Haploid SNP (Single Nucleotide Polymorphism) molecular marker combination related to egg quality character in SLC25A38 gene, primer pair and application of haplotype SNP molecular marker combination and primer pair

Abstract

The invention discloses a haplotype SNP molecular marker combination related to egg quality characters in an SLC25A38 gene, a primer pair and application of the haplotype SNP molecular marker combination and the primer pair, and relates to the field of poultry molecular marker screening. The molecular marker is cloned from an SLC25A38 gene of a laying hen, five SNP markers significantly related to the egg quality traits are screened, and association analysis is performed on the egg quality traits by using a haplotype composed of one or a combined marker of the five SNP markers. The sequences of the five SNP markers of the SLC25A38 gene are as shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3. The invention also discloses a primer pair for detecting the molecular marker, a method for screening egg quality traits and application of the molecular marker in assistant breeding of laying hens or assistant selection of the egg quality traits. The provided haplotype SNP molecular marker combination can be used as a haplotype molecular marker related to the eggshell color L, the eggshell strength and the SCI character, and a new molecular breeding marker is provided for marker-assisted breeding of the eggshell color L, the eggshell strength and the SCI character.

Description

Technical Field

[0001] The invention relates to the technical field of laying hen genetic marker screening, and in particular to a haplotype SNP molecular marker combination related to laying hen egg quality traits in a SLC25A38 gene, a primer pair and an application thereof. Background Art

[0002] With the improvement of living standards, people are increasingly pursuing high-quality livestock and poultry products. Eggs have become one of the most popular foods because of their high nutritional value and effective conversion rate of more than 98%. Although eggshell color and eggshell strength cannot determine the quality and nutritional value of eggs, consumers often use eggshell color as an intuitive trait when buying eggs. At the same time, since eggshell strength affects the breakage rate of eggs, it is also valued by people. At present, there are four main types of eggs on the market, brown-shell eggs, powder-shell eggs, white-shell eggs and green-shell eggs, among which brown-shell eggs and powder-shell eggs occupy the main market in my country. In production practice, it was found that there were phenomena such as uneven brown-shell egg color and lighter eggshell color in the brown-shell laying hen group, which restricted the breeding benefits of breeders. The depth of the brown color of the eggshell depends on the total amount of protoporphyrin IX in the eggshell. The color of brown-shelled eggs produced by different individuals of the same breed is different. This is because the ability to synthesize protoporphyrin varies among individual laying hens and is related to the individual's genetic basis. In addition, the brownness of the eggshells of eggs produced by the same individual at different egg-laying stages also varies to a certain extent. This may be related to multiple factors, such as age, stress, nutrition, drugs, and diseases, which can affect the color uniformity of brown-shelled eggs, causing the color of brown-shelled eggs to vary from dark brown to light brown.

[0003] The main pigment component in brown eggs is protoporphyrin IX, which is the prerequisite for heme synthesis. The first step in heme biosynthesis is the condensation of glycine and succinyl coenzyme A to form δ-aminolevulinic acid (ALA), which is catalyzed to condense into porphyrinogen, and 4 molecules of porphyrinogen further condense into uroporphyrinogen III, which is decarboxylated to form coproporphyrinogen III, which is oxidized and decarboxylated to form protoporphyrin IX, which is then catalyzed by ferrous chelatase to incorporate ferrous iron into protoporphyrin IX to form heme. Aminolevulinate synthase 1 (ALAS1) is the first rate-limiting enzyme in the process of heme synthesis. It is ubiquitously expressed in most non-erythroid tissues that produce heme. The rate of heme synthesis is controlled by the level of ALAS1. The first step of ALAS1-mediated protoporphyrin IX synthesis is the condensation of succinyl-CoA and glycine to produce ALA in the mitochondrial matrix, which is a rate-limiting step in the synthesis of protoporphyrin IX. Solute transporter SLC25A38 (Solute Carrier Family 25Member 38, SLC25A38) is a member of the solute carrier family 25 and is a pro-apoptotic protein encoded and expressed by the SLC25A38 gene. The SLC25 protein family is widely present in eukaryotes, also known as the mitochondrial carrier family. They transport amino acids, fatty acids, carboxylic acids, cofactors, inorganic ions and nucleotides across the inner membrane of mitochondria for important cellular processes such as oxidative phosphorylation, amino acid degradation and heme biosynthesis. The SLC25A38 protein encoded by the SLC25A38 gene is an amino acid transporter composed of 288 amino acids. It has been confirmed to be the main mitochondrial glycine transporter required for heme biosynthesis. It can promote the production of ALA by transporting glycine to mitochondria or exchanging glycine through the mitochondrial inner membrane of red blood cells, accelerate the synthesis of heme, and increase the content of protoporphyrin IX.

[0004] However, to date, there has been no report on the research of SLC25A38 gene in laying hens, and there is no research on using SLC25A38 gene in laying hens as a molecular marker for egg quality traits. Summary of the invention

[0005] The present invention provides a haplotype SNP molecular marker combination related to laying hen egg quality traits in the SLC25A38 gene, a primer pair and an application thereof, aiming to solve the problems existing in the above-mentioned background technology.

[0006] In order to achieve the above technical objectives, the present invention mainly adopts the following technical solutions:

[0007] In the first aspect, the present invention discloses a haplotype SNP molecular marker combination related to egg quality traits in the SLC25A38 gene, wherein the egg quality traits include one or more of eggshell color L, eggshell strength, and SCI; the SNP molecular marker is located in the coding region of the SLC25A38 gene of laying hens, including SNP site 1, SNP site 2, SNP site 3, SNP site 4, and SNP site 5;

[0008] The SNP site 1 is at position 473 of the sequence shown in SEQ ID NO: 1, or position 3515 of the reverse complementary sequence of the SLC25A38 gene, and there is an A / G mutation;

[0009] The SNP site 2 is at position 603 of the sequence shown in SEQ ID NO: 1, or position 3645 of the reverse complementary sequence of the SLC25A38 gene, and there is a T / C mutation;

[0010] The SNP site 3 is at position 566 of the sequence shown in SEQ ID NO: 2, or position 4247 of the reverse complementary sequence of the SLC25A38 gene, and there is a G / A mutation;

[0011] The SNP site 4 is at position 350 of the sequence shown in SEQ ID NO: 3, or position 5431 of the reverse complementary sequence of the SLC25A38 gene, and there is an A / G mutation;

[0012] The SNP site 5 is at the 413th position of the sequence shown in SEQ ID NO: 3, or the 5494th position of the reverse complementary sequence of the SLC25A38 gene, and there is a C / G mutation.

[0013] In a preferred embodiment of the present invention, when the SNP molecular marker combination is ATGAC / ATGAC haplotype, the eggshell color L and SCI are significantly better than other haplotype combinations; when the SNP molecular marker combination is ACAAC / ATGAC haplotype, the eggshell strength is significantly better than other haplotype combinations.

[0014] In a second aspect, the present invention discloses an application of the haplotype SNP molecular marker combination as described in the first aspect in assisted breeding of laying hens or assisted selection of laying hen egg quality traits.

[0015] In the third aspect, the present invention discloses a primer for detecting the SNP site 1 and / or SNP site 2 described in the first aspect, characterized in that the nucleotide sequence is: the nucleotide sequence of the upstream primer 1-F is as shown in SEQ ID NO: 4, and the nucleotide sequence of the downstream primer 1-R is as shown in SEQ ID NO: 5.

[0016] In a fourth aspect, the present invention discloses a primer for detecting the SNP site 3 described in the first aspect, characterized in that the nucleotide sequence is: the nucleotide sequence of the upstream primer 2-F is as shown in SEQ ID NO: 6, and the nucleotide sequence of the downstream primer 2-R is as shown in SEQ ID NO: 7.

[0017] In the fifth aspect, the present invention discloses a primer for detecting the SNP site 4 and / or SNP site 5 described in the first aspect, characterized in that the nucleotide sequence is: the nucleotide sequence of the upstream primer 3-F is as shown in SEQ ID NO: 8, and the nucleotide sequence of the downstream primer 3-R is as shown in SEQ ID NO: 9.

[0018] In a sixth aspect, the present invention discloses an application of the primers as described in any one of the third aspect, the fourth aspect, and the fifth aspect in assisted breeding of laying hens or assisted selection of laying hen egg quality traits.

[0019] In the seventh aspect, the present invention discloses a kit for detecting egg quality traits of laying hens, wherein the egg quality traits of laying hens include one or more of eggshell color L, eggshell strength, and SCI; and includes the primers described in the third aspect, the fourth aspect, and the fifth aspect.

[0020] In an eighth aspect, the present invention discloses a use of the kit as described in the seventh aspect in detecting egg quality traits of laying hen.

[0021] In a ninth aspect, the present invention discloses a method for screening egg quality traits of laying hen, wherein the egg quality traits of laying hen include one or more of eggshell color L, eggshell strength, and SCI; the method comprises the following steps:

[0022] (1) Extracting genomic DNA from laying hen blood;

[0023] (2) using the primers described in the third aspect to perform PCR amplification to obtain the sequence shown in SEQ ID NO: 1 in the first aspect; using the primers described in the fourth aspect to perform PCR amplification to obtain the sequence shown in SEQ ID NO: 2 in the first aspect; using the primers described in the fifth aspect to perform PCR amplification to obtain the sequence shown in SEQ ID NO: 3 in the first aspect;

[0024] (3) sequencing the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, screening the DNA sequence mutation sites, and analyzing the haplotype combination of the SLC25A38 gene;

[0025] (4) Select individuals with the haplotype combination of ATGAC / ATGAC or ACAAC / ATGAC.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] The present invention discovers a haplotype SNP molecular marker combination related to laying hen egg quality traits, provides a reference basis for assisted selection of laying hen egg quality traits, and the provided haplotype SNP molecular marker combination can be used as a haplotype molecular marker related to eggshell color L, eggshell strength, and SCI traits, providing a new molecular breeding marker for marker-assisted breeding of laying hen egg color L, eggshell strength, and SCI traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The results of agarose gel detection of the PCR amplification products of the laying hen SLC25A38 gene fragment using primers 1-F and 1-R, where M is a marker and 1-4 are the amplification results of the SLC25A38 gene fragment;

[0029] Figure 2 The results of agarose gel detection of the PCR amplification products of the laying hen SLC25A38 gene fragment using 2-F and 2-R primers, where M is a marker and 1-4 are the amplification results of the SLC25A38 gene fragment;

[0030] Figure 3 The results of agarose gel detection of the PCR amplification products of the laying hen SLC25A38 gene fragment using 3-F and 3-R primers, where M is a marker and 1-4 are the amplification results of the SLC25A38 gene fragment;

[0031] Figure 4 Comparison of sequencing results of individuals with different genotypes at 5 SNP polymorphism sites of SLC25A38 gene in laying hens; (a) There is an A / G mutation site at 3515bp of the reverse complementary sequence of SLC25A38 gene; (b) There is a T / C mutation site at 3645bp of the reverse complementary sequence of SLC25A38 gene; (c) There is a G / A mutation site at 4247bp of the reverse complementary sequence of SLC25A38 gene; (d) There is an A / G mutation site at 5431bp of the reverse complementary sequence of SLC25A38 gene; (e) There is a C / G mutation site at 5494bp of the reverse complementary sequence of SLC25A38 gene;

[0032] Figure 5 This is the result of haplotype block analysis of the SLC25A38 gene. DETAILED DESCRIPTION

[0033] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples of the specification. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0034] Example 1 Obtaining a fragment of the partial coding region of the laying hen SLC25A38 gene and establishing a SNP detection method

[0035] 1. Extraction of genomic DNA from laying hens

[0036] The experimental laying hen breed of the present invention is Luodao Red Chicken, and the sample comes from the poultry test field of the Institute of Animal Husbandry and Veterinary Medicine of Hubei Academy of Agricultural Sciences. The blood genomic DNA is extracted using the blood / cell / tissue genomic DNA extraction kit of Tiangen Biochemical Technology Co., Ltd. The specific steps are as follows:

[0037] (1) Use a disposable syringe to draw about 1 ml of blood from the vein under the chicken wing, store it in a 1.5 ml anticoagulant blood collection tube containing sodium citrate, shake it gently, record the wing number, and store it at -20°C for later use. Draw 20 μL of anticoagulant blood, add 180 μL of GA buffer and 20 μL of proteinase K solution, and mix thoroughly;

[0038] (2) Add 200 μl of buffer GB, mix thoroughly by inversion, and place at 70°C for 10 min. The solution should become clear and centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0039] (3) Add 200 μl of anhydrous ethanol, shake thoroughly for 15 seconds, and centrifuge briefly;

[0040] (4) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3, centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid;

[0041] (5) Add 500 μl of buffer GD to the adsorption column CB3, centrifuge at 12,000 rpm for 30 s, and discard the waste liquid;

[0042] (6) Add 600 μl of rinse solution PW to the adsorption column CB3, centrifuge at 12,000 rpm for 30 s, and discard the waste solution;

[0043] (7) Repeat the previous step;

[0044] (8) Centrifugation at 12000 rpm for 2 min to completely remove residual PW;

[0045] (9) Place the adsorption column in a clean centrifuge tube, add 50-200 μl of elution buffer TE in the center of the column, let stand at room temperature for 2-5 min, centrifuge at 12000 rpm for 2 min to elute the DNA, and store the eluted DNA at -20°C for later use.

[0046] 2. Obtaining a partial nucleotide fragment of the laying hen SLC25A38 gene

[0047] Primer pairs were designed based on the laying hen SLC25A38 gene sequence published in the NCBI database (Accession No. Gene ID: 420717), and three pairs of primers were designed based on the reverse complementary sequence of the sequence. The sequences of the primer pairs are as follows:

[0048] Upstream primer 1-F: 5'-AGCAAGGAACATGCGAGCAAGTT-3' (shown in SEQ ID NO: 4),

[0049] Downstream primer 1-R: 5'-TCCTGAAGCAGATTGAAGCTATTGC-3' (shown in SEQ ID NO: 5).

[0050] Upstream primer 2-F: 5'-ATCCACGCTTACGTTACATTCAG-3' (shown in SEQ ID NO: 6),

[0051] Downstream primer 2-R: 5'-TGAGACTGAATCTCTTGTCAGTG-3' (shown in SEQ ID NO: 7).

[0052] Upstream primer 3-F: 5'-GCAGTCAGTGCTAAGGAACCGAATG-3' (shown in SEQ ID NO: 8),

[0053] Downstream primer 3-R: 5'-TTGGACCACAAGTGCCAAGCCAT-3' (shown in SEQ ID NO: 9).

[0054] The above primers were used to perform PCR amplification in laying hen genomic DNA. The PCR reaction system is shown in Table 1, and the PCR reaction conditions are shown in Table 2.

[0055] Table 1 PCR reaction system

[0056]

[0057] Table 2 PCR reaction conditions

[0058]

[0059] The PCR amplification products were detected by agarose gel electrophoresis. Figure 1-Figure 3

[0060] 3. Detection of molecular markers using direct sequencing of PCR products

[0061] The PCR products obtained above were directly sent to Beijing Aoke Dingsheng Biotechnology Co., Ltd. for sequencing. The returned sequencing results were compared with the reverse complementary sequences to determine the mutation site and the genotype of the site in the test population. Blast analysis was performed using DNAStar software, and the results were as follows: Figure 4 As shown, five allele mutation sites, namely A / G, T / C, G / A, A / G and C / G, were found at 3515bp, 3645bp, 4247bp, 5431bp and 5494bp of the reverse complementary sequence of the gene, respectively. The above mutations caused the polymorphism of the SLC25A38 gene, forming a total of 11 haplotypes, namely ACAAC, ATGAC, GCGGG, ACGGG, GTGGG, ATGGG, ATAAC, ATGGC, ACGAC, ATGAG, ACGAG

[0062] The nucleotide sequences of the above five SNP markers refer to the sequence table SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

[0063] SEQ ID NO: 1

[0064] agcaaggaacatgcgagcaagttctgcagtcaacattgccctcactgttttctcctcaaacgcttttgttcagcaatttctcattgcacaaaggtggtaagcacggagctatttttaaaatgggcttctctcaacatagataccatgctgtggaaaccctgcccaaggcagtcccaggtacagtccttccggaatgcattgatcaaaagatgcgaagatttgatccttctttcttctacttccctaaaggcctaatcctctgtctcagaagggctttcttcctcccagctgagcaaggcttattcctccatggaactgggaacttcccagtgccagctggtcacagcacgcaggagaaggagtgaggctggtcagttctagtgcaagtcagtcaagatttcaagcccattttttccatcatctgttcatatacagtccacgccattgctgccatcagagtacgcctgagggcR(A or G)cgaggcacaccacctcggaagaagccaaccaagccaaagtcctgcagcagaaaacaaacagcaatccattaccatctgcctccagcatttta attcttcatcatttttttttacatggaacaacccacaY(T or C)tgtatttcagctcagatccagatcagcctctgaaagatccacgcttacgttacattcagcctttaggaagaacccaaaccactgtgcaattacagg gcacccactgaaaaaggaaggagaagggtatgccaggatgacaaaggacagggaaagccacactcaagcctgacatagagaaggtgaaggagcaatagcttcaatctgcttcagga

[0065] SEQ ID NO: 2

[0066] atccacgcttacgttacattcagcctttaggaagaacccaaaccactgtgcaattacagggcacccactgaaaaaggaaggagaagggtatgccaggatgacaaaggacagggaaagccacactcaagcctgacatagagaaggtgaaggagcaatagcttcaatctgcttcaggaaaatgacttgtccttgttttagagctcattcttgttcacaaagtaacgtaactgttctttaaaaactgaagtttgtaagtgctgaaaataaatacatctgttaggaaacggttcgtgcacaagaaaaaaaaaagaaaatccatacacaaatacagattcttgtttaggaaagaaaacaaagcaaagctgctaagatccactacatactaaggaaaccctttgccttagtgcggtaattacagatgtgcctacatggataaaccagaggtggcagcagctgcaagcacagctcttccaagctcatgttcagagctaaagtcaccaccagtgtgaagacaaaggcatagcagacaactgaagtgtaatcattcagcagcttgatgcatgagR(G or A)cagatctgtgtggagagatgcttggtggaattatagcacaaaggtgggcatagcctactcttcaactgcctgtcttctgtaattttgtgcaaacagttaaaggatttgagaatggcaagagtaattggggagcaagttccactcccttgtaatccattcaagaggagcaggaaataatctgagtagtgataatagcctcttaattacaaggaaactcaaggaatggactgaaacttctgccttcaaaccatctaccacagtacccttccagttaatttcccaagcaggtccacatgaaaaacactgacaagagattcagtctca

[0067] SEQ ID NO: 3

[0068] gcagtcagtgctaaggaaccgaatgtaacaggaactcagataaggaaaagttgtttaagtcttgcctcagccagttctacaaccagagaaaccccagcttagtggaaactaatcagtatacaagacaaacagcagaagaaaccactgctgaacacatcctctctttcagttcctcactaacctaacttacgtatcactcacctaccttaagcatgagtcttcaaaaagacagtacattttgggcccatttccacttctatactgacatgagatctacagttttccacaagcaaaaggcaaacatctcacctaaagccctacaagagagtaactgaactactgatgatgcR(A or G)tgcaataagcgaagcagcgacttttatggcacaatgcaacaaaagcaacgttttatgtcacaS(C or G)cctctgaagttcagccttaccctgaggtgtgagttttttggtctgtgtgtagaacatcaggtagatcccagagaaaggtgcatcccgtagcagagtggcagtgagcccactgaacatgccacgagccccttccgtctgatagatactcctcagagctccatacacactcccatagccaaatcttccactctgcagagttagataagagtcagtcatccacatgccaaggagttccactcacaccctgaggccactgtgttctcatctgatacaagagatggcagtagagaggatagcccaaggcaaaaactgtgttccacctacctcagcctctaaaagagtccttcaagaaggtaaaacacaaaaagtatcccacaaatacagaggcactgtatacaaacagcactgtaaaatctcagggtaagtttcacattcacattctgcctagttatcagtagtatggcttggcacttgtggtccaa。

[0069] Example 2 Detection of the polymorphic distribution of the molecular markers prepared by the present invention in laying hens

[0070] The polymorphism of five loci in the partial coding region of the SLC25A38 gene in laying hens was detected, and three genotypes were detected at the g.3515A>G, g.3645T>C, g.4247G>A, g.5431A>G and g.5494C>G loci. The genotype frequencies, allele frequencies and distributions are shown in Table 3.

[0071] Table 3 Genotype frequency and allele frequency of SLC25A38 gene in laying hens

[0072]

[0073]

[0074] As shown in Table 3, three genotypes were detected at the five mutation sites of the sequence. At sites SLC25A38_SNP1 to SLC25A38_SNP5, the dominant alleles were A, T, G, A and C, and the dominant genotypes were AA, TT, GG, AA, and CC, respectively.

[0075] Example 3 Association analysis and application of the molecular markers of the present invention with egg quality traits

[0076] In order to determine whether the detected markers SLC25A38_SNP1 to SLC25A38_SNP5 in laying hens are related to the differences in egg quality traits, 262 Luodao Red chickens were selected as test samples. The samples were collected at the Poultry Experimental Field of the Institute of Animal Husbandry and Veterinary Medicine of Hubei Academy of Agricultural Sciences. Seven egg quality traits, including egg weight, eggshell color L, a, b values, eggshell strength, yolk weight, and SCI, were recorded for each individual. Polymorphism detection was performed using direct sequencing, and the correlation between different genotypes in the partial coding region of the SLC25A38 gene in laying hens and egg quality traits was analyzed. SPSS27.0 software was used for association analysis between genotype and phenotype, and the model used was as follows:

[0077] Y ij =u+G i +P j +e ij

[0078] Among them, Y ij is the observed value of the trait; u is the total average value of the trait; G i is the genotype effect; P j is a fixed effect; e ij is a random error.

[0079] An association analysis between different genotypes of five mutation sites and laying hen egg quality traits was conducted in Rock Island Red chickens. The statistical analysis results are summarized in Table 4.

[0080]

[0081] As can be seen from Table 4, there are genotypes related to eggshell color L, a, and b values ​​at the SLC25A38_SNP1 to SLC25A38_SNP5 loci of the SLC25A38 gene. Among them, the CC genotype at the SLC25A38_SNP5 locus, the AA genotype at the SLC25A38_SNP4 locus, and the CC genotype at the SLC25A38_SNP2 locus have higher color L values; the CT genotype at the SLC25A38_SNP2 locus is related to the SLC The AG genotype at SLC25A38_SNP1 had a higher color a value; the GG genotype at SLC25A38_SNP3 had a higher color b value. In addition, the CC genotype at SLC25A38_SNP2 had a higher egg weight and SCI; the AA genotype at SLC25A38_SNP3 had a higher egg weight; the AA genotype at SLC25A38_SNP4 and the CC genotype at SLC25A38_SNP5 had a higher SCI.

[0082] Example 4 Identification of haplotype combinations with excellent egg quality traits

[0083] 1. Construction of haplotypes and haplotype combinations

[0084] Haploview software was used to perform haplotype analysis of SLC25A38_SNP1 to SLC25A38_SNP5. The haplotype block analysis results are shown in Figure 5 shown.

[0085] Depend on Figure 5 It can be seen that according to the linkage disequilibrium analysis of the SLC25A38_SNP1 to SLC25A38_SNP5 loci, a total of 2 haplotype blocks were found, and haplotype analysis was performed on the 2 haplotype blocks. 11 haplotypes were found in the laying hen population studied in the present invention, as shown in Table 5 below.

[0086] Table 5 Haplotype statistics of SLC25A38 gene SNP locus

[0087]

[0088] The haplotype combinations of each individual composed of the above haplotypes were analyzed, and a total of 15 haplotype combinations were found, as shown in Table 6.

[0089] Table 6 SLC25A38 gene haplotype combinations

[0090]

[0091] Some haplotype combinations with smaller numbers in the sample population were eliminated, and the five haplotypes with the largest numbers were selected for association analysis.

[0092] 2. Association analysis between haplotype combinations and egg quality traits

[0093] SPSS27.0 software was used to perform association analysis between haplotype combinations and egg quality traits. The results are shown in Table 7.

[0094] Table 7 Results of association analysis between dominant haplotypes and egg quality traits

[0095]

[0096] As shown in Table 7, there are no significant differences in egg weight, color a, color b and yolk weight among the five haplotype combinations. The color L of haplotype combination H4H5 (sequence: ACGGG / GTGGG) is significantly lower than that of other haplotype combinations. The eggshell strength of haplotype combination H1H2 (sequence: ACAAC / ATGAC) is significantly higher than that of haplotype combinations H2H2 (sequence: ATGAC / ATGAC) and H5H9 (sequence: GTGGG / ACGAC), and significantly higher than that of haplotype combinations H2H6 (sequence: ATGAC / ATGGG) and H4H5 (sequence: ACGGG / GTGGG). The SCI of haplotype combination H4H5 (sequence: ACGGG / GTGGG) is significantly lower than that of other haplotype combinations.

[0097] In summary, the H2H2 (sequence: ATGAC / ATGAC) haplotype combination is superior to other haplotype combinations in terms of color L and SCI, and the H1H2 (sequence: ACAAC / ATGAC) haplotype combination is superior to other haplotype combinations in terms of eggshell strength. Therefore, in the test population of this embodiment, the H2H2 (sequence: ATGAC / ATGAC) and H1H2 (sequence: ACAAC / ATGAC) haplotype combinations have the best egg quality traits.

[0098] This example identified two haplotype combinations with excellent egg quality traits (their sequences are: ATGAC / ATGAC and ACAAC / ATGAC). Therefore, in the laying hen population, the selection of individuals with these two haplotype combinations will help improve the egg quality traits of laying hens. Based on the above results, the haplotype combination composed of the mutation sites of the present invention can be used as a potential genetic marker for improving the eggshell color trait and other egg quality traits of laying hens in the auxiliary selection of laying hens.

[0099] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A haplotype SNP molecular marker combination related to laying hen egg quality traits in the SLC25A38 gene, characterized in that: The egg quality traits include one or more of eggshell color L, eggshell strength, and SCI; the SNP molecular marker is located in the SLC25A38 gene coding region of laying hens, including SNP site 1, SNP site 2, SNP site 3, SNP site 4, and SNP site 5; The SNP site 1 is at position 473 of the sequence shown in SEQ ID NO: 1, or position 3515 of the reverse complementary sequence of the SLC25A38 gene, and there is an A / G mutation; The SNP site 2 is at position 603 of the sequence shown in SEQ ID NO: 1, or position 3645 of the reverse complementary sequence of the SLC25A38 gene, and there is a T / C mutation; The SNP site 3 is at position 566 of the sequence shown in SEQ ID NO: 2, or position 4247 of the reverse complementary sequence of the SLC25A38 gene, and there is a G / A mutation; The SNP site 4 is at position 350 of the sequence shown in SEQ ID NO: 3, or position 5431 of the reverse complementary sequence of the SLC25A38 gene, and there is an A / G mutation; The SNP site 5 is at the 413th position of the sequence shown in SEQ ID NO: 3, or the 5494th position of the reverse complementary sequence of the SLC25A38 gene, and there is a C / G mutation.

2. The haplotype SNP molecular marker combination according to claim 1, characterized in that: When the SNP molecular marker combination is ATGAC / ATGAC haplotype, the eggshell color L and SCI are significantly better than other haplotype combinations; when the SNP molecular marker combination is ACAAC / ATGAC haplotype, the eggshell strength is significantly better than other haplotype combinations.

3. Use of the haplotype SNP molecular marker combination as described in claim 1 in assisted breeding of laying hens or assisted selection of laying hen egg quality traits.

4. A primer for detecting SNP site 1 and / or SNP site 2 according to claim 1, characterized in that: The nucleotide sequences are as follows: the nucleotide sequence of the upstream primer 1-F is shown in SEQ ID NO:4, and the nucleotide sequence of the downstream primer 1-R is shown in SEQ ID NO:

5.

5. A primer for detecting the SNP site 3 in claim 1, characterized in that: The nucleotide sequences are as follows: the nucleotide sequence of the upstream primer 2-F is shown in SEQ ID NO:6, and the nucleotide sequence of the downstream primer 2-R is shown in SEQ ID NO:

7.

6. A primer for detecting SNP site 4 and / or SNP site 5 according to claim 1, characterized in that: The nucleotide sequences are as follows: the nucleotide sequence of the upstream primer 3-F is shown in SEQ ID NO:8, and the nucleotide sequence of the downstream primer 3-R is shown in SEQ ID NO:

9.

7. Use of the primers as described in any one of claims 4 to 6 in assisted breeding of laying hens or assisted selection of laying hen egg quality traits.

8. A kit for detecting egg quality traits, characterized in that: The laying hen egg quality traits include one or more of eggshell color L, eggshell strength, and SCI; and include the primers according to claim 4, the primers according to claim 5, and the primers according to claim 6.

9. Use of the kit as claimed in claim 8 in detecting egg quality traits of laying hen.

10. A method for screening egg quality traits of laying hens, characterized in that: The egg quality traits include one or more of eggshell color L, eggshell strength, and SCI; comprising the following steps: (1) Extracting genomic DNA from laying hen blood; (2) using the primers described in claim 4 to perform PCR amplification to obtain the sequence shown in SEQ ID NO: 1 in claim 1; using the primers described in claim 5 to perform PCR amplification to obtain the sequence shown in SEQ ID NO: 2 in claim 1; using the primers described in claim 6 to perform PCR amplification to obtain the sequence shown in SEQ ID NO: 3 in claim 1; (3) sequencing the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, screening the DNA sequence mutation sites, and analyzing the haplotype combination of the SLC25A38 gene; (4) Select individuals with the haplotype combination of ATGAC / ATGAC or ACAAC / ATGAC.

Images