A SNP molecular marker associated with egg-laying time in chickens and its application

Abstract

The present invention discloses a SNP molecular marker and application related to the egg-laying time trait of chickens. The method utilizes egg-laying time data and performs genome-wide association analysis (GWAS) on the egg-laying time trait. It is found that there is a C>A nucleotide single base mutation at 5817488bp on chromosome 9 of the chicken reference genome Gallus_gallus.GRCg6a version, which is located inside the PIK3CB gene. The mutation significantly affects the egg-laying time of chickens. At the same time, the acquisition and application of the molecular marker are disclosed. The present invention also provides a molecular marker genotyping detection method that affects the egg-laying time of chickens. The method can be used to establish an efficient and accurate molecular marker-assisted breeding technology, which is applied to the genetic improvement of the egg-laying stability of chickens, thereby improving the egg-laying performance and stress tolerance of chickens.

Description

Technical Field

[0001] The present invention relates to the field of molecular marker-assisted selection technology and animal genetic breeding technology, and in particular to a SNP molecular marker related to the egg-laying time trait of chickens and its application. Background Art

[0002] Eggs are low-cost to produce and rich in various nutrients, making them one of the most common and affordable sources of protein for humans. However, in laying hen production, abnormal fluctuations in egg production and the short duration of peak egg production are currently prominent issues. Therefore, breeding chickens for stable egg production and improving their stress tolerance will significantly improve egg production performance.

[0003] Research has shown that the interval between egg laying and ovulation of the yolk of a particular egg is relatively stable, typically 23-25 ​​hours. The timing of ovulation is influenced by factors such as the previous egg laid, light exposure, hormone levels, and physiological state. Luteinizing hormone (LH), a key hormone that signals ovulation, typically reaches high levels 4-8 hours before ovulation and requires darkness. Therefore, under normal physiological conditions, both ovulation and egg laying occur in the morning. Studies have shown that egg laying time is significantly correlated with both egg consistency and egg production. Specifically, the earlier a hen's average egg laying time, the closer it is to consistently laying one egg per day, and the more eggs it will lay later in life. Furthermore, egg laying time can be measured during peak egg production and can be used as a trait for early selection of later egg production performance, accelerating breeding progress. Furthermore, the earlier or later egg laying time is not only closely linked to egg production performance, but an earlier and more consistent egg laying time also facilitates management and increases farm profitability. Therefore, advancing egg laying time is a key focus of current layer breeding efforts. Summary of the Invention

[0004] In view of the above research background, by statistically analyzing the time of laying of each egg during a period of time during the peak laying period of multiple laying hens, the laying time phenotypic data of a single individual can be obtained. By then utilizing high-throughput sequencing and GWAS (Genome-wide association study), SNPs related to the laying time trait of chickens can be selected quickly, efficiently and accurately. This fills the gap in the international GWAS research on the laying time trait and is of great significance to my country's chicken breeding industry. The primary purpose of the present invention is to provide a SNP molecular marker for selecting the laying time trait of chickens. The present invention is based on a specialized maternal strain of high-yielding laying hens, and uses the method of whole genome association analysis to find SNP molecular markers related to the laying time trait of chickens, so as to serve as SNP molecular markers for marker-assisted selection of the laying time trait of chickens.

[0005] The second object of the present invention is to provide the application of the SNP molecular markers of the above-mentioned chicken egg-laying time trait in chicken genetic breeding.

[0006] In order to find the SNP for the above purpose, the technical solution adopted by the present invention is: a SNP molecular marker related to the egg-laying time of chickens, the SNP molecular marker is selected from chr9_5817488, and the SNP molecular marker chr9_5817488 contains an amino acid sequence with a polymorphism of C / A at 5817488bp on chromosome 9 of the chicken reference genome Gallus_gallus.GRCg6a version.

[0007] The genotype of the polymorphic site contained in the SNP molecular marker chr9_5817488 is a CC genotype, indicating an advanced average egg-laying time.

[0008] The present invention also provides a primer set for amplifying the SNP molecular marker associated with chicken egg-laying time, wherein the primer set comprises an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3.

[0009] Upstream primer primer-F: TGATCTGCAAGGTCTTTTCCA (SEQ ID NO.01),

[0010] Downstream primer primer-R: TCTTGATGTGGTTGGGGTTC (SEQ ID NO. 02).

[0011] A kit comprises the primer set.

[0012] The present invention also provides an application of detecting molecular markers related to chicken egg-laying time traits in chicken genetic breeding, which is used to identify chickens with different egg-laying times.

[0013] The present invention also provides a method for selecting a chicken strain with early egg-laying time, comprising the following steps:

[0014] (1) obtaining whole genomic DNA of the chicken to be tested, and using it as a template, performing PCR amplification using the primer set described in claim 3 or the kit described in claim 4 to obtain a DNA fragment containing the chr9:5817488 site;

[0015] (2) Identifying the genotype of the DNA fragment at the chr9:5817488 site, after Sanger sequencing, retaining the individuals whose genotype of the polymorphic site contained in the SNP molecular marker chr9_5817488 of the chicken to be tested is CC, so as to increase the frequency of the allele C at the site, thereby advancing the average egg-laying time of the offspring chickens, and further improving their egg-laying performance and stability. Eliminating the individuals whose genotype of the polymorphic site contained in the SNP molecular marker chr9_5817488 of the chicken to be tested is CA or AA.

[0016] Compared with the existing technology, the invention of this article has the following advantages and effects: the present invention is the first in the world to study and determine the molecular markers related to the traits affecting the egg-laying time of chickens, verify their effects on the egg-laying time, and finally establish molecular assisted breeding technology, which is applied to the genetic improvement of the egg-laying performance and stability of chickens. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The Manhattan plot and QQ (Quantile-Quantile plot) of the genome-wide association analysis of the egg-laying time trait of the present invention are shown;

[0018] Figure 2 This is a heat map of the LD within the PIK3CB gene, a candidate gene for the egg-laying time trait of the present invention;

[0019] Figure 3 The phenotypic effects of different SNP genotypes proposed in the present invention on the specialized maternal strain of high-yielding laying hens;

[0020] Figure 4 Comparison of egg-laying time between two groups with different genotypes of the SNP proposed in the present invention;

[0021] Figure 5 The distribution diagram of the SNP genotypes proposed in the present invention in different chicken populations in public databases;

[0022] Figure 6 This is a diagram of the Sanger sequencing results of different SNP genotypes proposed in the present invention. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. The reagents not described in detail separately in the present invention are all conventional reagents and can be obtained from commercial channels; the methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0024] Example 1 Phenotypic Determination

[0025] A total of 507 hens from a specialized high-yielding egg-laying hen strain were raised at the Shendi Agricultural Science and Trade Co., Ltd. breeding farm in Hubei Province. Phenotypic data on egg laying schedules were collected for each hen, beginning at the 26th week of peak egg production, for 30 days. Each egg laying schedule phenotypic data was converted to a numerical value. The hour (24-hour system) was kept constant, while the minute value was converted to the decimal point using the formula "one minute = one sixtieth of an hour." The average of all egg laying schedule values ​​over the 30-day period was calculated for each hen as the phenotypic data. The mean and dispersion of the phenotypic data were calculated, with the coefficient of variation being the ratio of the standard deviation to the mean. Descriptive statistics for the egg laying schedule traits of the 507 hens from the specialized high-yielding egg-laying hen strain are shown in Table 1.

[0026] Table 1 Phenotypic statistics of egg-laying time traits of specialized high-yielding egg-laying chicken lines

[0027]

[0028] Example 2 Sample Collection

[0029] Blood was collected from the 507 hens in Example 1, and genomic DNA was extracted from the blood samples and sent to Wuhan Yingzi Gene Technology Co., Ltd. for whole genome resequencing with a sequencing depth of 5×.

[0030] Example 3 GWAS of egg laying time traits

[0031] The hen whole genome resequencing data obtained in Example 2 were processed, and the processing flow included the steps of preliminary filtering, quality control, data filling, further quality control, and linkage disequilibrium (LD) trimming.

[0032] 1. SNP variant sites in the whole genome resequencing data (data from Example 2) were detected using GATK v3.8. Low-quality variants were initially filtered out. The variant detection process followed the GATK best practices (https: / / software.broadinstitute.org / gatk / best-practices). The following filtering criteria were used for SNP variant sites: QD < 2.0 || FS > 60.0 || MQ < 40.0 || MQRankSum < -12.5 || ReadPosRankSum < -8.0;

[0033] 2. Data quality control: Data quality control was performed using PLINK v1.9, and SNPs with a genotype missing rate greater than 5% were removed (--geno 0.05);

[0034] 3. Data filling: After data quality control, missing SNPs were filled using Beagle software;

[0035] 4. Further quality control: PLINK v1.9 was used to perform further quality control on the filled SNPs. The control conditions included removing SNPs with a minor allele frequency (MAF) less than 1% and removing SNPs that did not conform to Hardy-Weinberg equilibrium (HWE). That is, the HWE test P value threshold was set to less than 1 × 10 -6 This means that if the observed genotype frequency of a SNP is significantly different from the expected genotype frequency calculated based on the allele frequency (P value is less than 0.000001), then this SNP site will be considered to be inconsistent with HWE and will be excluded from subsequent analyses (--maf 0.01--hwe 1e-6);

[0036] 5. Prune LD. Prune SNP sites with strong associations using PLINK v1.9. PLINK will calculate the r between all SNP pairs in each window according to the specified window size and step size. 2 Each window contains 50 SNPs, and the window moves 5 SNP steps each time. The difference between the combination frequency of any two SNPs in the window and the random combination frequency in the SNP population contained in the window is detected, and the r between any two SNPs in the window is guaranteed by deleting SNPs. 2 If the r between the two SNPs is greater than 0.2, 2If the p-value is greater than 0.2, it is considered that they are in strong linkage disequilibrium (LD). The above process is repeated for the entire genome until all SNPs have been evaluated. This can reduce the multicollinearity problem caused by LD (--indep-pairwise 50 5 0.2). After all the above steps, 343,843 single nucleotide polymorphism (SNP) sites are finally retained for subsequent analysis.

[0037] 6. Based on the above 343,843 single nucleotide polymorphism (SNP) sites, the kinship matrix was calculated using GCTA v1.94.1 (--bfile genotype--make-grm--out grm). Here, --bfilegenotype specifies the genotype data file, --make-grm indicates that the kinship matrix should be created, and --outgrm specifies the prefix of the output file.

[0038] The single-trait model in GCTA v1.94.1 (y = Xb + Wu + e, where y is the n × 1 phenotype vector (i.e., the laying time of each sample), n is the sample size, X is the design matrix of fixed benefits, b is the vector of fixed effects, u is the vector of SNP effects, e is the vector of residual effects, and W is the standardized genotype matrix, i.e., the SNP sites of each sample) was used to estimate the heritability of the laying time trait by calculating the heritability using the restricted maximum likelihood method (--grm grm--phenopheno.txt--reml--out h 2 ), --grmgrm is used to specify the kinship matrix file, --pheno pheno.txt is used to specify the phenotypic data file, --reml indicates the use of restricted maximum likelihood method for estimation, --out h 2 The prefix of the specified output file is heritability. The heritability estimation result will provide information about the proportion of the phenotypic variance of the egg laying time trait to the total phenotypic variance of different genotypes. The heritability and significance are shown in Table 2. In Table 2, the heritability is 0.46, which means that the genetic effect can explain 46% of the phenotypic variance in Table 1. That is, when the phenotypic variance of a certain genotype is 0.71, the heritability of the egg laying time trait is 0.71. 2 , a heritability exceeding 0.4 is considered high heritability, thus confirming that egg-laying time has significant and high heritability, and subsequent GWAS can be conducted;

[0039] Table 2 Heritability of egg-laying time traits in specialized high-yielding egg-laying chicken lines

[0040]

[0041] 7. Based on the above 343,843 single nucleotide polymorphism (SNP) sites and the values ​​described in Example 1 as phenotypic data, the linear mixed model (LMM, Linear Mixed Model, Y ilm =μ i +K l +G m +e ilm , where Y ilm is the phenotypic value, μ i is the average value, K l is the kinship matrix, G m is the effect of the SNP, e ilm The individual kinship matrix (-bfile genotype-gk 2-ppheno.txt) was added to conduct a genomic association study on egg-laying time (GWAS, -bfile genotype-k output / result.sXX.txt-p pheno.txt-lmm1). The Bonferroni method was used to determine the genome-level significant threshold line of 0.05 / 343843 and the recommended threshold line of 1 / 343843. That is, in 343843 independent tests, when the significance level of each test was 0.05 / 343843, the false positive rate at the whole genome level was controlled within 0.05, thus identifying SNPs associated with egg-laying time in chickens.

[0042] GWAS results showed that ( Figure 1 A in the figure, two SNPs were located at 170867650bp on chromosome 1 and 5817488bp on chromosome 9. The QQ plot of GWAS shows ( Figure 1 Figure B) shows no significant outliers, indicating that the GWAS results contain no significant outliers or observations that deviate from the expected distribution. The lambda value, which is the inflation factor between the observed P-value distribution in the QQ plot and the expected uniform distribution, is within the ideal range, indicating that the P-value distribution in the GWAS results is not significantly inflated or compressed, confirming the credibility of the GWA results. Detailed information on the associated SNPs derived from GWA is shown in Table 3.

[0043] Table 3 SNPs associated with egg-laying time in specialized high-yielding laying hen strains

[0044]

[0045] Of the two associated SNPs, the one on chromosome 9 is located within a gene. This gene (PIK3CB) is primarily involved in intracellular signaling, regulating various biological processes, including cell proliferation, survival, differentiation, and motility. Studies have shown that this gene plays a key role in metabolic homeostasis and is important in follicle proliferation and long-term memory formation. Its function may affect egg production stability in laying hens. The SNP on chromosome 9 had a lower P value than the SNP on chromosome 1, so the SNP on chromosome 9 was selected as the target molecular marker.

[0046] The results of linkage disequilibrium (LD) analysis of the PIK3CB gene located by the chr9_5817488 SNP were obtained. Figure 2 ) showed that there were multiple highly linked blocks within the PIK3CB gene, and these blocks had a strong linkage relationship with chr9_5817488, including some missense mutations of the PIK3CB gene, further supporting the reliability of this SNP as a key gene molecular marker.

[0047] Example 4 Verification of Phenotypic Effects of Target Molecular Markers in Multiple Populations 1

[0048] First, using the results of whole genome sequencing, the 507 high-yielding egg-laying chickens of the specialized maternal strain in Example 1 were classified according to the genotype of the egg-laying time SNP molecular marker chr9_5817488, and the egg-laying time of groups with different genotypes was counted. The results are shown in Table 4 and Figure 3 .

[0049] Table 4 Effects of different genotypes of SNP molecular markers for egg-laying time on the phenotypes of specialized high-yielding laying hen lines

[0050]

[0051] The results in Table 4 show that the average egg-laying time of individuals with CC genotype of SNP molecular marker chr9_5817488 is 1.28 hours earlier than that of individuals with CA genotype. Figure 3 results.

[0052] Then, the laying time of 1177 Jingmen black-feathered green-shelled laying hens with poor laying performance of the same age was statistically analyzed using the same method (the method described in Example 1). The results showed that the average laying time of Jingmen black-feathered green-shelled laying hens was delayed by 1.1 hours compared with the high-yielding specialized maternal strain (Table 5, Table 1), and the difference was significant (P<0.001).

[0053] At the same time, through molecular detection of SNP markers related to egg-laying time in 1177 Jingmen black-feathered green-shelled laying hens, it was found that the number of individuals with chr9_5817488 genotypes of CA and AA in the Jingmen black-feathered green-shelled laying hens group was significantly higher than that in the high-yielding laying hens group ( Figure 4 B) in Figure 4 The A in the figure further indicates that the average egg-laying time of the 1,177 Jingmen black-feathered green-shelled laying hens was later than that of the specialized high-yielding dam line. Therefore, the CA and AA genotypes have a delayed effect on average egg-laying time. Combined with the results shown in Table 4, only the CC genotype has an effect on advancing egg-laying time, while the other two genotypes delay egg-laying time.

[0054] Table 5 Phenotypic statistics of laying time traits of Jingmen black-feathered green-shell laying hens

[0055]

[0056] Example 5 Verification of Phenotypic Effects of Target Molecular Markers in Multiple Populations 2

[0057] We obtained 1,181 chicken genome sequencing data from the NCBI database containing clear breed information. We then performed genotyping on the molecular marker chr9_5817488 for each individual by comparing and genotyping the original sequencing files (fastq). Nine individuals had no genotypes detected. The remaining 1,172 individuals were divided into five groups based on their breed origin: red junglefowl, domestic local chickens, foreign local chickens, high-yield broilers, and high-yield laying hens. The genotypes of the molecular marker chr9_5817488 were then counted for each group. The results are shown in the table. Figure 5 .

[0058] Figure 5 Results showed that this SNP molecular marker is highly polymorphic in the original domestic chicken breed, the Red Junglefowl, with all three genotypes present in large numbers, with the CC genotype accounting for approximately half. It is less polymorphic in local chickens (such as the Yunyang Large Chicken, Huaibei Ma Chicken, Silky-bone Chicken, and Tibetan Chicken) and local chickens (such as the Japanese Bantam, Brahman, Guifei Chicken, and Alacana Chicken), with the CC genotype accounting for approximately three-quarters. In high-yielding broilers (such as Cornish, White Rock, and Cobb commercial broilers), the CC genotype accounts for nearly 90%, while in high-yielding laying hens (such as Leghorn, Rock Island Red, and New Hampshire), the CC genotype accounts for over 95%. Therefore, the frequency of the CC genotype has gradually increased with selective breeding for egg-laying performance. In future genetic breeding efforts to improve egg-laying performance and stress tolerance in laying hens, molecular breeding could be used to further increase the frequency of the CC genotype, particularly in local laying hens with relatively high numbers of the CA and AA genotypes.

[0059] Example 6 Detection and Verification of Molecular Markers

[0060] 1) Design primers for the SNP marker chr9_5817488. The designed primer DNA sequences are as follows:

[0061] Upstream primer primer-F: TGATCTGCAAGGTCTTTTCCA (SEQ ID NO. 01), downstream primer primer-R: TCTTGATGTGGTTGGGGTTC (SEQ ID NO. 02).

[0062] 2) PCR amplification

[0063] PCR amplification was performed using primers Primer-F and Primer-R, using whole-genome DNA from the chicken to be tested as a template. The PCR reaction system consisted of a 40-μl reaction mixture containing 4.0 μl of DNA template, 12 μl of double-distilled water, 20 μl of MasterMix, 2 μl of the upstream primer, and 2 μl of the downstream primer. The PCR reaction conditions were: initial denaturation at 95°C for 5 min; 14 cycles of denaturation at 94°C for 15 s, annealing at 68°C for 15 s, and extension at 72°C for 30 s, with the annealing temperature decreasing by 1°C each cycle; 25 cycles of denaturation at 94°C for 15 s, annealing at 55°C for 15 s, and extension at 72°C for 30 s; and a final extension at 72°C for 5 min.

[0064] 3) DNA sequence determination

[0065] Finally, the products after PCR amplification were sequenced. The sequence determination was completed by Qingke Company. The gene fragment sequencing required reverse sequencing using primer-R primers. The sequencing results were as follows: Figure 6 As shown, Figure 6 A in is CC type, Figure 6 The B in is CA type, Figure 6 The C in is AA type.

[0066] The present invention provides a method for identifying a SNP molecular marker associated with the egg-laying time trait in chickens. It also identifies a SNP molecular marker associated with the egg-laying time trait in chickens and provides a molecular detection method for the marker. In chicken genetic breeding, molecular detection is used to select individuals with the CC genotype at this locus and eliminate individuals with the CA and AA genotypes to increase the frequency of the allele C at this locus, thereby advancing the average egg-laying time of offspring chickens. This can effectively advance the egg-laying time and egg-laying stability of chickens, improving egg-laying performance and stress tolerance.

[0067] Based on the above results, the identification method, mutation site, and detection method of the present invention can be used as potential genetic markers for improving egg-laying performance and stress tolerance in chickens in the field of genetic breeding.

[0068] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. Application of a reagent for detecting SNP site genotype in chicken breeding, characterized in that: The SNP site is located at 5817488 bp on chromosome 9 of the chicken reference genome Gallus_gallus.GRCg6a version. The average egg-laying time of individuals with the CC genotype at the site is earlier than that of individuals with the CA genotype. The chicken is a specialized maternal strain of high-laying chickens, and the application is to identify chickens with different egg-laying times.

2. Application of a primer set or kit in chicken breeding, characterized in that: The primer set includes an upstream primer and a downstream primer, the upstream primer is shown as SEQ ID NO.01, and the downstream primer is shown as SEQ ID NO.02; the kit includes the primer set, the chicken is a specialized maternal strain of high-yielding laying hens, and the application is to identify chickens with different egg-laying times.

3. A method for selecting chickens with early egg-laying time, characterized in that: The following steps are involved: (1) obtaining whole genomic DNA of the chicken to be tested, and using it as a template, performing PCR amplification using the primer set described in claim 2 or the kit described in claim 2 to obtain a DNA fragment containing the chr9:5817488 site; (2) Identifying the genotype of the DNA fragment at the chr9:5817488 site, after Sanger sequencing, retaining the individuals whose genotype at the chr9_5817488 site of the chicken to be tested is CC, and eliminating the individuals whose genotype at the chr9_5817488 site of the chicken to be tested is CA or AA; The reference genome of the locus is Gallus_gallus.GRCg6a version; The chicken is a specialized maternal strain of high-yielding laying hens.

4. The method according to claim 3, characterized in that In step (1), the PCR amplification reaction system is: 40 ul reaction system, including 4.0 ul DNA template, 12 ul double distilled water, 20 ul Master Mix, 2 ul upstream primer, and 2 ul downstream primer; In step (1), the reaction procedure of the PCR amplification is as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 15 s, annealing at 68°C for 15 s, and extension at 72°C for 30 s, for 14 cycles, with the annealing temperature decreasing by 1°C each cycle; denaturation at 94°C for 15 s, annealing at 55°C for 15 s, and extension at 72°C for 30 s, for 25 cycles; and final extension at 72°C for 5 min.

Images