SNP molecular marker primer combinations for molecular identification of soft fiber areca nut germplasm resources and their applications

Abstract

This invention provides a combination of SNP molecular marker primers for the molecular identification of soft-fiber areca nut germplasm resources and their applications, belonging to the field of SNP molecular marker technology. Based on the constructed core areca nut germplasm resources, this invention conducts genetic background association analysis on the phenotypic characteristics of fruit fibers and develops SNP molecular marker primers based on areca nut fiber-specific loci. The development of these SNP molecular marker primers includes four pairs of specific primers. This invention also provides a method for detecting soft-fiber areca nut germplasm resources using SNP molecular marker primers. This method can rapidly, accurately, cost-effectively, and with high throughput detect the genotype of soft-fiber areca nut germplasm resources. The four pairs of specific primers of this invention can be used to identify soft-fiber areca nut germplasm resources, which has important application significance for the scientific protection of areca nut germplasm resource diversity, research on the genetic conservation and evolution of areca nut resources, and areca nut genetic breeding.

Description

Technical Field

[0001] This invention belongs to the field of SNP molecular marker technology, specifically relating to SNP molecular marker primer combinations for molecular identification of soft fiber areca germplasm resources and their applications. Background Technology

[0002] Areca catechu L. is a perennial evergreen tree belonging to the Areca genus of the palm family. It ranks first among the "Four Major Southern Chinese Medicines" and has the effects of reducing edema, relieving joint pain, and strengthening the spleen and regulating the middle jiao. It is a commonly used medicinal material in traditional Chinese medicine.

[0003] Traditional areca fiber phenotypic identification relies on breeders' extensive survey and cultivation experience and is easily influenced by environmental and human factors, leading to errors and low efficiency in target gene selection. Basic research on areca germplasm resources is relatively weak, lacking systematic comparison and research on germplasm diversity. Currently, areca fiber identification and evaluation are limited to sensory, physiological and biochemical measurements, and textural characteristics (Kang Xiaoning, Wang Shiping, Dai Jiahui, Ma Jinshuang, Ji Jianbang, Wang Haican. Study on the dynamic changes of fruit morphology, texture, and pericarp composition during areca growth. Preservation and Processing). Molecular identification methods for soft fiber areca germplasm resources are particularly lacking. With the emergence and utilization of molecular marker technology, its directness and convenience have made its application value and prospects highly anticipated. In areca molecular breeding, developing molecular markers closely linked to target genes in areca fiber and their functionally specific molecular markers for selecting target genes is of great significance for the evaluation and innovative utilization of areca germplasm resources. Summary of the Invention

[0004] This invention addresses the shortcomings of existing technologies by providing an SNP molecular marker primer combination for the molecular identification of soft fiber areca nut germplasm resources and its application. The SNP molecular marker primer combination consists of four pairs of specific primers and can be used to identify soft fiber areca nut germplasm resources. It provides guidance for breeding and germplasm resource screening of areca nuts with important soft and hard fiber qualities. The technical process of this invention is as follows: Figure 1 .

[0005] The specific technical solution is as follows:

[0006] The first aspect of this invention provides an SNP molecular marker primer combination for molecular identification of soft fiber areca germplasm resources, consisting of 4 pairs of specific primers, the nucleotide sequences of which are as follows:

[0007] PA40374 upstream primer: TTAGGCTCAACCCTGAATGG;

[0008] PA40374 downstream primer: GGTGTCCACACCAATTCTCC;

[0009] PA40381 upstream primer: TGAAGATGTTTTTCCCGAGG;

[0010] PA40381 downstream primer: AGCTCTAAGCACCTGGGTCA;

[0011] PA40383 upstream primer: TGCCACTTAACGCAGACTTG;

[0012] PA40383 downstream primer: CAAGTCCCTGCCTACGGATA;

[0013] PA40688 upstream primer: AGTACCCACCATGCCACAAT;

[0014] PA40688 downstream primer: GATCCAAGGGAACAGATCCA.

[0015] The second aspect of this invention provides a process for applying the aforementioned SNP molecular marker primer combination in the molecular identification of soft fiber areca germplasm resources, comprising the following steps:

[0016] (1) Extracting DNA from the sample to be analyzed: Collect areca leaves or areca fruits and extract genomic DNA;

[0017] (2) PCR amplification reaction: PCR amplification reaction was performed on the genomic DNA in step (1) using the above 4 pairs of specific primers;

[0018] (3) Detection of PCR amplification products: The PCR amplification products were electrophoresed on a 1.5% agarose gel containing 10% Goldview nucleic acid dye. The electrophoresis was performed in 0.5×TBE buffer at 110V for 40 min. The gel running results were photographed and recorded in a gel imaging system.

[0019] (4) Detection of PCR amplification products: The PCR amplification products are subjected to genome sequencing.

[0020] Further, the PCR amplification reaction program described in step (2) is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 60℃ annealing for 30 sec, 72℃ extension for 30 sec, for 35 cycles; 72℃ extension for 5 min.

[0021] Further, the PCR amplification reaction system described in step (2) is as follows: 20 ng of areca nut genomic DNA, 2 μL each of 5 pmol / μL upstream and downstream primers, 15 μL of 2×Taq PCR MasterMix, and ddH2O to a total volume of 30 μL.

[0022] Furthermore, the genome sequencing described in step (3) is Sanger first-generation conventional sequencing.

[0023] The beneficial effects of this invention are:

[0024] This invention conducts genetic background association analysis on the phenotypic characteristics of fruit fiber based on the constructed core germplasm resources of Areca catechu, and develops SNP molecular markers based on Areca catechu fiber-specific loci, resulting in four pairs of specific primers. This invention also provides a method for detecting soft-fiber Areca catechu germplasm resources using SNP molecular marker primers. This method can rapidly, accurately, cost-effectively, and with high throughput detect the genotype of soft-fiber Areca catechu germplasm resources. The four pairs of specific primers of this invention can be used to identify soft-fiber Areca catechu germplasm resources, which has important application significance for the scientific protection of Areca catechu germplasm resource diversity, research on the genetic conservation and evolution of Areca catechu resources, and Areca catechu genetic breeding. Attached Figure Description

[0025] Figure 1 This is a flowchart illustrating the technical process of the present invention.

[0026] Figure 2 Manhattan plot for genome-wide association analysis of traits and variant sites using the MLM model;

[0027] Figure 3 Gel imaging image for detecting areca nut PCR amplification products;

[0028] Figure 4 For PA40374 primer sequencing sequence alignment and SNP genotyping results, a: FMHF; b: 20 other materials;

[0029] Figure 5 For PA40381 primer sequencing sequence alignment and SNP genotyping results, a: low elastic strength sample; b: high elastic strength sample;

[0030] Figure 6 For PA40383 primer sequencing sequence alignment and SNP genotyping results, a: low hardness sample; b: high hardness sample;

[0031] Figure 7 The sequence alignment and SNP genotyping results for PA40688 primers are shown in Figure a: samples with low protopectin content; and Figure b: samples with high protopectin content.

[0032] Table 1 Phenotypic characteristics of areca nut fruit fiber Detailed Implementation

[0033] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0034] Example 1: Development of SNP molecular marker-specific primers

[0035] (1) Evaluation of areca nut phenotypic traits: The phenotypic traits of fiber from 235 areca nut fruits were analyzed (Table 1);

[0036] (2) Evaluation of Areca population structure and genetic diversity: Based on SLAF simplified genome sequencing technology, the constructed Areca germplasm resource population was sequenced to obtain SNP markers;

[0037] (3) Genetic background analysis of areca fruit fiber traits: Based on the association analysis between the areca fruit fiber phenotypic traits in step (1) and the SNP markers obtained in step (2), SNP sites that are significantly associated with fruit fiber traits were obtained.

[0038] (4) Development of specific primers Figure 2 Based on the SNP sites that are significantly associated with fruit fiber traits in step (3) above, four pairs of primers with high specificity and polymorphism were designed and screened. The nucleotide sequences of the four pairs of primers are as follows:

[0039] PA40374 upstream primer: TTAGGCTCAACCCTGAATGG;

[0040] PA40374 downstream primer: GGTGTCCACACCAATTCTCC;

[0041] PA40381 upstream primer: TGAAGATGTTTTTCCCGAGG;

[0042] PA40381 downstream primer: AGCTCTAAGCACCTGGGTCA;

[0043] PA40383 upstream primer: TGCCACTTAACGCAGACTTG;

[0044] PA40383 downstream primer: CAAGTCCCTGCCTACGGATA;

[0045] PA40688 upstream primer: AGTACCCACCATGCCACAAT;

[0046] PA40688 downstream primer: GATCCAAGGGAACAGATCCA.

[0047] Table 1235 Phenotypic Characteristics of Areca Nut Fruit Fiber

[0048]

[0049]

[0050]

[0051]

[0052]

[0053] Example 2: Application of molecular identification of important qualities of areca nut fruit fiber in germplasm resources

[0054] (1) Collect different types and regions of areca germplasm resources as experimental materials for the verification of SNP molecular markers;

[0055] (2) Extraction of DNA from the sample to be analyzed: Total DNA was extracted from the areca nut sample above using the modified CTAB method;

[0056] (3) PCR amplification was carried out using the four pairs of specific primers obtained in Example 1:

[0057] PCR amplification reaction: DNA from 21 samples of areca nut samples, including BDKP, BSDF, and BSMQ, extracted in step (2) was used as amplification templates. Four pairs of specific primers developed in step (3) were used as amplification primers for PCR amplification. The PCR reaction system was as follows: 20 ng of areca nut genomic DNA, 2 μL each of 5 pmol / μL upstream and downstream primers, 15 μL of 2×Taq PCR Master Mix, and ddH2O was added to a total volume of 30 μL. The PCR reaction amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 60℃ annealing for 30 sec, 72℃ extension for 30 sec, for 35 cycles; 72℃ extension for 5 min, and storage at 4℃.

[0058] (4) Detection of PCR amplification products: PCR amplification products were electrophoresed using 10% Goldview nucleic acid dye and 1.5% agarose gel in 0.5×TBE buffer at 110V for 40 min. The gel running results were photographed and recorded in a gel imaging system.

[0059] (5) Detection of PCR amplification products: The PCR amplification products are subjected to Sanger first-generation conventional sequencing, and the gene polymorphism sites are determined based on the nucleotide sequence information at the corresponding positions.

[0060] Validation results of 4 pairs of specific primers: Figure 3 The results of PCR amplification products of some areca nut samples were validated using four pairs of specific primers. The results showed that the four pairs of specific primers developed are suitable for identifying soft fiber areca nut germplasm resources.

[0061] The detection results of the four pairs of specific primers are as follows:

[0062] Sequence alignment and SNP genotyping results using the PA40374 primer pair showed that cellulose content, an indicator of areca nut fiber, was significantly high in the FMHF samples. The PA40374 primer pair sequencing results showed 7 SNP sites, indicating abundant polymorphic sites. Therefore, the PA40374 primer pair can be used as a sequencing-specific primer for samples with low cellulose content. Figure 4 ).

[0063] Sequence alignment and SNP genotyping results using the PA40381 primer pair showed that the PA40381 primer pair could detect areca fiber with an elastic strength below 3.39 N / mm. 2 The sample yielded a detectable count of 71.43%, thus it can be used as a specific primer for detecting areca nut elasticity indicators. Figure 5 ).

[0064] Sequencing sequence alignment and SNP genotyping results using the PA40383 primer pair showed that the PA40383 primer pair could detect samples with a fiber hardness of 249.7N or lower, with a detection rate of 95.24%. Therefore, it can be used as a specific primer for detecting the hardness index of areca nuts. Figure 6 ).

[0065] Sequencing sequence alignment and SNP genotyping results using the PA40688 primer pair showed that the PA40688 primer pair could detect protopectin content in areca nut fiber indicators below 15.77%, with a detectable quantity of 76.19%. Therefore, it can be used as a specific primer for detecting protopectin content in areca nut fiber indicators. Figure 7 ).

[0066] Specific embodiments have been used to illustrate the principles and implementation methods of this invention. The descriptions of the embodiments above are only for the purpose of helping to understand the method and core ideas of this invention. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the ideas of this invention. Therefore, the content of this specification should not be construed as a limitation of this invention.

Claims

1. The application process of a SNP molecular marker-specific primer pair in the molecular identification of soft fiber areca germplasm resources includes the following steps: (1) Extracting DNA from the sample to be analyzed: Collect areca leaves or areca fruits and extract genomic DNA; (2) PCR amplification reaction: PCR amplification reaction of the genomic DNA in step (1) was performed using specific primer pairs; the nucleotide sequences of the specific primer pairs are as follows: the upstream primer is TGCCACTTAACGCAGACTTG; the downstream primer is CAAGTCCCTGCCTACGGATA; the site recognition sequence of the upstream and downstream primer identification sites is TGGGCATGGG[C / T]ACGGCTATCT; (3) Detection of PCR amplification products: The PCR amplification products were electrophoresed on a 1.5% agarose gel containing 10% Goldview nucleic acid dye. The electrophoresis was performed at 110V for 40 min in 0.5×TBE buffer. The gel running results were photographed and recorded in a gel imaging system. (4) Detection of PCR amplification products: The PCR amplification products are subjected to genome sequencing.

2. The application according to claim 1, characterized in that, The PCR amplification reaction program described in step (2) is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 60℃ annealing for 30 sec, 72℃ extension for 30 sec, for 35 cycles; 72℃ extension for 5 min.

3. The application according to claim 1, characterized in that, The PCR amplification reaction system described in step (2) is as follows: 20 ng of areca nut genomic DNA, 2 μL each of 5 pmol / μL upstream and downstream primers, 15 μL of 2×Taq PCR Master Mix, and ddH2O to a total volume of 30 μL.

4. The application according to claim 1, characterized in that, The genome sequencing described in step (3) is Sanger first-generation conventional sequencing.

Images