A SNP molecular marker of LRRK1 gene associated with duck slaughter rate and its application

Through whole-genome association analysis and identification of LRRK1 gene SNP sites, the problem of slow improvement in the slaughter rate of Loumen ducks in existing breeding methods was solved, and molecular marker-assisted selection of ducks with high slaughter rates was achieved, thereby improving breeding efficiency.

CN119287023BActive Publication Date: 2025-09-23JIANGSU INST OF POULTRY SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411447647.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-16
Publication Date
2025-09-23
Estimated Expiration
2044-10-16

AI Technical Summary

Technical Problem

The effectiveness of existing breeding methods in improving the slaughter rate of Loumen ducks is gradually decreasing, and it is difficult to quickly identify molecular markers that significantly affect the slaughter rate at the genomic level, resulting in slow breeding progress.

Method used

Through whole-genome association analysis, the LRRK1 gene SNP site (T/C) on chromosome NC_040056.1 of Loumen duck was discovered. Specific primers were designed for PCR amplification and Sanger sequencing to quickly identify the TT genotype to achieve molecular marker-assisted selection and improve the slaughter rate.

Benefits of technology

It significantly improved the slaughter rate of Loumen ducks at 10 weeks of age, provided a reliable way to quickly identify ducks with high slaughter rates, and promoted the breeding process of meat ducks.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119287023B_ABST
    Figure CN119287023B_ABST
Patent Text Reader

Abstract

The present invention relates to a LRRK1 gene SNP molecular marker associated with duck slaughter rate and its application, belonging to the technical field of molecular biology. The present invention uses whole-genome association analysis to discover for the first time the presence of a SNP site on the NC_040056.1 chromosome of Loumen ducks that is associated with the growth traits of meat ducks. This site significantly affects the slaughter rate of Loumen ducks at 10 weeks of age, and the TT genotype is an excellent genotype. Therefore, the present invention provides a pair of upstream and downstream primers for amplifying the flanking sequences of the molecular marker, performing genotyping of the molecular marker through the flanking sequences, and implementing molecular marker-assisted selection based on the typing results. The beneficial effect is that the slaughter rate of ducks can be quickly identified, providing a reliable way to select or cultivate local sheldon duck varieties with faster growth rates and higher slaughter rates, thereby accelerating the breeding process of meat ducks.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to an LRRK1 gene SNP molecular marker associated with duck slaughter rate and application thereof, belonging to the technical field of molecular biology. Background Art

[0002] Loumen ducks are renowned for their excellent meat quality and are among the fastest-growing dual-purpose ducks. They are commonly used in delicacies such as aozao noodles in southern Jiangsu, and their development and utilization prospects are promising. As a dual-purpose duck, meat performance is a key economic indicator for Loumen ducks, with the dressing rate directly determining the selling price of their white strip meat. Therefore, rapidly improving the dressing rate of Loumen ducks is a key research and application area for poultry breeders. Currently, conventional breeding methods use pedigrees and phenotypes to calculate breeding values, and then select and match based on these values. This approach has some effectiveness in breeding practice, but after a certain stage of selection, genetic progress gradually decreases, and the breeding effect gradually deteriorates. Advances in molecular biology techniques have made it possible to perform genotyping on individuals at the genomic level and, combined with phenotypic analysis, identify molecular markers that significantly influence specific phenotypes. These important molecular markers can be used in breeding, combined with pedigrees and phenotypic values, for marker-assisted selection, improving selection effectiveness. For specific breeds and traits, it is crucial to identify molecular markers that have a significant phenotypic impact and can be rapidly identified. Summary of the Invention

[0003] The purpose of the present invention is to address the defects of the existing technology, propose a SNP molecular marker related to duck slaughter rate and its application, and provide a reliable way to select or cultivate local sheldon duck varieties with high slaughter rate.

[0004] The present invention first provides a LRRK1 gene SNP molecular marker associated with duck slaughter rate. The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 3 or SEQ ID NO: 4. The SNP site is located at position 3237972 on chromosome NC_040056.1 of Loumen duck. The base is T or C, and the genotype is TT, TC, or CC. This mutation site significantly affects the slaughter rate of Loumen ducks, where the slaughter rate of individuals with the TT genotype is significantly higher than that of individuals with the TC and CC genotypes.

[0005] The present invention determines the slaughter rate of the Loumen duck population at market age (10 weeks old), collects blood from each individual, and resequences the genome. The molecular markers significantly associated with the slaughter rate are found through the GWAS method. The molecular markers and phenotypes are statistically analyzed, and the slaughter rate differences between different genotypes at this site are significant.

[0006] The present invention further provides an application of a LRRK1 gene SNP molecular marker associated with duck slaughter rate, wherein the detection method comprises the following steps:

[0007] Step 1: Extract the total genomic DNA of the duck to be tested;

[0008] Step 2: Using the total genomic DNA of the duck to be tested as a template, PCR amplification is performed using the duck DNA-specific primers shown in SEQ ID NO: 1 and SEQ ID NO: 2 to obtain an amplified product;

[0009] Step 3: Sanger sequencing of the PCR product;

[0010] Step 4: Determine the SNP molecular marker genotype based on the sequencing peak graph.

[0011] In step 1, the final concentration of the reaction system in 25 μl is:

[0012] 50 ng of duck DNA to be tested

[0013] 2 x Accurate Taq Master Mix 12.5μl

[0014] Upstream primer 1 μl

[0015] Downstream primer 1 μl

[0016] Add sterile water to 25 μl.

[0017] The sequence of the upstream primer F is shown in SEQ ID NO: 1, and the downstream primer R

[0018] The sequence is shown in SEQ ID NO: 2;

[0019] The reaction conditions of the PCR amplification are as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; and storage at 20°C.

[0020] In the step 4, the judgment standard is the slaughter rate of individuals with TT genotype at the SNP site.

[0021] The slaughter rate was significantly higher than that of individuals with TC and CC genotypes.

[0022] The above method can be applied to the breeding of Loumen ducks. Loumen duck breeding involves the breeding of a core group of Loumen ducks. The core group is a group of individuals within the Loumen duck breed that participate in breeding and are ranked in the top 20% of performance phenotypic values ​​related to the breeding objectives.

[0023] This study, using genome-wide association analysis, discovered for the first time a single-nucleotide polymorphism (SNP) site (T / C) on chromosome NC_040056.1 of Loumen ducks, which is associated with meat duck growth traits. This site significantly affects the 10-week-old slaughter rate of Loumen ducks, with the TT genotype representing a superior genotype. Therefore, the present invention provides a pair of upstream and downstream primers (SEQ ID NO:1 and SEQ ID NO:2) for amplifying the flanking sequences of this molecular marker (SEQ ID NO:3 or SEQ ID NO:4). Genotyping of the molecular marker using these flanking sequences is then performed using marker-assisted selection (MAS). This approach has the beneficial effect of enabling rapid identification of duck slaughter rates, providing a reliable approach for selecting or cultivating local shelduck breeds with faster growth rates and higher slaughter rates, and accelerating the breeding process for meat ducks. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the Manhattan plot of genome association analysis. The horizontal axis is chromosome, showing that a site on chromosome NC_040056.1 is significantly correlated with slaughter rate.

[0025] Figure 2 These are the peak graphs of three genotypes: TT, TC and CC. DETAILED DESCRIPTION

[0026] Example

[0027] This embodiment detects the LRRK1 gene SNP molecular marker associated with duck slaughter rate according to the following method. The detection method includes the following steps:

[0028] Step 1: Extract the total genomic DNA of the duck to be tested;

[0029] Step 2: Using the total genomic DNA of the duck to be tested as a template, PCR amplification is performed using the duck DNA-specific primers shown in SEQ ID NO: 1 and SEQ ID NO: 2 to obtain an amplified product;

[0030] Step 3: Sanger sequencing of the PCR product;

[0031] Step 4: Determine the SNP molecular marker genotype based on the sequencing peak graph.

[0032] In step 1, the final concentration of the reaction system in 25 μl is:

[0033] 50 ng of duck DNA to be tested

[0034] 2 x Accurate Taq Master Mix 12.5μl

[0035] Upstream primer 1 μl

[0036] Downstream primer 1 μl

[0037] Add sterile water to 25 μl.

[0038] The sequence of the upstream primer F is shown in SEQ ID NO: 1, and the sequence of the downstream primer R is shown in SEQ ID NO: 2. The PCR amplification reaction conditions are: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 60 sec, for a total of 30 cycles; 72°C extension for 2 min; and storage at 20°C. Specifically:

[0039] The body weight and carcass weight of 500 Loumen ducks at 10 weeks of age were measured, and the slaughter rate was calculated. After blood was collected from the wing vein, genomic DNA was extracted. The whole genome was sequenced using Illumina's HiSeq X-Ten sequencing platform, and the sequencing depth of each individual was 10×. After the data were quality controlled, BWA and GATK software were used for sequence alignment and genotype extraction. Combined with the 10-week-old slaughter rate and genotyping data, rMVP software was used to perform GWAS analysis of mixed linear models. The results are shown in Figure 2. Figure 1 Results showed that the T-to-C mutation at locus 3237972 on chromosome 11 (NC_040056.1) was significantly associated with the slaughter rate of Loumen ducks at 10 weeks of age. The slaughter rates of the TT genotype, TC genotype, and CC genotype were 88.96% ± 1.54%, 85.42% ± 4.92%, and 84.39% ± 2.73%, respectively. The slaughter rates of the TT genotype were significantly higher than those of the TC and CC genotypes (P < 0.05). The number of individuals with the GG, GC, and CC genotypes was 331, 148, and 21, respectively, conforming to the Hardy-Weinberg equilibrium (P = 0.4716).

[0040] Primer design for identifying the nucleotide polymorphism of NC_040056.1:3237972

[0041] Based on the whole genome sequencing results, primers for identifying the nucleotide polymorphism at position NC_040056.1: 3237972 on the duck genome were designed as follows:

[0042] Upstream primer: ATGCTGGCCCTGCTAAACAT (SEQ ID NO: 1)

[0043] Downstream primer: ATGGGGAGAGCTTTTGCCTC (SEQ ID NO: 2)

[0044] The amplified product bands are:

[0045] ATGCTGGCCCTGCTAAACATACTGTGGGTTTGCCGACCTGGACTGCTCCTCGCGTGACACAGAACACTGTTTGGCTTCAGAGCTCTCTGTAATTTTGTCTCACTTGCTTTGAAAATGCTGAATTATCCAAGCATAGTCTTCAAAAAAAAATTTATTTCCTTGATTAGTGTCAGCTCCTGTAAAAGAATCACGATTCCCTCTGGATTGGATAGGCCAAAGCCCCCCTGCACTGAGAAAGCAACACCACAACCAGGCAGAGCTGCACCAGTTATACCCACCGAGCTTTACTGCTTGTACCAACCATGCCAAATTTTAGCCTGTCTAGACTACGGTGGGAGCAAATCTGAAAGATGTTTTATGCTTTGGGGCACTTACAACTCATAGACTTGGCTGTCAGGATTTTTTAATCCACTACTACCACCTCTTTGTTTAGGAAAGGAGGAGTAAGAGCTCAAAATCTCGAGAAATGCCCTCTACCTGCCATCCCTCGCCTGACGAGGACAAGGAGGTGACCCACTTCACATAAGAGTGCCCCTGGGTGCTACGGACCCACCAGACTTCGTTAGGTGCTGGTGAGGCAAAAGCTCTCCCCAT(SEQID NO:3)

[0046] (SEQ ID NO: 4)

[0047] Note: The 425th base is a mutant base.

[0048] Genotyping verification of Loumen duck population

[0049] Experimental materials: The population other than the genome resequencing at the Kunshan Loumen Duck Conservation Farm (a total of 600 ducks)

[0050] The first step is to obtain the genotype of each individual

[0051] 1. Determine the slaughter rate of 600 ducks at 10 weeks of age;

[0052] 2. Blood sample collection: Blood was collected from the wing vein of each duck using EDTA2K vacuum blood collection tubes and stored at -20℃ for later use;

[0053] 3. Whole blood genomic DNA extraction;

[0054] 4. Genotype determination: Take the genomic DNA of each duck to be tested as a template and perform PCR amplification using the primers designed in Example 2. The obtained product is sequenced by Sanger sequencing to obtain the following sequence: Figure 2 The three genotypes shown are TT, TC, and CC, and the genotype of each individual is determined.

[0055] Step 2: SNP site and phenotype association analysis verification

[0056] 1. Grouping by genotyping information: The genotypes of the mutation sites were examined based on the sequence information. The genotypes were divided into TT, TC, and CC genotype groups, with 401, 180, and 19 individuals in each group, respectively. The genotype distribution conformed to the Hardy-Weinberg equilibrium (P value was 0.890).

[0057] 2. The 10-week-old slaughter rates of the TT, TC, and CC genotype groups were 89.73%±2.37%, 84.28%±3.55%, and 85.11%±2.88%, respectively. A variance analysis of the 10-week-old slaughter rates of the different genotype groups revealed a significant correlation between genotype differences and slaughter rates. The TT genotype group had a significantly higher slaughter rate than the TC and GC genotype groups, indicating that the TT genotype is an excellent genotype for the slaughter rate trait. Homozygous genotypes at this locus can significantly improve the 10-week-old slaughter rate of Loumen ducks.

[0058] In addition to the above embodiments, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the scope of protection required by the present invention.

Claims

1. A single nucleotide polymorphism (SNP) molecular marker of the LRRK1 gene associated with duck slaughter rate, characterized by: The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 3 or SEQ ID NO:

4. The molecular marker is located at position 425 of SEQ ID NO: 3 or SEQ ID NO: 4, the base is T or C, and the genotype is TT, TC or CC.

2. The use of the LRRK1 gene SNP molecular marker associated with duck slaughter rate according to claim 1, characterized in that: Used for molecular detection of the slaughter rate of Loumen duck breed at 10 weeks of age, the nucleotide sequences of the duck DNA specific primer pair required for the molecular marker detection are shown as SEQ ID NO: 1 and SEQ ID NO: 2, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO: 3 or SEQ ID NO:

4.

3. The use of the LRRK1 gene SNP molecular marker associated with duck slaughter rate according to claim 2, characterized in that: The detection method comprises the following steps, Step 1: Extract the total genomic DNA of the duck to be tested; Step 2: Using the total genomic DNA of the duck to be tested as a template, PCR amplification is performed using the duck DNA-specific primers shown in SEQ ID NO: 1 and SEQ ID NO: 2 to obtain an amplified product; Step 3: Sanger sequencing of the PCR product; Step 4: Determine the SNP molecular marker genotype based on the sequencing peak graph.

4. The use of the LRRK1 gene SNP molecular marker associated with duck slaughter rate according to claim 3, characterized in that: In step 1, the final concentration of the reaction system in 25 μl is: 50 ng of duck DNA to be tested 2 x Accurate Taq Master Mix 12.5μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl; The sequence of the upstream primer F is shown in SEQ ID NO: 1, and the sequence of the downstream primer R is shown in SEQ ID NO: 2; The reaction conditions of the PCR amplification are as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; and storage at 20°C.

5. The use of the LRRK1 gene SNP molecular marker associated with duck slaughter rate according to claim 3, characterized in that: In the step 4, the judgment criterion is that the slaughter rate of individuals with the TT genotype at the SNP site is significantly higher than the slaughter rates of individuals with the TC genotype and the CC genotype.

6. The use of the LRRK1 gene SNP molecular marker associated with duck slaughter rate according to claim 2, characterized in that: The breeding of Loumen duck breed is the breeding of the core group of Loumen duck.

7. The use of the LRRK1 gene SNP molecular marker associated with duck slaughter rate according to claim 6, characterized in that: The Loumen duck core group is a group composed of the top 20% of individuals in the Loumen duck breed that participated in breeding and measurement of performance phenotypic values ​​related to breeding goals.

Citation Information

Patent Citations

  • Molecular marker associated with duck growth and slaughter characteristics and application thereof

    CN102604939A

  • SNP (Single Nucleotide Polymorphism) site related to growth and development of melanmen ducks and application of SNP site

    CN116064841A