Peach early flowering phenotype molecular marker and application thereof

Abstract

The application belongs to the field of plant molecular biology, and discloses a peach early flowering phenotype molecular marker and application thereof. The peach early flowering phenotype molecular marker is a combination of SNP molecular markers related to the peach early flowering phenotype, and is composed of 20 SNP loci of a first chromosome of the peach. Further typing detection is performed by KASP technology, and the peach early flowering phenotype molecular marker can be used for molecular identification of the peach early flowering phenotype and breeding of peach varieties, and has great application value.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology, specifically relating to a molecular marker for the early flowering phenotype of peach and its application. Background Technology

[0002] Flowering is an extremely complex biological process, a crucial pathway involving the combined regulation of endogenous and environmental signals within the plant. The timing of flowering is critical to a plant's adaptability, yield, and reproductive isolation: if flowering occurs too early, the floral tissues may be damaged by late frost, resulting in insufficient pollen to ensure fertilization of all ovules; conversely, if flowering occurs too late, the plant may encounter conditions unfavorable for seed maturation or dispersal, forcing offspring to remain in harsh environments, hindering their reproduction (Gaudinier, A., & Blackman, BK 2020. Evolutionary processes from the perspective of flowering timediversity. New Phytol, 225(5), 1883-1898.). Therefore, understanding the flowering code of plants is of great significance for improving crop yield and broadening plant adaptability.

[0003] The peach originated in my country, and its germplasm resources are very rich. It grows widely in temperate and subtropical regions. Precisely because of its wide planting range, regional adaptability is also a particularly important issue. For fruit crops such as peaches, the timing of flowering is closely related to the chilling requirement of the variety, in addition to environmental factors such as photoperiod (Blackman, BK. 2017. Changing Responses to Changing Seasons: Natural Variation in the Plasticity of Flowering Time. Plant Physiol, 173(1), 16-26.). If the chilling requirement of the introduced fruit trees cannot be met in the region, the plants will not be able to complete the natural dormancy process normally, which will inevitably cause growth and development disorders, resulting in low fruit set or crop failure. Therefore, while pursuing the goal of high-quality breeding, the adaptability of varieties is also an issue that modern peach breeders need to consider. However, there are currently no relevant molecular markers that can be applied in breeding. Summary of the Invention

[0004] This invention utilizes the peach 170K SNP chip to perform genotyping analysis on 489 germplasm resources originating from major producing areas worldwide. Genome-wide association analysis, identity by descent (IBD), and haplotype analysis were conducted on the peach flowering time trait to identify a molecular marker combination consisting of 20 SNPs. Genotyping was performed using KASP (Kompetitive Allele Specific PCR) technology, which can be used for molecular identification of early-flowering phenotypes in peaches.

[0005] This invention provides a molecular marker for the early flowering phenotype of peach, which is a combination of SNP molecular markers associated with the early flowering phenotype of peach, including the following loci on chromosome 1 of peach: Chr1:45355352, Chr1:45355677, Chr1:45355882, Chr1:45356724, Chr1:45358864, Chr1:45365756, Chr1:45375955, Chr1:45379885, C hr1:45379925, Chr1:45393095, Chr1:45397405, Chr1:45398583, Chr1:45400035, Chr1:45402011, Chr1:45404038, Chr1:45408105, Chr1:45414874, Chr1:45426756, Chr1:45427123 and Chr1:45435638;

[0006] More specifically, the SNP sites are classified into Allele R and Allele A according to genotype, and their bases are as follows:

[0007]

[0008]

[0009] Furthermore, the flanking sequences of the SNP site are as follows:

[0010] Chromosomal location Flanking sequence Chr1:45355352 TTATAATGCGCATTGAAGTAATATTGCATGCAAAT[A / G]TGGGTTAAGTCAGTTTACAAACACATTGTGTCTCT Chr1:45355677 TCCAACTGCATTAACTACGCCACCTCGAAGCACAG[C / G]TGGGGCTGGCGCCTCTCCCTCGGCCTAGCCATAGT Chr1:45355882 TTGCCCAGCTAGTTAAGGCCAGCGAGATAGCCAAA[G / T]CTCTCGACGAGGAGCCATTTGTGACCATATTTCAG Chr1:45356724 GAGACGAAAGGAATCCCATTGGATCAAGTGCATAC[A / G]GTTTGGGTGAAGCATTGGTACTGGCGTCGATTTGT Chr1:45358864 TAATCACGTAATAAGAGATATAGACACACAAGACT[C / T]CAATTACGTAAAGTCCCACATAAGCTTCTCTCACA Chr1:45365756 GGAAACAAATGATTTCCAAAATTTAAAGTATATCT[C / T]AAAAGAGGACAAAAAAAGATTCGATATCATTCCAA Chr1:45375955 AAACGATCCCTTATTGAAAAATTTTGTATCCCCAC[A / G]ACCCAAAATATGCTCCGTTTATGGGCCAGAAATGG Chr1:45379885 CAAAAAAATTGAGACACATGATAATTCATAGCACT[G / T]ACTTGGGATGTTTATTAGTTGTGCTTACTAGTTAC Chr1:45379925 GGGATGTTTATTAGTTGTGCTTACTAGTTACTAGG[C / G]TATGCTATTGTCGAGTTTGTGTCATATAGTAGTAG Chr1:45393095 GTGAGAGAAAGCTATAAGAGAAAGTAACTAATGAG[C / G]TGTTTTCATTTTTTGATTATTCAGGAATCAATTTT Chr1:45397405 CATACATGGCCAACTGTCCCAAATGGGAGTCGACT[A / G]GAGGCACTGCTCCTTATTAGCCATATCCAGCACCA Chr1:45398583 GCTTGGCCATATACATACTTATGCGTGCTGCTGTG[C / T]TGGCGTCGCGGTGTGGGATTAAAAGCAAACGGTTC Chr1:45400035 GAATTTGATTCACTAATCAATTTGTGGCATGATTG[A / G]CGATTTTAAATTGGAGCAATAGAAACATTTTGATT Chr1:45402011 AAAAATTGTTTTAGACCTGCTATGATTTTCAACAT[A / T]TCAAAATAAAACATAATAACTAAACAAAACCATAA Chr1:45404038 TTTTTTATATCCGATGTGACTCAATTTTCGGTCTT[A / G]ATGCCCATTCGTAATCACACATATGTTTTTATTAG Chr1:45408105 CTGTAAACTAAAACACAATCAGAAAACATATTCTC[C / T]CCATCATCATATTCTCTCCATCATTTTCCACAGCA Chr1:45414874 GAATGAGATTGAAACCCTTTGAGAGCCAACCGCAT[C / T]GACTTTGATTTCACAACCGAAATTCTCGCAATTAA Chr1:45426756 GTCTATACGGGAAAATAATGACACTCACCAATCAC[C / T]ACCCTCATCCTTAACTTTGCAACCTCCCCCAACAC Chr1:45427123 TGAACCTTAAAATTGACAGACTTTGACGGTAGGAC[C / T]GTTTTGATACAAAATGAAAGTTGAAGGACCACTGA Chr1:45435638 TGGTGGTATCAGAACTAGTAAACTTGATGTGGGGC[G / T]TCCATCTGTCGATTACAAAAGTATCTGTCATGTTC .

[0011] The present invention also provides a primer combination for detecting the early flowering phenotype of peach, the primers comprising 20 primer sets for detecting the molecular markers respectively. Preferably, the primers are KASP primers, each primer set comprising two upstream forward primers, respectively connected to different fluorescent markers P1 and P2, such as connected to FAM and HEX fluorescent markers respectively, and one downstream reverse primer P3.

[0012] Preferably, the primers comprise the following KASP primers:

[0013]

[0014]

[0015] The present invention also provides a kit for detecting the early flowering phenotype of peach, comprising the primer combination described herein, which is placed or packaged separately, and optionally, further comprising a reagent for extracting genomic DNA from the peach to be tested.

[0016] The present invention further provides the application of the molecular marker or the primer combination or the kit in detecting the early flowering phenotype of peach.

[0017] The present invention also provides a method for detecting the early flowering phenotype of peach, comprising the following steps: taking a genomic DNA sample of the peach to be tested, performing PCR reaction using the primer combination as described above, and detecting and determining the genotype of each locus by analyzing the PCR reaction products.

[0018] Furthermore, the genotype of each site is determined by the fluorescence signal. More specifically, the FAM and HEX fluorescence signal data are plotted on the x-axis and y-axis, respectively. The FAM and HEX values ​​of each reaction well are corrected by the value of the reference dye ROX for that specific well. The fluorescence values ​​are standardized to obtain the relative fluorescence values ​​corresponding to FAM and HEX for each PCR reaction well. Based on the relative fluorescence values, the samples are clustered, and the genotype is further determined based on the sample clusters and fluorescence types.

[0019] More specifically, by determining the genotype, the initial flowering period of the sample to be tested can be effectively predicted, and superior strains can be screened according to the breeding objectives. Specifically, if the goal is to breed cultivated peaches suitable for growth in low-latitude regions, the genotypes of the above 20 SNP loci should be tested, and varieties containing 12 or more Allele A nucleotides should be selected; if the goal is to breed cultivated peaches suitable for growth in mid- to high-latitude regions, varieties containing less than 12 Allele A nucleotides should be selected.

[0020] This invention discloses a molecular marker for early flowering phenotype in peaches and its application. It comprises a combination of 20 SNP loci from peach chromosome 1, and further utilizes KASP technology for genotyping detection. This marker can be used for molecular identification of early flowering phenotypes in peaches and for the breeding of peach varieties, demonstrating significant application value. Attached Figure Description

[0021] Figure 1 The flowering period of 489 peach germplasm accessions from the National Fruit Tree Germplasm Resource Center (Beijing) in 2019.

[0022] Figure 2 The initial flowering phenotypes of peach germplasm containing three different haplotypes are shown.

[0023] Figure 3 KASP molecular marker typing results for early peach blossom. Detailed Implementation

[0024] The following detailed description of specific embodiments is intended to facilitate understanding of the present invention, but is not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0025] Example 1: Survey on Peach Blossom Flowering Time

[0026] The peach germplasm resources involved in this invention are planted in the National Fruit Tree Germplasm Resource Nursery for Beijing Peach and Strawberry. The flower bud status of each germplasm in the resource nursery was recorded from March 15th to April 15th, 2019. The date when the number of fully blooming flower buds reaches 10% of the total number of flower buds on the tree is defined as the initial flowering period of this variety. According to... Figure 1 The survey data shows that the initial flowering period is concentrated between April 1st and 5th, accounting for 84.2% of the total; those earlier than (or equal to) March 31st account for 11.0% of the total, which is the early flowering phenotype; and those later than (or equal to) April 6th account for 4.8% of the total, which is the late flowering phenotype.

[0027] Example 2: Obtaining the genotype of peach germplasm

[0028] Fresh, young leaves from 489 germplasm resources in the resource nursery were collected, and genomic DNA was extracted and stored at -20℃. Genotyping of these germplasm resources was performed using the peach 170K SNP chip. Chip production was carried out using Affymetrix's technology platform, and genotyping of the samples was commissioned to Beijing Bio-Tech Biotechnology Co., Ltd.

[0029] The genotyping results were obtained from the genotyping of these 489 peach samples using 170K SNPs, which is equivalent to a matrix of 170,000 SNPs × 489. 2. Based on this data, the data was processed using Beagle v4.1 software to filter out low-quality loci, leaving 61,425 high-quality loci, which were simplified into a 61,425 × 489 data matrix. 3. GWAS analysis was performed using this simplified data to obtain association intervals related to the peach's initial flowering period.

[0030] Example 3: Analysis of loci associated with peach flowering time

[0031] The genotypic data of the 489 peach germplasm resources obtained in Example 2 (i.e., the association intervals related to the initial flowering period of peach obtained in Example 2) were filled using Beagle v4.1 software to obtain a high-quality data matrix consisting of 61,425 SNPs. Combined with the peach initial flowering period survey data in Example 1, statistical analysis was performed using a mixed linear model in Fast-LMMv2.06.20130802 software, with the latest Longhua Honeydew Genome as the reference genome (Yu Y, Guan J, Xu Y, Ren F, Zhang Z, Yan J, Fu J, Guo J, Shen Z, Zhao J, Jiang Q, Wei J and Xie H (2021) Population-scale peach genome analyses unravel selection patterns and biochemical basis underlying fruit). A genome-wide association analysis (Variety. Nature Communications. 12: 3604.) showed that the 45,355,677–48,792,036 bp region on chromosome 1 of peach was strongly associated with the flowering time of peach.

[0032] Example 4: Genetic Basis Analysis of Early-Blooming Families

[0033] To further narrow down the associated loci (chromosome 1, 45,355,677–48,792,036 bp), we further analyzed the shared genomic segments among members of families with the early-flowering phenotype, as these segments contain the molecular basis for the early-flowering phenotype inherited by these family members. These genomic segments were superimposed with the peach early-flowering association signal to screen for genomic genetic information regulating the peach early-flowering period. Kinship analysis of the 489 peach germplasm resources mentioned above was performed using GEMMA (v0.98.1-0) software, revealing a family population with the early-flowering phenotype consisting of 16 members (including: “Sunon”, “Tropicsnow”, “Sunraycer”, “Vallegrande”, “Flordaglo”, “Sunwright”, “Early Grand”, “Flordaprince”, “Flordacrest”, “FlordaGrande”, “Sundollar”, “Tropic Beauty”, “Zhongguo Taiwan Shui Mi”, “Chirva”, “Chimarrita”, and “Tropic Sweet”).

[0034] IBD analysis of this family was performed using Beagle v5.1.RefinedIBD (v17Jan20.102) software, which obtained the common genomic fragments of the family members. Among them, the 45,355,352-45,435,638bp interval on chromosome 1 coincides with the peach flowering time signal in the genome, which may be the genetic basis of the early flowering phenotype of the family members.

[0035] Example 5: Early-flowering haplotype analysis

[0036] Haplotype analysis was performed on the common genomic region (chromosome 1 chr1: 45,355,352-45,435,638 bp) in the early-flowering family population of Example 4. The analysis software used was Beagle (v5.1). After removing low-frequency haplotypes that appeared only once, three haplotypes (Hap1, Hap2, and Hap3) were obtained, each consisting of 20 SNPs (sequence information is shown in Table 2). Their genotypes are shown in Table 1 (divided into Allele R and Allele A). Among them, the varieties with the Hap3 genotype flowered significantly earlier than other varieties. Figure 2 ).

[0037] Table 1. Haplotypes associated with the beginning of peach flowering time

[0038] Chromosomal Location Allele R Allele A Hap1 Hap2 Hap3 Chr1:45355352 A G A A G Chr1:45355677 C G C C G Chr1:45355882 G T G G T Chr1:45356724 A G A A G Chr1:45358864 T C T T C Chr1:45365756 T C T T C Chr1:45375955 G A G G A Chr1:45379885 T G T T G Chr1:45379925 G C G G C Chr1:45393095 C G C C G Chr1:45397405 A G A A G Chr1:45398583 T C T T C Chr1:45400035 A G A A G Chr1:45402011 A T A A T Chr1:45404038 A G A A G Chr1:45408105 C T C C T Chr1:45414874 C T C C T Chr1:45426756 C T C T C Chr1:45427123 T C T T C Chr1:45435638 G T G G T

[0039] Example 6: Development of molecular markers for early peach blossom phenotype

[0040] Further analysis was conducted on the 20 SNPs closely related to the early flowering phenotype of peaches found in Example 5, as shown in Table 1. If the test result is the same as Allele R, the result is recorded as 0; if it is the same as Allele A, the result is recorded as 1. The total number of genotype determination results of these 20 SNPs for each sample that are 0 / 1 and 1 / 1 is counted. A total of 12 or more is defined as an early flowering genotype, otherwise it is a non-early flowering genotype.

[0041] Of the 35 samples with early-flowering genotypes, taking 2019 as an example, 28 had a flowering start date earlier than or equal to March 31, 4 had a flowering start date later than or equal to April 1, and 3 had an unknown phenotype. The average flowering start date was March 29, with an accuracy rate of 87.5%. Of the 454 varieties with non-early-flowering genotypes, 25 had a flowering start date earlier than or equal to March 31, 424 had a flowering start date later than or equal to April 1, and 5 had an unknown phenotype. The average flowering start date was April 3, with an accuracy rate of 94.4%. The overall accuracy rate was 94.0%.

[0042] Example 7: Validation of molecular markers for early peach blossom phenotype

[0043] The initial flowering date of the same population in the following year (2020) was investigated using the phenotypic survey method described in Example 1, and phenotypic data were recorded. The early-flowering phenotype of this population was identified according to the method described in Example 6: among the 35 early-flowering genotype varieties, 33 had an initial flowering date earlier than or equal to March 31, 2 had an initial flowering date later than or equal to April 1, with an average initial flowering date of March 28, and an accuracy rate of 94.3%; among the 454 non-early-flowering genotypes, 51 had an initial flowering date earlier than or equal to March 31, 393 had an initial flowering date later than or equal to April 1, and 10 had an unknown phenotype, with an average initial flowering date of April 1, and an accuracy rate of 88.5%; the overall accuracy rate was 88.9%.

[0044] Example 8: Development of KASP molecular markers for early peach blossoms

[0045] To facilitate the application of peach molecular breeding, the 20 SNPs in Example 5 were analyzed using Kraken based on their flanking sequences (Table 2). TM The software system designs a simple and low-cost KASP primer combination (Table 3). This combination consists of three primers: two forward primers connected to FAM (P1) and HEX (P2) fluorescent labels, respectively, and one reverse primer (P3). Each primer is dissolved and diluted to 100 μM with sterile water, and mixed in a ratio of P1:P2:P3:water = 6:6:15:23. It is important to note that the four loci (Chr1:45356724, Chr1:45375955, Chr1:45397405, and Chr1:45435638) are detected based on the antisense strand. That is, if the detection result is A, the genotype at that locus is complementary to the sequence T; if the detection result is T, the genotype at that locus is complementary to the sequence A; if the detection result is C, the genotype at that locus is complementary to the sequence G; and if the detection result is G, the genotype at that locus is complementary to the sequence C.

[0046] Table 2. Flanking sequences of SNPs associated with the phenotype of early peach blossom

[0047] Chromosome position Flanking sequence Chr1:45355352 TTATAATGCGCATTGAAGTAATATTGCATGCAAAT[A / G]TGGGTTAAGTCAGTTTACAAACACATTGTGTCTCT Chr1:45355677 TCCAACTGCATTAACTACGCCACCTCGAAGCACAG[C / G]TGGGGCTGGCGCCTCTCCCTCGGCCTAGCCATAGT Chr1:45355882 TTGCCCAGCTAGTTAAGGCCAGCGAGATAGCCAAA[G / T]CTCTCGACGAGGAGCCATTTGTGACCATATTTCAG Chr1:45356724 GAGACGAAAGGAATCCCATTGGATCAAGTGCATAC[A / G]GTTTGGGTGAAGCATTGGTACTGGCGTCGATTTGT Chr1:45358864 TAATCACGTAATAAGAGATATAGACACACAAGACT[C / T]CAATTACGTAAAGTCCCACATAAGCTTCTCTCACA Chr1:45365756 GGAAACAAATGATTTCCAAAATTTAAAGTATATCT[C / T]AAAAGAGGACAAAAAAAGATTCGATATCATTCCAA Chr1:45375955 AAACGATCCCTTATTGAAAAATTTTGTATCCCCAC[A / G]ACCCAAAATATGCTCCGTTTATGGGCCAGAAATGG Chr1:45379885 CAAAAAAATTGAGACACATGATAATTCATAGCACT[G / T]ACTTGGGATGTTTATTAGTTGTGCTTACTAGTTAC Chr1:45379925 GGGATGTTTATTAGTTGTGCTTACTAGTTACTAGG[C / G]TATGCTATTGTCGAGTTTGTGTCATATAGTAGTAG Chr1:45393095 GTGAGAGAAAGCTATAAGAGAAAGTAACTAATGAG[C / G]TGTTTTCATTTTTTGATTATTCAGGAATCAATTTT Chr1:45397405 CATACATGGCCAACTGTCCCAAATGGGAGTCGACT[A / G]GAGGCACTGCTCCTTATTAGCCATATCCAGCACCA Chr1:45398583 GCTTGGCCATATACATACTTATGCGTGCTGCTGTG[C / T]TGGCGTCGCGGTGTGGGATTAAAAGCAAACGGTTC Chr1:45400035 GAATTTGATTCACTAATCAATTTGTGGCATGATTG[A / G]CGATTTTAAATTGGAGCAATAGAAACATTTTGATT Chr1:45402011 AAAAATTGTTTTAGACCTGCTATGATTTTCAACAT[A / T]TCAAAATAAAACATAATAACTAAACAAAACCATAA Chr1:45404038 TTTTTTATATCCGATGTGACTCAATTTTCGGTCTT[A / G]ATGCCCATTCGTAATCACACATATGTTTTTATTAG Chr1:45408105 CTGTAAACTAAAACACAATCAGAAAACATATTCTC[C / T]CCATCATCATATTCTCTCCATCATTTTCCACAGCA Chr1:45414874 GAATGAGATTGAAACCCTTTGAGAGCCAACCGCAT[C / T]GACTTTGATTTCACAACCGAAATTCTCGCAATTAA Chr1:45426756 GTCTATACGGGAAAATAATGACACTCACCAATCAC[C / T]ACCCTCATCCTTAACTTTGCAACCTCCCCCAACAC Chr1:45427123 TGAACCTTAAAATTGACAGACTTTGACGGTAGGAC[C / T]GTTTTGATACAAAATGAAAGTTGAAGGACCACTGA Chr1:45435638 TGGTGGTATCAGAACTAGTAAACTTGATGTGGGGC[G / T]TCCATCTGTCGATTACAAAAGTATCTGTCATGTTC

[0048] Table 3. KASP primer combinations

[0049]

[0050]

[0051] The genotyping effect of these 20 sets of KASP primers was detected using 95 peach genomic DNA samples, as follows:

[0052] 1. DNA sample concentration adjustment: Thaw 95 peach genomic DNA samples stored at -20°C on ice and dilute them with RNase-free water to a concentration of 5-50 ng.

[0053] 2. Prepare the Mix working solution: Each reaction contains 2.5 μl of DNA, 2.5 μl of 2×Master Mix, and 0.07 μl of Primermix; gently pipette five times to mix, and then centrifuge briefly at 3000 rpm. Fill the negative control NTC positions with the same volume of RNase-free water. Seal the wells with a special sealing film, and use a scraper to tighten the edges. Place the 384-well plate in a 4°C centrifuge and centrifuge briefly at 1200 rpm. Collect the sample to the bottom of the wells, check for air bubbles, and if present, gently tap the bottom of the tube before centrifuging again briefly.

[0054] 2. PCR reaction procedure: The PCR instrument used was an ABI 9700, and the reaction conditions were: ① 94℃ for 15 min; ② 94℃ for 20 sec, 60℃

[0055] 60sec, 10cycles; ③94℃20sec, 55℃60sec, 26cycles.

[0056] 3. Genotyping: Using Douglas genotyping software, the genotypes of each locus were determined based on the fluorescence signals. FAM and HEX data were plotted on the x and y axes, respectively. The FAM and HEX values ​​for each reaction well were corrected using the value of the reference dye (ROX) for that specific well. The fluorescence values ​​were standardized to obtain the relative fluorescence values ​​corresponding to FAM and HEX for each PCR reaction well. Based on the relative fluorescence values, the samples were clustered, and the genotype was further determined based on the sample clusters and fluorescence type. The detection results of 20 KASP primers are shown in Table 4, and the genotyping results are as follows: Figure 3 As shown. Specifically, it is determined by machine interpretation. Figure 3 For example, the second SNP clearly shows three clusters: those near X, those near y, and three clusters in the middle. y is labeled with FAM, x with Hex, and the middle ones are heterozygous. Some samples might be homozygous at that locus, resulting in only two clusters. If the selected sample has only one genotype, the graph will show only one cluster. However, regardless of the method, the genome can be genotyped. If the detection fails, it will be indicated by two black dots in the lower left corner of each graph. In this experiment, water was used as a negative control for PCR. Therefore, the results of the 20 KASP primer sets are as follows, all of which can accurately genotype the samples being tested.

[0057] Table 4

[0058]

[0059]

[0060] Table 4 (continued)

[0061]

[0062]

[0063]

[0064] Table 4 (continued)

[0065]

[0066]

[0067] The above invention is applicable to the selection of foreground and background in the peach breeding process, effectively predicts the initial flowering period of the test sample, and selects superior strains according to the breeding objectives: that is, if the goal is to breed cultivated peaches suitable for growth in low latitude regions, by testing the genotypes of the above 20 SNP loci, varieties containing 12 or more A-type alleles should be selected; if the goal is to breed cultivated peaches suitable for growth in mid- to high-latitude regions, varieties containing fewer than 12 A-type alleles should be selected.

Claims

1. The application of a molecular marker for the early-blooming phenotype of peach in the detection of the early-blooming phenotype of peach, characterized in that, The aforementioned early-flowering phenotypic molecular markers for peach are a combination of SNP molecular markers associated with the early-flowering phenotype of peach, including the following SNP loci on chromosome 1 of peach: Chr1:45355352, Chr1:45355677, Chr1:45355882, Chr1:45356724, Chr1:45358864, Chr1:45365756, Chr1:45375955, Chr1:45379885, Chr1:45379925 Chr1:45393095, Chr1:45397405, Chr1:45398583, Chr1:45400035, Chr1:45402011, Chr1:45404038, Chr1:45408105, Chr1:45414874, Chr1:45426756, Chr1:45427123, and Chr1:45435638; the SNP sites are classified into Allele R and Allele A according to genotype, and their bases are respectively: The flanking sequences of the SNP sites are as follows: Furthermore, the application defines an early-flowering genotype by summing the number of genotype determination results of 0 / 1 and 1 / 1 for each of the 20 SNP loci in the test sample, and defines a total of 12 or more as an early-flowering genotype, otherwise as a non-early-flowering genotype. If the test result is the same as Allele R, the result is recorded as 0; if it is the same as Allele A, the result is recorded as 1.

2. A primer combination for detecting the early-blooming phenotype of peach, characterized in that, The primers comprise 20 sets of primers for detecting the phenotypic molecular markers of early peach blossoms as described in claim 1.

3. The primer combination as described in claim 2, characterized in that, The primers are KASP primers, and each primer set includes two upstream forward primers connected to different fluorescent labels, and one downstream reverse primer P3.

4. The primer combination as described in claim 3, characterized in that, The two upstream forward primers are connected to FAM and HEX fluorescent labels, respectively.

5. The primer combination as described in claim 3, characterized in that, The primers include the following KASP primers:

6. A reagent kit for detecting the early-blooming phenotype of peach, characterized in that, It includes the primer combinations as described in any one of claims 2 to 4, respectively placed.

7. The kit according to claim 6, characterized in that, It also includes reagents for extracting genomic DNA from peaches to be tested.

8. The application of the primer combination as described in any one of claims 2 to 4, or the kit as described in claim 6 or 7, in the detection of early flowering phenotype in peaches; the application is defined by summing the number of genotype determination results of 0 / 1 and 1 / 1 for each of the 20 SNP loci of the sample to be tested, defining the total number of genotype determination results equal to or greater than 12 as early flowering genotype, otherwise as non-early flowering genotype. If the detection result is the same as Allele R, the result is recorded as 0; if it is the same as Allele A, the result is recorded as 1. Allele R and Allele A are defined as follows. 。 9. A method for detecting the early-blooming phenotype of peach, characterized in that, Take a genomic DNA sample of peach to be tested, and perform PCR reaction using the primer combination as described in any one of claims 2 to 5. Detect the PCR reaction products and determine the genotype of each locus. The genotype determination criteria are as follows: count the total number of genotype determination results of 0 / 1 and 1 / 1 for each of the 20 SNP loci of the sample to be tested. Define the total number of genotypes equal to or greater than 12 as early flowering genotypes, otherwise as non-early flowering genotypes. If the detection result is the same as Allele R, the result is recorded as 0; if it is the same as Allele A, the result is recorded as 1. Allele R and Allele A are defined as follows. 。 10. The method for detecting the early-blooming phenotype of peach as described in claim 9, characterized in that, The genotype of each locus is determined by the fluorescence signals generated by the FAM and HEX fluorescent labels connected by two upstream forward primers, respectively.

11. The method as described in claim 10, characterized in that, FAM and HEX fluorescence signal data were plotted on the x and y axes, respectively. The FAM and HEX values ​​for each reaction were corrected by the value of the reference dye ROX for that reaction. The fluorescence values ​​were standardized to obtain the relative fluorescence values ​​of FAM and HEX for each PCR reaction. Based on the relative fluorescence value, the samples are clustered, and the genotype is further determined based on the sample cluster and fluorescence type.

12. The method for detecting the early-blooming phenotype of peach as described in claim 11, characterized in that, By determining the genotype, the initial flowering period of the test sample can be effectively predicted, and superior strains can be screened according to the breeding objectives.

13. The method as described in claim 12, characterized in that, If the goal is to breed cultivated peaches suitable for growth in low-latitude regions, the genotypes of the 20 SNP loci should be tested, and varieties containing 12 or more Allele A nucleotides should be selected. If the goal is to breed cultivated peaches suitable for growth in mid- to high-latitude regions, varieties containing fewer than 12 Allele A nucleotides should be selected.

Images