GmbZIP36 protein related to aluminum resistance of plants in acid soil as well as coding gene and application of GmbZIP36 protein

Abstract

The invention discloses a GmbZIP36 protein related to aluminum resistance of plants in acid soil as well as a coding gene and application of the GmbZIP36 protein, and belongs to the technical field of bioengineering. The amino acid sequence of the GmbZIP36 protein is shown as SEQ ID NO: 2, 3 or 4, and the nucleotide sequence of the coding gene of the GmbZIP36 protein is shown as SEQ ID NO: 1. The invention finds that the expression of the GmbZIP36 gene is induced by aluminum stress, the relative root elongation and root biomass of arabidopsis thaliana and soybean under the aluminum stress can be obviously improved by over-expressing the gene in a plant, and aluminum accumulation is reduced, so that the aluminum resistance of the plant is enhanced. The invention provides a recombinant vector containing the gene, a host cell and application of the recombinant vector and the host cell in regulating and controlling the aluminum resistance of plants. Meanwhile, the invention also provides a method for producing an aluminum-resistant transgenic plant by using the gene, a kit for detecting the gene or protein and a method for carrying out assisted breeding by using the molecular marker linked with the gene. The invention provides a key gene resource for aluminum-resistant molecular breeding of crops, and has important significance for cultivating new varieties of crops adapting to acid soil.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to the GmbZIP36 protein and its encoding gene related to aluminum tolerance in plants in acidic soil, and its applications. Background Technology

[0002] Soil acidification is becoming an increasingly serious problem and a significant environmental issue hindering sustainable agricultural development. In my country, acidic soils are found in 15 provinces, covering a total area of ​​approximately 2.2 million km². 2 Soil acidification, covering 22.7% of the country's total land area, is expanding. It is primarily caused by natural weathering (such as desilication and aluminum enrichment in red soil) and human activities (acid rain, excessive nitrogen fertilizer application, etc.). Aluminum (Al) is the most abundant metallic element in the Earth's crust, after oxygen and silicon, and is a major component of inorganic minerals in soil. Soil acidification causes aluminum, which originally existed in the solid phase of the soil as oxides and aluminosilicates, to be converted into active Al... 3+ It dissolves into the soil solution in micromolar concentrations of Al. 3+ This can damage plant roots, inhibit their growth, and affect nutrient absorption. In acidic soils, aluminum toxicity has become a key factor limiting crop growth and yield, severely restricting agricultural production efficiency and urgently needing to be addressed.

[0003] Currently, methods to alleviate aluminum toxicity in acidic soils and improve plant aluminum tolerance mainly focus on two aspects: improving the soil environment and enhancing the plant's own tolerance, resulting in various technical pathways. 1) Soil improvement and management: This mainly includes applying lime (such as quicklime, limestone powder), increasing the application of organic fertilizers (compost, green manure), and adding mineral conditioners (silicon-calcium fertilizer, phosphate rock powder), etc. These methods can quickly neutralize soil acidity, increase pH value, and make active Al... 3+ It is converted into insoluble aluminum hydroxide precipitate, reducing the bioavailability of aluminum. However, lime and organic fertilizers require regular and large-scale application, which is costly. Rainwater leaching consumes soil conditioners, and the effect usually lasts for 1-3 years, requiring repeated investment; excessive application of lime leads to excessively high soil pH, causing deficiencies in trace elements such as iron, manganese, and zinc, resulting in "overcorrection" and bringing risks of pests, diseases, or heavy metal pollution; for large areas or complex terrain such as mountainous and hilly acidic soils, transportation and application costs are extremely high, making it difficult to promote on a large scale. 2) Enhancing plant tolerance: By introducing or regulating genes related to crop aluminum tolerance, crops can still grow normally in aluminum toxic environments, thereby reducing problems such as yield reduction and quality degradation caused by stress, and improving crop yield stability; reducing crop dependence on chemical inputs and reducing potential risks of environmental pollution; making marginal land that was originally unsuitable for cultivation have planting potential, helping to alleviate the problem of arable land resource shortage and expanding the range of arable land.

[0004] Soybeans, as an important dual-purpose crop in my country, serving as both grain and oilseed, are not only a vital source of plant protein and oil but also widely used in animal feed and industrial raw materials, playing a crucial role in ensuring national food security and sustainable agricultural development. With increasing soil acidification, aluminum toxicity in acidic soils poses an increasingly serious threat to the yield and quality of soybeans and other major crops. Aluminum toxicity not only inhibits soybean root growth but also leads to stunted growth, yellowing leaves, and a sharp decline in yield. Existing methods for mitigating aluminum toxicity in acidic soils have drawbacks such as environmental pollution, high costs, and unstable effectiveness. By using molecular breeding techniques to discover and utilize aluminum-tolerant genes, it is possible to effectively improve the adaptability of soybeans in acidic soils, reduce the impact of aluminum toxicity on soybean growth, and increase soybean yield and quality. This will not only help alleviate the problem of insufficient soybean production capacity in my country but also improve the planting efficiency of soybeans in acidic soil areas, promoting sustainable agricultural development.

[0005] Basic leucine zipper (bZIP) transcription factors are an important class of transcriptional regulators in plants, playing multiple functions in plant development and stress response. Members of the bZIP family possess conserved basic leucine zipper domains, enabling them to form homodimers or heterodimers. By binding to specific cis-acting elements, they regulate the expression of a series of downstream genes in the plant genome, helping plants adapt to adverse environmental conditions, including drought, salinity, and low temperature. However, the specific role of these transcription factors in aluminum toxicity remains unclear. In-depth research into the functions of the genes encoding soybean bZIP family transcription factors and their effects on plants will provide a theoretical basis and genetic resources for improving plant adaptability to aluminum toxicity in acidic soils and for breeding aluminum-tolerant crop varieties. The specific functions of bZIP members in soybean are highly differentiated, and no studies have yet revealed or suggested a correlation between GmbZIP36 and aluminum stress. Summary of the Invention

[0006] In view of the serious constraints on agricultural development caused by aluminum toxicity due to soil acidification, existing mitigation methods have drawbacks such as environmental pollution, high cost, and unstable effectiveness. There is an urgent need for a more efficient, durable, and environmentally friendly technology to solve the problem of aluminum toxicity in plants in acidic soils. The purpose of this invention is to provide a GmbZIP36 protein and its encoding gene related to aluminum tolerance in plants in acidic soils, as well as its applications.

[0007] To achieve the above objectives, the present invention employs the following technical solution: This invention provides a polynucleotide associated with aluminum tolerance in plants grown in acidic soils, wherein the polynucleotide is selected from the group consisting of: (a) A polynucleotide with a nucleotide sequence as shown in SEQ ID NO: 1; (b) Polynucleotides encoding proteins with amino acid sequences as shown in SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4; (c) A polynucleotide that has at least 90% sequence identity with the polynucleotide sequence described in (a) or (b) and encodes a protein that enhances the aluminum tolerance of plants.

[0008] It is the coding sequence of the gene Glyma.18G117100 or a functional fragment thereof.

[0009] This invention provides a recombinant expression vector comprising a polynucleotide associated with aluminum tolerance in plants grown in acidic soils, and a plant expression regulatory sequence operably linked to the polynucleotide. By directly utilizing these sequences, the plant's response to aluminum stress can be precisely enhanced; and the plant expression regulatory sequence operably linked to the polynucleotide ensures efficient transcription and translation of the polynucleotide in plant cells. Through the regulatory sequence driving gene expression, stable synthesis of functional proteins is achieved, thereby enhancing root growth and aluminum tolerance, and preventing functional failure due to uncontrolled expression.

[0010] This invention provides a genetically engineered plant host cell containing the aforementioned polynucleotide or the aforementioned recombinant expression vector. By creating a genetically engineered plant host cell and introducing specific genes or expression vectors, the plant's tolerance to aluminum toxicity in acidic soil is enhanced, thereby solving the problems of root damage and growth inhibition.

[0011] The host cell is a plant host cell.

[0012] This invention provides the application of the polynucleotides, recombinant expression vectors, or host cells related to aluminum tolerance in acidic soils, in regulating plant aluminum tolerance. By utilizing specific genetically engineered elements to regulate plant aluminum tolerance, the inhibitory effect of aluminum toxicity on plant growth in acidic soils can be addressed.

[0013] Preferably, the plant is Arabidopsis thaliana or soybean.

[0014] The regulation of plant aluminum tolerance is described as follows: the application is to enhance the aluminum tolerance of plants by increasing the expression level or activity of the polynucleotide or the protein encoded by it.

[0015] Preferably, the regulation of plant aluminum tolerance is to regulate the aluminum tolerance of plants in acidic soil.

[0016] More preferably, the acidic soil is soil with a pH less than 5.0.

[0017] This invention provides a method for producing transgenic plants with improved aluminum tolerance, comprising: The step of introducing the polynucleotide or the recombinant expression vector into the target plant cells, tissues or organs to obtain a transgenic plant with higher aluminum tolerance than the target plant.

[0018] The present invention provides a kit for detecting polynucleotides or proteins encoded by polynucleotides associated with aluminum tolerance in soybeans grown in acidic soils, the kit comprising primer pairs or probes for specifically amplifying or detecting the polynucleotides associated with aluminum tolerance in soybeans grown in acidic soils.

[0019] The present invention provides a plant breeding method, comprising the step of screening plant germplasm or progeny with enhanced aluminum tolerance using molecular markers linked to the polynucleotide or its coding region.

[0020] Compared with the prior art, the present invention achieves the following technical effects: The polynucleotides related to aluminum tolerance in plants in acidic soils provided by this invention employ polynucleotide sequences as shown in SEQ ID NO:1, directly utilizing verified gene sequences to ensure they encode proteins with aluminum tolerance functions; they employ polynucleotides encoding proteins with specific amino acid sequences such as SEQ ID NO:2~SEQ ID NO:4, ensuring the integrity of protein structure and maintaining its biological activity by precisely matching the sequences of known functional proteins; they employ polynucleotides with at least 90% sequence identity with the aforementioned sequences, allowing sequence variation while preserving function, and by setting an identity threshold, ensuring that proteins with enhanced aluminum tolerance functions can still be encoded even with high sequence similarity. This expands the applicability of the polynucleotide, enabling it to adapt to different plant or environmental conditions while avoiding functional loss; by providing a specific polynucleotide, it aims to enhance the aluminum tolerance of plants in acidic soils, thereby alleviating the inhibition of root growth by aluminum toxicity.

[0021] Furthermore, by mining and applying the GmbZIP36 gene (Glyma.18G117100) from the soybean bZIP transcription factor family, this study specifically addresses the problem of limited root elongation and growth in soybeans under aluminum stress, especially in acidic soils. Experiments show that, compared to the wild type, overexpression of this gene in Arabidopsis and soybean significantly reduces aluminum accumulation in plant roots, increases relative root elongation and root biomass, and enhances the plant's aluminum tolerance. This invention overcomes the drawbacks of relying on soil improvement to enhance crop survival in acidic soils, which involves long cycles, high costs, and potential environmental pollution if not properly managed. It provides a key gene resource for molecular breeding: GmbZIP36 effectively enhances the plant's aluminum tolerance by promoting root development, increasing relative root elongation and taproot elongation under aluminum stress, and reducing root aluminum accumulation. The discovery of this gene can not only improve the adaptability of soybeans to planting in acidic soils, but also promote the growth and development of soybean roots and enhance nutrient absorption capacity, which is of great significance for alleviating the insufficient soybean production capacity and improving the self-sufficiency rate in my country.

[0022] The present invention provides a method for producing transgenic plants with improved aluminum tolerance. Through genetic engineering, specific aluminum tolerance-related genetic elements are introduced into a plant system to produce transgenic plants with enhanced tolerance to aluminum toxicity in acidic soils, thereby overcoming the inhibitory effect of aluminum stress on plant growth.

[0023] This invention provides a kit for detecting polynucleotides or their encoded proteins associated with aluminum tolerance in soybeans grown in acidic soils. By providing a specially designed kit, it solves the problem of efficiently identifying genetic information related to aluminum tolerance in soybeans in acidic soil environments, thereby supporting plant aluminum tolerance breeding and research. The kit contains primer pairs or probes for specifically amplifying or detecting the polynucleotide sequence shown in SEQ ID NO:1. By designing primers or probes based on this specific sequence, high specificity and accuracy of the detection process are ensured, avoiding cross-reactions with other genes, thus reliably identifying the presence or expression level of the GmbZIP36 gene, providing technical support for the rapid cultivation of aluminum-tolerant plants.

[0024] The plant breeding method provided by this invention utilizes molecular marker-assisted selection technology to precisely screen for aluminum tolerance traits, thereby cultivating crop varieties that can grow stably in acidic soils with aluminum toxicity, reducing reliance on traditional soil amendments. Utilizing a specific polynucleotide (GmbZIP36 gene) directly related to aluminum tolerance in acidic soil plants, this polynucleotide has been experimentally verified to significantly enhance plant aluminum tolerance. Through its linked molecular markers, breeders can indirectly but accurately identify individuals carrying aluminum tolerance alleles during early plant development, avoiding the time-consuming and uncertainties of traditional phenotypic screening and accelerating the breeding process. Screening for plant germplasm or progeny with enhanced aluminum tolerance is based on rapid, high-throughput molecular marker detection, ensuring that the selected materials possess stable aluminum tolerance traits for subsequent breeding or direct planting. This directly solves the problem of inhibited crop growth in acidic soils, improving yield stability and land utilization. Attached Figure Description

[0025] Figure 1 for GmbZIP36 Structural diagram of the gene in the soybean genome and electrophoresis image of PCR amplification of the CDS region. Where A represents... GmbZIP36 Gene structure diagram, B is GmbZIP36 Agarose gel electrophoresis image of gene PCR amplification; Figure 2 Wild-type soybean under aluminum stress GmbZIP36 Relative gene expression level analysis. Where A represents soybean root tip expression under aluminum stress at different time points. GmbZIP36 The relative expression levels, B represents the soybean root tip under different concentrations of aluminum stress. GmbZIP36 The relative expression level; Figure 3 For overexpression GmbZIP36 A schematic diagram of the construction of a plant expression vector for a gene. Where A represents... GmbZIP36 Gene insertion into Arabidopsis overexpression vector pCambia3301 The diagram shows that B is... GmbZIP36 Gene insertion into soybean overexpression vector pTF101.1 A schematic diagram; Figure 4 This study aimed to identify the transcriptional and protein levels in homozygous overexpressing plants. A represents the results of qRT-PCR identification. GmbZIP36 Transcriptional levels of the gene in Arabidopsis thaliana overexpression, B is identified by qRT-PCR. GmbZIP36 Transcriptional levels of the gene in overexpressed soybean, C represents the translational level of the GmbZIP36 protein in the overexpression lines as determined by Western blot. Figure 5 For overexpression GmbZIP36Detection of relevant indicators to improve the aluminum tolerance of Arabidopsis thaliana seedlings. Among them, A is the physiological phenotype of taproot elongation of Arabidopsis thaliana seedlings under aluminum stress, B is the relative root elongation rate of Arabidopsis thaliana seedlings under aluminum stress, C is the taproot elongation of Arabidopsis thaliana seedlings under aluminum stress, D is the aluminum content in the root system of Arabidopsis thaliana seedlings under aluminum stress, and E is the root biomass of Arabidopsis thaliana seedlings under aluminum stress. Figure 6 For overexpression GmbZIP36 Detection of relevant indicators to improve the aluminum tolerance of soybean seedlings. Among them, A is the physiological phenotype of primary root elongation of soybean seedlings under aluminum stress, B is the relative root elongation rate of soybean seedlings under aluminum stress, C is the primary root elongation of soybean seedlings under aluminum stress, D is the aluminum content of soybean seedling roots under aluminum stress, E is the root biomass of soybean seedlings under aluminum stress, and F is the hematoxylin staining of soybean root tips under aluminum stress. Detailed Implementation

[0026] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0027] For experiments not specifically described in the examples, the procedures or conditions should be followed according to the conventional experimental procedures described in the literature in this field. Reagents or instruments whose manufacturers are not specified are all commercially available conventional reagent products.

[0028] Example 1: Wild-type soybean seedlings under aluminum stress GmbZIP36 Gene amplification and expression pattern analysis This invention used wild-type soybean Williams 82 (provided by the Institute of Crop Science, Chinese Academy of Agricultural Sciences) as experimental material. Transcriptome analysis of soybean roots under aluminum stress revealed a bZIP family transcription factor gene located on chromosome 18 of the soybean genome, whose transcriptional level was significantly induced by aluminum stress. The gene number is [gene number missing]. Glyma.18G117100 From comprehensive plant genome databases Phytozome The sequence of phytozome, as shown in SEQ ID No. 1, was obtained from the website (https: / / phytozome-next.jgi.doe.gov), and a gene structure diagram was drawn, as shown in the attached diagram. Figure 1 As shown, the coding gene contains 7 exons and 6 introns, with a total length of 3776 bp.

[0029] Total RNA was extracted from soybean roots under aluminum stress according to the method described in the plant total RNA extraction kit (TaKaRa, Code No. 9769). First-strand cDNA synthesis was performed using a reverse transcription kit (Thermo Fisher, K1622). Primer pairs were used to… GmbZIP-F :ATGGAACGAAGTGGCGGAAT and " GmbZIP-R The target gene was obtained by PCR amplification using the formula "CTCAGCATTATTGGTACCAT" (as shown in SEQ ID No. 13~SEQ ID No. 14). GmbZIP The CDS sequence was obtained. The PCR amplification products were identified by agarose gel electrophoresis, and the results are shown in the attached figure. Figure 1 As shown, a clear band is visible at approximately 981 bp, and the sequencing results of the amplified product are completely consistent with SEQ ID No. 1. This gene contains three transcripts in soybean, and the protein sequences expressed by its exons, depending on the splicing method, are shown in SEQ ID Nos. 2-4. Based on the conserved bZIP domain in its protein structure, the encoding gene is named... GmbZIP36 Subsequently, regarding GmbZIP36 The specific functions of the gene in soybean response to aluminum stress in acidic soil were analyzed, and the transcriptome data results were validated.

[0030]

[0031] Plump, wild-type Williams 82 soybean seeds were selected and evenly sown in a storage box filled with 1 / 2 vermiculite. The seeds were covered and germinated in the dark at 28°C for 3 days. After germination, the seedlings were wrapped in a sponge and cultured in Hoagland nutrient solution for 3 days. The photoperiod in the growth chamber was 14 hours of light / 10 hours of darkness, with an average temperature of 28°C and a relative humidity of 65%. Soybean seedlings with uniform growth were then subjected to the following aluminum stress treatments: (1) Aluminum stress at different times GmbZIP36 Expression level analysis: Soybean seedlings cultured in Hoagland nutrient solution for 5 days were transferred to aluminum-free treatment group (0.5 mM CaCl2, pH 5.0) and aluminum-stress treatment group (0.5 mM CaCl2, 30 μM AlCl3, pH 5.0) to continue growth. At 0, 3, 6, 12 and 24 h of treatment, the root tips of seedlings were cut at 0-1 cm, 15 root tips were divided into 1 group and flash-frozen with liquid nitrogen.

[0032] (2) Under different concentrations of aluminum stress GmbZIP36Expression level analysis: Soybean seedlings cultured in Hoagland nutrient solution for 5 days were transferred to treatment solutions containing 0, 5, 10, 15, and 30 μM AlCl3, respectively. The main component of the solution was 0.5 mM CaCl2, pH 5.0. After 12 h of treatment, the root tips of the seedlings were cut off at 0-1 cm and flash-frozen with liquid nitrogen.

[0033] Total RNA was extracted from soybean root tips of the different treatment groups, and cDNA was obtained by reverse transcription. The cDNA was diluted 5 times and used as a PCR template to select the soybean microtubule gene. Tubulin ( Glyma.19G37940 ( ) was used as an internal control. A real-time fluorescence quantitative PCR kit (PerfectStart #AQ601-01-V2) was used to detect aluminum stress. GmbZIP36 Relative gene expression level analysis. The real-time quantitative PCR reaction system is shown in Table 1, the reaction procedure in Table 2, and the primers used in Table 3. Data were statistically analyzed using SPSS software, and Dunnett's t-test was used to determine the significance of differences between each treatment group and the control group.

[0034] Table 1: Real-time quantitative PCR reaction system

[0035] Table 2: Real-time Quantitative PCR Reaction Procedure

[0036] Table 3: Primers for Real-Time Quantitative PCR

[0037] See appendix Figure 2 A, GmbZIP36 The relative expression level of [a substance] showed a trend of first increasing and then decreasing with the increase of aluminum stress time. At 12 h of aluminum stress, [the expression level was higher]. GmbZIP36 The expression level was the highest, and the difference from the control group (no aluminum stress) was the most significant. Under different concentrations of aluminum stress... GmbZIP36 The results of the expression level analysis are attached. Figure 2 B. As shown in the figure, at a low aluminum ion concentration (5 μM), GmbZIP36 The expression level was not significantly different from the control group (0 μM); 10 μM aluminum ions were sufficient to... GmbZIP36 Expression levels increased 3-fold under treatment with 15-30 μM aluminum ions. GmbZIP36 The expression of this gene was significantly induced, with a relative expression level increasing by 7–8 times. These results are consistent with the transcriptome data, indicating that this gene is induced by aluminum stress and plays an important role under aluminum toxicity conditions.

[0038] Example 2: GmbZIP36 Obtaining and identifying overexpressing plants 1. Construction of plant expression vectors Following the instructions of the plasmid mini-extraction kit (Solepro, D1100), plasmids were extracted from the expression vector. pCambia3301-35S-GFP and pTF101.1-35S-GFP Plasmids were extracted from Escherichia coli, and the vector was linearized using restriction endonucleases. The reaction system is shown in Tables 4-5.

[0039] Table 4: pCambia3301-35S-GFP Carrier linearized reaction system

[0040] Table 5: pTF101.1-35S-GFP Carrier linearized reaction system

[0041] Mix the above reaction system thoroughly and incubate in a metal bath at 37°C for 2 hours. Perform agarose gel electrophoresis on the reaction product, and recover the linearized vector according to the instructions of the DNA agarose gel recovery kit (Yuan Ye, R32223-50T), naming them as follows: pCambia3301-cut and pTF101.1-cut .

[0042] Primers No. 5-6 and SEQ ID No. 7-8 were used to amplify soybean cDNA. GmbZIP36 Gene fragments. The PCR products were detected by agarose gel electrophoresis, and recovered using a DNA agarose gel extraction kit. GmbZIP36 The fragments and bands are named respectively. pCambia-GmbZIP36 and pTF-GmbZIP36 .

[0043]

[0044] Use the Infusion method to obtain... pCambia3301-cut and pCambia-GmbZIP36 , pTF101.1-cut and pTF-GmbZIP36 The ligation reaction was carried out, and the reaction system is shown in Table 6. The vector construction process is shown in the appendix. Figure 3 .

[0045] Table 6: Connection Reaction System

[0046] The ligation product was transformed into Escherichia coli DH5α. After successful verification by bacterial culture PCR, the strain was preserved and sent for sequencing.

[0047] 2. Transformation of Agrobacterium Take correctly sequenced *E. coli* bacterial culture, shake to amplify, and extract plasmids. Use heat shock transformation to... pCambia3301-GmbZIP36 Transplanted with AGL-0 strain, pTF101.1-GmbZIP36 Transformed into strain GV3101. The specific transformation method is as follows: Agrobacterium AGL-0 and GV3101 competent cells were removed from the -80℃ freezer and thawed on ice. Using a pipette, aspirates were separately... pCambia3301-GmbZIP36 and pTF101.1-GmbZIP36 Add 0.5 μL of plasmid to 50 μL of competent cells, mix well, and incubate on ice for 20 min. Place the centrifuge tube containing the competent cells in liquid nitrogen for 1 min, then immediately heat shock in a 37°C water bath for 2 min. Add 500 μL of antibiotic-free LB liquid medium to the centrifuge tube and incubate at 28°C with a shaker at 200 rpm for 3 h. Centrifuge at 5000g for 5 min, discard the supernatant, resuspend the cells in the remaining liquid medium, and evenly spread on LB solid medium containing Kan / Rif and Kan / Str antibodies. Incubate upside down at 28°C for 2 days. Pick single clones for culture PCR and preserve the strain for subsequent transformation.

[0048] 3. Transformation of Arabidopsis thaliana by flower-dipping infection method Take and carry pCambia3301-GmbZIP36 The AGL-0 Agrobacterium strain expressing the vector was thawed on ice and inoculated at a 1:100 ratio into LB liquid medium containing Kan / Rif resistance, and propagated at 28°C. The OD of the bacterial culture was then measured. 600 Once the bacterial count exceeds 1.2, collect the cells by centrifugation. Resuspend the cells in an equal volume of infection solution (Silwet:sucrose:ddH2O = 30 μL: 5 g: 100 mL), mix well, and pour into a 20 cm diameter petri dish for later use. Select 20 wild-type Arabidopsis thaliana Col-0 plants that are in full bloom. Immerse all flower buds in the infection solution, constantly shaking the petri dish to ensure full contact between the infection solution and the flower buds. Infection time is 1 min. After infection, treat in the dark for 1 day, then transfer to a light-controlled culture room for normal culture until Arabidopsis thaliana matures. The seeds harvested are from the T0 generation.

[0049] 5. Soybean conversion using cotyledon node transformation method Take and carry pTF101.1-GmbZIP36 The GV3101 Agrobacterium strain expressing the vector was thawed on ice and inoculated at a 1:100 ratio into LB liquid medium containing Kan / Str resistance, and propagated at 28°C. The OD of the bacterial culture was then measured. 600 Once the pH value exceeds 1.2, collect the bacterial cells by centrifugation, resuspend the cells in an equal volume of infection solution (MS salt + 10mM MES + 200μM acetylsalicylic acid, pH 5.2) for later use.

[0050] Aseptically germinated Williams 82 soybean seeds were selected and surface-sterilized in the following order: 70% ethanol for 30 seconds, followed by 15% sodium hypochlorite for 10 minutes. The seeds were then rinsed five times with sterile water. The sterilized seeds were inoculated onto hormone-free MS medium and germinated in a light incubator for 5 days until the cotyledons were fully expanded and the hypocotyl elongated. The roots and true leaves were removed with a scalpel, and a transverse incision was made approximately 3 mm below the cotyledons along the hypocotyl, retaining the cotyledonary node explant with a pair of complete cotyledons and a small segment of the hypocotyl. The explants were immersed in the inoculum solution for 15 minutes to ensure complete adhesion of the Agrobacterium strain. The explants were removed, excess bacterial solution was aspirated, and they were transferred to co-culture medium (BM salt + 1.2 mg / L TDZ + 200 μM acetylsylgenone) and incubated in the dark at 25°C for 3 days. After co-culture, the explants were transferred to a medium containing 250 mg / L Srb antibiotic to inhibit Agrobacterium overgrowth. Explants were transferred to selection medium (BM salt + 2 mg / L Basta + 1.2 mg / L TDZ + Kan / Str) for further culture. The medium was changed every 2 weeks for 6-8 weeks until untransformed cells died and transformed cells formed resistant shoots. When the resistant shoots reached 2-3 cm in length, they were cut off and transferred to shoot elongation medium (BM salt + 0.2 mg / L BA) for continued light culture to promote robust stem growth. Healthy elongated shoots were then transferred to rooting medium (1 / 2 MS salt + 0.1 mg / L NAA) for 2-4 weeks until a complete root system was formed. Well-rooted test-tube seedlings were hardened off for 2-3 days by opening the bottle caps to gradually acclimate them to the external environment, and then transplanted to sterilized nutrient soil. After survival, they were transferred to a greenhouse for normal culture. These plants are T0 generation seedlings.

[0051] 6. Screening and identification of overexpressing plants Screening for overexpression of Arabidopsis thaliana: T0 generation seeds were surface-sterilized and evenly sown in MS medium containing 0.001% Basta for 3 days of dark germination. Then, they were transferred to a photoperiod of 16 h light / 8 h dark for further cultivation. During this period, untransformed Arabidopsis seedlings successively yellowed and died. The healthy four-leaf stage seedlings were transferred to soil for further cultivation, and harvested individually, designated as T1 generation. T1 generation seeds were sown again in MS medium with herbicide resistance, maintaining selection pressure until a 3:1 phenotypic segregation was observed in the seedling population (with 1 / 4 of the seedlings dying and yellowing). The non-yellowing seedlings were transferred to soil for further cultivation, and harvested individually, designated as T2 generation. T2 generation seeds were sown again in MS medium with herbicide resistance, and the transgenic seedling populations that did not exhibit yellowing or death were selected for further cultivation, mixed, and harvested, designated as T3 generation homozygous lines.

[0052] The screening process for overexpressing soybeans is similar to that for Arabidopsis thaliana. Seeds from T0 generation plants are harvested, and gene segregation ratios are analyzed after sowing to verify Mendel's laws of inheritance in transgenic plants. Homozygous lines are then screened for subsequent functional studies.

[0053] Identification of overexpression plants: During the seedling stage of the overexpression plants, two leaf samples were taken from each of four Arabidopsis thaliana seedlings and four soybean leaves at the three-leaf stage, and flash-frozen in liquid nitrogen. Total RNA was extracted from one leaf sample using the method described in Example 1, and the expression in positive plants was identified by real-time quantitative PCR. GmbZIP36 The transcriptional level of the gene was measured; another sample of total plant protein was extracted, and the translational level of the GmbZIP36 protein in positive plants was identified by Western blotting. The Western blotting procedure is as follows: The plant samples were crushed using a sample grinder. 6× loading buffer was added to centrifuge tubes, and the samples were boiled in a 94℃ metal bath for 10 min to lyse the plant leaves and completely denature the proteins. The samples were centrifuged at 12000 rpm for 10 min, and the supernatant was aspirated and loaded onto a 10% SDS-PAGE gel along with the protein marker. An initial voltage of 80V was set, and after the sample entered the separating gel, the voltage was increased to 120V until bromophenol blue migrated to the bottom of the gel. The protein in the gel was transferred to a nitrocellulose membrane using the sandwich method at a constant voltage of 100V for 1 h. The membrane was then blocked overnight in 5% skim milk. Since GFP was used as the tag during vector construction, the blocked membrane was incubated with the primary antibody Anti-GFP for 1 h, followed by incubation with the secondary antibody goat anti-rabbit IgG-HRP for 1 h, and finally washed three times with PBST. The membrane was then exposed to chemiluminescence for 1 min, developed, and photographed.

[0054] Molecular testing was performed on the transgenic lines to verify... GmbZIP36 Gene expression data are shown in the appendix. Figure 4 .like Figure 4 As shown in A, almost no [specific antibodies] can be detected in wild-type Arabidopsis thaliana. GmbZIP36 Expression, in four overexpression lines #1, #5, #6 and #13 GmbZIP36 Gene expression levels increased approximately 25-30 times, with line #1 showing the highest expression level. For example... Figure 4 As shown in B, in overexpression lines #4, #11, and #15... GmbZIP36 The expression levels were all high, with the highest expression level in strain #11 and the expression level in strain #7 being significantly higher than that in the wild type.

[0055] Western blot analysis was performed on the transgenic lines to verify the expression of the GmbZIP36 protein. The results are shown in the appendix. Figure 4 .like Figure 4 As shown in Figure C, compared to the wild type, the overexpression line showed a clear protein band at approximately 70 kDa. GmbZIP36 The gene-encoded protein is 36.4 kDa, and the fusion tag GFP protein is 32.8 kDa. High protein expression levels were observed in the four Arabidopsis overexpression lines #1, #5, #6, and #13, while high levels of GmbZIP36 protein were observed in soybean lines #4 and #11, low levels in line #15, and only very weak protein accumulation was detected in line #7. These results demonstrate that the vector and transformation method constructed in this invention can effectively... GmbZIP36 The gene was successfully and efficiently transcribed and translated in Arabidopsis thaliana and soybean overexpression lines.

[0056] Example 3: Overexpression under aluminum stress GmbZIP36 Aluminum tolerance study of Arabidopsis thaliana plants (1) Detection of relative root elongation and taproot elongation in Arabidopsis thaliana under aluminum stress: Take wild-type Col-0 and 4 GmbZIP36 Overexpressing Arabidopsis seeds were surface-sterilized with 1% sodium hypochlorite for 10 min, rinsed 5 times with sterile water, and evenly sown on MS solid medium. Vernalization was carried out at 4°C in the dark for 3 days. After germination, the culture dishes were held vertically to allow the Arabidopsis roots to continue growing on the surface of the medium. When the roots reached approximately 0.5 cm in length, Arabidopsis seedlings with uniform root length were transferred separately to Al-free medium and medium containing 50 µM AlCl3 in a sterile operating table. The initial root tip position was marked on square culture dishes. Each treatment group contained at least 40 Arabidopsis seedlings. After 5 days of vertical culture, the final root tip position was marked, and the root length before and after aluminum treatment was measured. The difference in root elongation and the relative root elongation rate were calculated.

[0057] Relative root elongation (RRE) = Root elongation before aluminum treatment / Root elongation after aluminum treatment × 100%.

[0058] (2) Detection of aluminum content in Arabidopsis roots under aluminum stress: Arabidopsis seedlings grown vertically for 7 days on MS solid medium were collected, grouped into clusters of 50, and pretreated in 1 / 5 Hoagland nutrient solution for 3 days, with the nutrient solution changed every other day. The seedlings were then treated in a 0.5 mM CaCl2 solution containing 30 µM AlCl3 for 2 days. After treatment, the seedlings were washed 5 times with 0.5 mM CaCl2 solution, and the entire root was harvested and the surface moisture was blotted dry. Approximately 1 g of root sample was weighed using a 0.01% daily concentration, the value was recorded, and the sample was placed in a 20 mL digestion tube. 2 mL of nitric acid was added, and the sample was digested at 150 °C until reduced to 1 mL. External standard solutions (0, 0.5, 1, 2, 4, 8, 10, 15, and 20 μg / mL Al(NO3)3 solutions) and internal standard solution (10 μg / mL Al(NO3)3 solution) were prepared. The aluminum content in the digestion solution was determined using inductively coupled plasma mass spectrometry (ICP-MS).

[0059] (3) Detection of root biomass in Arabidopsis thaliana under aluminum stress: Arabidopsis seedlings that had grown vertically for 7 days on MS solid medium were transferred in clusters of 10 to 1 / 5 Hoagland nutrient solution for hydroponics for 5 days, with the nutrient solution changed every other day. The seedlings were then transferred to both an aluminum-free treatment group (0.5 mM CaCl2 solution, pH 5.0) and an aluminum-treated group (0.5 mM CaCl2 solution containing 30 µM AlCl3, pH 5.0) for 5 days. After treatment, the seedlings were washed 5 times with 0.5 mM CaCl2 solution, harvested whole, dried, and weighed.

[0060] Data on relative root elongation, taproot elongation, root aluminum content, and root biomass under aluminum stress were statistically analyzed using SPSS software. Dunnett's t-test was used to determine the significance of differences between groups, and the overexpression was comprehensively evaluated. GmbZIP36 The role of genes in improving aluminum tolerance in plants.

[0061] See appendix Figure 5 Compared to wild-type Col-0, four Arabidopsis thaliana species under aluminum stress... GmbZIP36 Overexpression lines #1, #5, #6, and #13 exhibited stronger aluminum tolerance, good root growth, and milder symptoms of aluminum toxicity. Specific phenotypes are as follows: Figure 5 As shown in A and 5C, under aluminum-free conditions, the taproots of all five seedlings grew well, with root elongation ranging from 2.8 to 3.1 cm, and no significant differences were observed among the groups. However, under aluminum stress, the taproot elongation of the wild-type Col-0 was significantly inhibited, with a root elongation of approximately 1.6 cm and a relative root elongation rate of only 59.3%. Figure 5 B); 4 GmbZIP36 The root elongation of overexpression lines #1, #5, #6, and #13 was higher than that of the wild type, with an elongation of approximately 1.8–2.6 cm, and relative root elongation rates of 71.1%, 70.3%, 76.8%, and 64.4%, respectively. Figure 5 B), significantly higher than the wild type. Continue to investigate... GmbZIP36 The detection of aluminum accumulation in the roots of the overexpression lines revealed that the aluminum content in the roots of the four overexpression lines #1, #5, #6, and #13 was 0.76, 0.79, 0.65, and 0.87 mg / g, respectively, which was significantly lower than the 1.18 mg / g of the wild type. Figure 5 D) Overexpressing strains accumulate less aluminum in their roots and suffer less aluminum toxicity. For example... Figure 5As shown in Figure E, the average root biomass of wild-type Arabidopsis thaliana under aluminum stress was 19.8 mg / plant, while the average root biomass of the four overexpression lines #1, #5, #6, and #13 were 25.8, 25.1, 26.7, and 22.4 mg / plant, respectively. This result further demonstrates that under aluminum stress... GmbZIP36 The overexpression lines showed better root growth than the wild-type plants, with a 13-35% increase in total root biomass. GmbZIP36 The overexpression line #6 showed significantly higher aluminum tolerance in all physiological indicators under aluminum stress than the wild type.

[0062] Example 4: Overexpression under aluminum stress GmbZIP36 An investigation into the aluminum tolerance of soybean plants (1) Detection of relative root elongation and taproot elongation in soybeans under aluminum stress: Three-day-old soybean seedlings were cultured in a 0.5 mM CaCl2 solution for 7 days. Seedlings with uniform growth were selected, their initial root lengths recorded, and numbered. These seedlings were then transferred to either an aluminum-free treatment group (0.5 mM CaCl2 solution, pH 5.0) or an aluminum-treated group (0.5 mM CaCl2 solution containing 30 µM AlCl3, pH 5.0), with 15-20 seedlings in each group. Two days later, the seedlings were removed, and their final root lengths were measured. The difference in root elongation and the relative root elongation rate were calculated.

[0063] (2) Detection of aluminum content in soybean roots under aluminum stress: Soybean seedlings grown for 15 days were transferred to a 0.5 mM CaCl2 solution containing 30 μM AlCl3 for aluminum treatment for 3 days. After treatment, the seedlings were washed 5 times with 0.5 mM CaCl2 solution, and the whole roots were harvested, the surface moisture was absorbed, and the roots were dried in a 65℃ oven. Approximately 1 g of root dry matter was weighed using a 0.01% daily concentration, the value was recorded, and the sample was placed in a 20 mL digestion tube. 2 mL of nitric acid was added, and the sample was digested at 150℃ until reduced to 1 mL. External standard solutions (0, 0.5, 1, 2, 4, 8, 10, 15, and 20 μg / mL Al(NO3)3 solutions) and internal standard solution (10 μg / mL Al(NO3)3 solution) were prepared. The Al content in the digestion solution was determined using inductively coupled plasma mass spectrometry (ICP-MS).

[0064] (3) Detection of soybean root biomass under aluminum stress: Soybean seedlings that had grown for 15 days were transferred to either an aluminum-free treatment group (0.5 mM CaCl2 solution, pH 5.0) or an aluminum-treated group (0.5 mM CaCl2 solution containing 30 µM AlCl3, pH 5.0) for 5 days. After treatment, the seedlings were washed 5 times with 0.5 mM CaCl2 solution, harvested whole, dried, and weighed.

[0065] (4) Hematoxylin staining of soybean root tips under aluminum stress: Soybean seedlings grown for 15 days were transferred to a 0.5 mM CaCl2 solution containing 30 μM AlCl3 for aluminum treatment for 2 days. 5 cm sections of soybean root tips were cut with a blade, rinsed 5 times with deionized water, and fixed in Carnot fixative at room temperature for 24 hours. 0.5 g of hematoxylin biological staining agent (Maclean, HH0311XGVP4I) and 0.05 g of potassium iodate (Aladdin, P116286) were dissolved thoroughly in 65℃ deionized water to obtain the hematoxylin staining solution. The fixed soybean root tips were immersed in the hematoxylin staining solution for 30 min, heated in a water bath to maintain the staining solution temperature at no less than 65℃. After staining, the root tips were removed, rinsed 3 times with deionized water to remove excess dye, and observed under a stereomicroscope.

[0066] See appendix Figure 6 , GmbZIP36 Overexpressing soybean lines exhibited stronger aluminum tolerance than the wild-type Williams82 under aluminum stress, manifested in longer taproot elongation, higher relative root elongation rate, greater root biomass, and less root aluminum accumulation under aluminum stress. (Because overexpressing line #7 showed differences at both transcriptional and translational levels...) GmbZIP36 The expression levels were all low, and considering that these might be false positives, and the phenotype under aluminum stress was not obvious, relevant data for this line were not listed. Figure 6 As shown in A, regardless of whether aluminum stress treatment is applied, 3 GmbZIP36 The overexpression lines showed more vigorous lateral root development and more extensive root systems compared to the wild-type Williams 82. Under normal conditions, the taproot elongation of the four seedlings was consistent, with root elongation ranging from 12.2 to 14.6 cm in each group, showing no significant difference. Under aluminum stress, taproot growth in wild-type soybean was significantly inhibited, and the number of lateral roots was also reduced, with an average taproot elongation of 7.7 cm. Figure 6 C), the relative root elongation rate was only 59.7% ( Figure 6 B); 3 GmbZIP36 The overexpression lines #4, #11, and #15 all showed higher taproot elongation than the wild type, ranging from 8.9 to 10.2 cm, with relative root elongation rates of 68.3%, 70.7%, and 66.4%, respectively. Figure 6 B). Continue with GmbZIP36 The detection of root aluminum content in the overexpression lines revealed that the root aluminum content in the three overexpression lines #4, #11, and #15 was 131.7, 124.9, and 130.2 µg / g, respectively, significantly lower than that of the wild type (164.1 µg / g). Figure 6 D); such as Figure 6 As shown in F, under aluminum stress, the root tips of wild-type soybean Williams 82 showed the deepest coloring, with 3... GmbZIP36The root tips of overexpression lines #4, #11, and #15 showed lighter staining, further indicating that compared to the wild type, GmbZIP36 Overexpression significantly reduced the aluminum content accumulated in soybean root tips. For example... Figure 6 As shown in Figure E, under normal growth conditions, the average root biomass of wild-type soybean was 3.2 g / plant, while the average root biomass of the three overexpression lines #4, #11, and #15 were 4.6, 4.9, and 4.2 g / plant, respectively, significantly higher than that of the wild type. Under aluminum stress, root growth of wild-type soybean was significantly inhibited, with an average root biomass of only 2.2 g / plant. Lateral root development in the three overexpression lines #4, #11, and #15 was almost unaffected by aluminum stress, and their total root biomass was approximately twice that of the wild type. These data indicate that... GmbZIP36 Overexpression significantly improved the aluminum tolerance of soybeans.

[0067] This invention constructs transgenic structures using genetic engineering technology. GmbZIP36 Plant expression vectors ( pCambia3301- GmbZIP36 and pTF101.1 - GmbZIP36 The virus was transferred into wild-type Arabidopsis Col-0 and soybean Williams 82 plants using the flower-dipping infection method and the cotyledon node transformation method, respectively. GmbZIP36 The gene was overexpressed in Arabidopsis and soybean, thereby enabling the plants to exhibit aluminum tolerance. This invention is the first to discover that overexpression of the gene in Arabidopsis and soybean... GmbZIP36 The transgenic lines showed significantly enhanced tolerance to aluminum toxicity in acidic soils. Compared to the wild type, overexpression of this gene not only increased relative root elongation and root biomass under aluminum stress but also significantly reduced root aluminum accumulation, thus improving the plant's aluminum tolerance. Based on functional validation of this gene in Arabidopsis and soybean, it is speculated that it may have a similar effect in enhancing aluminum tolerance in other plants. This invention is of great significance for elucidating the mechanism of aluminum tolerance in soybeans and provides genetic resources and technical support for expanding soybean cultivation in acidic soils with severe aluminum toxicity.

[0068] The above content is only for illustrating the technical concept of the present invention and should not be construed as limiting the scope of protection of the present invention. Any modifications made to the technical solution based on the technical concept proposed in this invention shall fall within the scope of protection of the claims of this invention.

Claims

1. A polynucleotide associated with aluminum tolerance in plants grown in acidic soils, characterized in that, The polynucleotide is selected from the following group: (a) A polynucleotide with a nucleotide sequence as shown in SEQ ID NO: 1; (b) Polynucleotides encoding proteins with amino acid sequences as shown in SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4; (c) A polynucleotide that has at least 90% sequence identity with the polynucleotide sequence described in (a) or (b) and encodes a protein that enhances the aluminum tolerance of plants.

2. The polynucleotide related to aluminum tolerance in plants in acidic soil according to claim 1, characterized in that, It is the coding sequence of the gene Glyma.18G117100 or a functional fragment thereof.

3. A recombinant expression vector, characterized in that, It comprises a polynucleotide associated with aluminum tolerance in acidic soil plants as described in claim 1 or 2, and a plant expression regulatory sequence operatively linked to the polynucleotide.

4. A genetically engineered plant host cell, characterized in that, It includes a polynucleotide related to aluminum tolerance in acidic soil plants as described in claim 1 or 2, or a recombinant expression vector as described in claim 3.

5. The genetically engineered plant host cell according to claim 4, characterized in that, The host cell is a plant host cell.

6. The application of a polynucleotide related to aluminum tolerance in acidic soil plants as described in claim 1 or 2, or a recombinant expression vector as described in claim 3, or a genetically engineered plant host cell as described in claim 4 or 5 in regulating aluminum tolerance in plants.

7. The application according to claim 6, characterized in that, The regulation of plant aluminum tolerance is described as follows: the application is to enhance the aluminum tolerance of plants by increasing the expression level or activity of the polynucleotide or the protein encoded by it.

8. A method for producing transgenic plants with improved aluminum tolerance, characterized in that, include: The step of introducing the polynucleotide of claim 1 or 2 or the recombinant expression vector of claim 3 into the target plant cells, tissues or organs to obtain a transgenic plant with higher aluminum tolerance than the target plant.

9. A kit for detecting polynucleotides or proteins encoded by polynucleotides associated with aluminum tolerance in soybeans grown in acidic soils, characterized in that, The kit contains primer pairs or probes for the specific amplification or detection of the polynucleotides associated with aluminum tolerance in soybeans in acidic soils as described in claim 1 or 2.

10. A plant breeding method, characterized in that, The method includes the step of screening plant germplasm or progeny with enhanced aluminum tolerance using molecular markers linked to the polynucleotides or their coding regions as described in claim 1 or 2.

Images