCTGCCGGACAAGGGCCACCAGCAGCGCGTCCTCCTCAGCAGCCCGGCCGTGCAGCATCGCCCCTTCACAGTGCAGGAGGATGCGCTTATCATCGCCGCGCAGGCACGCTACGGCAACAAGTGGGCCGACATCGCGCGACTCCTCCCCGGCCGCACCGACAACTCCGTCAAGAACCACTGGAACTCCAACCTCCGCAGGTGCCAGCGCCGCGCCAAGGCCATGGCCGCTGCCACTGCCGCACGTGTCGCCGCCTCCTCCTCGTCGTCTGGATCGGCTGTGAGAGCGAAGATGCAGCAGGAGGAACAAGTCATGGTGATGAACAGGTCGCCACCAGCCGTCGTGCATGGTGCAGTTACTGCTGTTATTGATGACCCGATGCCAATGCTGTCACTGACCTTGAGCCTGGGCCTGCCCCAGATGGCCGCAGATAAGGCCTCAGAGGAGGCAAAGGCAAAGGCAAAGGAAAAGACACCACCACCAGTGGGTGTGGGGGGCAATGACGTGCGACTAATGGCGGCGATACGGCAGGTGGTGAGGGAAGAGGTGGAGCGGCAGGCAGGGCAGCTCTTGTACTCGGTTGTCATGGCCACCACCGCTGCCAGGGTCGACGGGGCATCATCGTCCGATCACCCAACCAACGGCCACCACTAA SEQ ID NO.17:ATGGAGGTGCCGGTGCCGATCAAGACGGGGTCGTGGAGCCCTGAGGAGGACGCGCTGCTGGTGGCCCTCGTCCGGCAGCATGGCGCGCGGCGGTGGAGCGTGATCAGTGCCGGCGTCCCCGGGCGCACGGGCAAGTCGTGCCGGCTGCGGTGGTGCAACCAGCTCAGCCCGGCCGTGCAGCACCGTCCCTTCACGGCGCAGGAGGACGCGCTCATCATCGCCGCGCAGTCGCGCTACGGCAACAAGTGGGCCGACATCGCGCGCCTCCTCCCCGGCCGCACCGACAACTCCGTCAAGAACCACTGGAACTCCAACCTCCGCAGGTGCCAGCGCCGCGCCAAGGCCATGGCCGCCGCCGCCGCCGCGCGTGCCGCCGCCTCCTCTTCCTCGTCGTCCGGATCGGCCGCGAGAGCCAAGACGCAACAGCAGGAACAGGTCGTGGTGATGAACGGGACGCCGCCGGCCGCCGTGCATGGAGCGGGTACTGCTGCCGTCGATGACCCGCTTCCAATGCCGTCGCTGACGCTGAGCCTGGGCCTGCCCCAGATGGCCGCGGACTGGGCGTCGGAGGAGGCAAAGGCAAAGGAAAAGGAAAAGACACCACCGCCGGTGGGCGTGGGGGACGGTGAAGTGCGGCTGATGGCGGCGATGCGGCAGCTGGTGAGGGAGGAGGTGGAGAGGCAGGCAGGGCAGCTCTTGTACTCGGTCATCATGGCCACCACCGCTGCCAGGGCCGACGGGACATCGCCGTCCGATGGCCCAACCAACGGCCACCACTAA SEQ ID NO.18: ATGGAGGTGCCGGTGCCGATCAAGACGGGGTCGTGGCCTGAGGAGGACGCGCTGCTGGTGGCCCTCGTCCGGCAGCATGGCGCGCGGCGGTGGAGCGTGATCAGTGCCGGCGTCCCCGGGCGCACGGGCAAGTCGTGCCGGCTGCGGTGGTGCAACCAGCTAGCCCGGCCGTGCAGCACCGTCCCTTCACGGCGCAGGAGGACGCGCTCATCATCGCCGCGCAGTCGCGCTACGGCAACAAGTGGGCCGACATCGCGCGCCTCCTCCCCGGCCGCACCGACAACTCCGTCAAGAACCACTGGAACTCCAACCTCCGCAGGTGCCAGCGCCGCGCCAAGGCCATGGCCGCCGCCGCCGCCGCGCGTGCCGCCGCCTCCTCTTCCTCGTCGTCCGGATCGGCCGCGAGAGCCAAGACGCAACAGCAGGAACAGGTCGTGGTGATGAACGGGACGCCGCCGGCCGCCGTGCATGGAGCGGGTACTGCTGCCGTCGATGACCCGCTTCCAATGCCGTCGCTGACGCTGAGCCTGGGCCTGCCCCAGATGGCCGCGGACTGGGCGTCGGAGGAGGCAAAGGCAAAGGAAAAGGAAAAGACACCACCGCCGGTGGGCGTGGGGGACGGTGAAGTGCGGCTGATGGCGGCGATGCGGCAGCTGGTGAGGGAGGAGGTGGAGAGGCAGGCAGGGCAGCTCTTGTACTCGGTCATCATGGCCACCACCGCTGCCAGGGCCGACGGGACATCGCCGTCCGATGGCCCAACCAACGGCCACCACTAA SEQ ID NO.19:ATGGAGGTGCCGGTGCCGATCAAGACGGGGTCGTGGAGCCAGCTGGTTGCACCACCGCAGCCGGCACGACTTGCCCGTGCGCCCGGGGACGCCGGCACTGATCACGCTCCACCGCCGCGCGCCATGCTGCCGGACGAGGGCCACCAGCAGCGCGTCCTCCTCAGGCAGCCCGGCCGTGCAGCACCGTCCCTTCACGGCGCAGGAGGACGCGCTCATCATCGCCGCGCAGTCGCGCTACGGCAACAAGTGGGCCGACATCGCGCGCCTCCTCCCCGGCCGCACCGACAACTCCGTCAAGAACCACTGGAACTCCAACCTCCGCAGGTGCCAGCGCCGCGCCAAGGCCATGGCCGCCGCCGCCGCCGCGCGTGCCGCCGCCTCCTCTTCCTCGTCGTCCGGATCGGCCGCGAGAGCCAAGACGCAACAGCAGGAACAGGTCGTGGTGATGAACGGGACGCCGCCGGCCGCCGTGCATGGAGCGGGTACTGCTGCCGTCGATGACCCGCTTCCAATGCCGTCGCTGACGCTGAGCCTGGGCCTGCCCCAGATGGCCGCGGACTGGGCGTCGGAGGAGGCAAAGGCAAAGGAAAAGGAAAAGACACCACCGCCGGTGGGCGTGGGGGACGGTGAAGTGCGGCTGATGGCGGCGATGCGGCAGCTGGTGAGGGAGGAGGTGGAGAGGCAGGCAGGGCAGCTCTTGTACTCGGTCATCATGGCCACCACCGCTGCCAGGGCCGACGGGACATCGCCGTCCGATGGCCCAACCAACGGCCACCACTAA SEQ ID NO.20: ATGGAGATGCCGGCGCCGATCAAGACGGGGTCGTGGAGCCCTGAGGAGGACGCCCTGCTGGTGGCCCTCGTCCGGCAGCATGGCGCGCGGCGGTGGAGCGTGATCAGCGCCGGCGTGCCCGGGCGCACGGGCAAGTCGTGCCGGCTGCGGTGGTGCAACCAGCTCAGCCCGGCCGTGCAGCACCGTCCTTTCACGGCGCAGGAGGACGCGCTCATCATCGCCGCGCAGGCGCGCTACGGCAACAAGTGGGCCGACATCGCGCGCCTCCTCCCCGGCCGCACCGACAACTCCGTCAAGAACCACTGGAACTCCAACCTCCGCAGGTGCCAGCGCCGCGCCAAGGCCATGGCCGCCGCCGCCGCCGCGCGTGCCGCCGCCTCCTCCTCGTCGTCGTCCGGATCGGCCGCGAGAGCCAAGACGCAACAGCAGGAACAGGTCGTGGTGATGAACGGGACGCCGCCGGCCGCCGTGCATGGAGCGGGTAGTGCTGCTGTCGATGACCCGCTGCCAATGCCGTCGCTGACGCTGAGCCTGGGCCTGCCCCAGATGGCCGCGGACAGGGCGTCGGAGGAGGCAAAGGCAAAGGAAAAGGAAAAGACACCACCGCCGGTGGGCGTGGGGGACGATGAAGTGCGGCTGATGGCGGCGATGCGGCAGATGGTGAGGGAAGAGGTGGAGAGGCAGGCAGGGCAGCTCTTGTACTCGGTCGTCATGGCCACCACCGCTGCCAGGACCGACGGGACATCGCCGTCCGATCGCCCAACCAACGGCCACCACTAA SEQ ID NO.21: ATGGAGATGCCGGCGCCGATCAAGACGGGGTCGTGGAGCCCAGCCCGGCCGTGCAGCACCGTCCTTTCACGGCGCAGGAGGACGCGCTCATCATCGCCGCGCAGGCGCGCTACGGCAACAAGTGGGCCGACATCGCGCGCCTCCTCCCCGGCCGCACCGACAACTCCGTCAAGAACCACTGGAACTCCAACCTCCGCAGGTGCCAGCGCCGCGCCAAGGCCATGGCCGCCGCCGCCGCCGCGCGTGCCGCCGCCTCCTCCTCGTCGTCGTCCGGATCGGCCGCGAGAGCCAAGACGCAACAGCAGGAACAGGTCGTGGTGATGAACGGGACGCCGCCGGCCGCCGTGCATGGAGCGGGTAGTGCTGCTGTCGATGACCCGCTGCCAATGCCGTCGCTGACGCTGAGCCTGGGCCTGCCCCAGATGGCCGCGGACAGGGCGTCGGAGGAGGCAAAGGCAAAGGAAAAGGAAAAGACACCACCGCCGGTGGGCGTGGGGGACGATGAAGTGCGGCTGATGGCGGCGATGCGGCAGATGGTGAGGGAAGAGGTGGAGAGGCAGGCAGGGCAGCTCTTGTACTCGGTCGTCATGGCCACCACCGCTGCCAGGACCGACGGGACATCGCCGTCCGATCGCCCAACCAACGGCCACCACTAA SEQ ID NO.22: ATGGAGATGCCGGCGCCGATCAAGACGGGGTCGTGGAGCCAGCCCGGCCGTGCAGCACCGTCCTTTCACGGCGCAGGAGGACGCGCTCATCATCGCCGCGCAGGCGCTACGGCAACAAGTGGGCCGACATCGCGCGCCTCCTCCCCGGCCGCACCGACAAC TCCGTCAAGAACCACTGGAACTCCAACCTCCGCAGGTGCCAGCGCCGCCAAGGCCATGGCCGCCGCCGCCGCCGCGCGTGCCGCCGCCTCCTCCTCGTCGTCGTCCGGATCGGCCGCGAGAGCCAAGACGCAACAGCAGGAACAGGTCGTGGTGATGAACGG GACGCCGCCGGCCGCCGTGCATGGAGCGGGTAGTGCTGCTGTCGATGACCCGCTGCCAATGCCGTCGCTGACGCTGAGCCTGGGCCTGCCCCAGATGGCCGCGGACAGGGCGTCGGAGGAGGCAAAGGCAAAGGAAAAGGAAAAGACACCACCGCCGGTGGGCG TGGGGGACGATGAAGTGCGGCTGATGGCGGCGATGCGGCAGATGGTGAGGGAAGAGGTGGAGAGGCAGGGCAGCTCTTGTACTCGGTCGTCATGGCCACCACCGCTGCCAGGACCGACGGGACATCGCCGTCCGATCGCCCAACCAACGGCCACCACTAA SEQ ID NO.23: TTTCCCAGTCACGACGTTGT SEQ ID NO.24: ATCTCTAGAGAGGGGCACGA The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0027] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0028] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. Wheat TaMYB44 A CRISPR / Cas9 gene editing vector for a gene, characterized in that: The vector uses pBUE414 as a backbone vector, and also includes an sgRNA expression frame and a Cas9 expression frame. The Cas9 expression frame is an expression frame for regulating Cas9 expression by the Ubi promoter. The sgRNA expression frame includes the following elements from upstream to downstream: TaU3 promoter, TaMYB44 sgRNA1, terminator OsU3t, promoter TaU3, TaMYB44 sgRNA2, terminator TaU3t, wherein TaMYB44 The sgRNA1 has the sequence shown in SEQ ID NO.1, TaMYB44 The sgRNA2 has the sequence shown in SEQ ID NO.

2.

2. The method for constructing the vector according to claim 1, characterized in that: The steps include: 1) Design targeting TaMYB44 sgRNA1 and sgRNA2 of the gene, primers for amplifying the OsU3t and TaU3 promoter backbone sequences were designed, and the sgRNA1 and sgRNA2 sequences were connected to the 5' end of the amplification primers, respectively, and the amplification primers were TaMYB44-gR1-F0 as shown in SEQ ID NO.3 and TaMYB44-gR2-R0 as shown in SEQ ID NO.4; 2) Design primers for amplifying the PCR product shown in step 1), and connect the BsaI restriction site sequence to the 5' end of the primer, the amplification primers are TaMYB44-gR1-F shown in SEQ ID NO.5 and TaMYB44-gR2-R shown in SEQ ID NO.6; 3) The four primers TaMYB44-gR1-F0, TaMYB44-gR2-R0, TaMYB44-gR1-F and TaMYB44-gR2-R were mixed to amplify the OsU3t and TaU3 promoter backbone sequences to obtain the PCR product shown in SEQ ID NO.7; 4) The PCR product obtained in step 3) was mixed with restriction endonuclease BsaI, restriction endonuclease buffer, pBUE414 vector plasmid, T4 ligase and 10xNEB T4 Buffer to perform vector restriction enzyme digestion and ligation reaction to obtain the final vector.

3. A transformant containing the vector according to claim 1.

4. The vector of claim 1 is used to knock out wheat TaMYB44 Application to genetic effects.

5. Use of the vector according to claim 1 in improving wheat quality.

6. A DNA fragment, characterized in that This DNA fragment is TaMYB44 The guide sgRNA of the gene is composed of, and its sequence is shown in SEQ ID NO.1 and SEQ ID NO.2.

Images