Molecular marker, method, primer pair and kit for identifying petal size character of muskmelon and application of molecular marker, method, primer pair and kit

Abstract

The invention discloses a molecular marker, a method, a primer pair and a kit for identifying the petal size character of thin-skinned muskmelon and application of the molecular marker, and belongs to the technical field of molecular marker-assisted breeding. The invention aims to obtain a chromosome segment and a molecular marker which are closely linked with the petal size of a thin-skinned muskmelon. The invention provides a molecular marker for identifying the petal size character of a thin-skinned muskmelon. The molecular marker is shown as SEQ ID NO.1 or SEQ ID NO.2. The molecular marker is used for identifying the petal size character of the thin-skinned muskmelon. According to the identification method, the genome DNA of the to-be-detected muskmelon sample is extracted in the seedling stage, so that the petal size of the muskmelon can be identified, the operation is simple and convenient, the identification accuracy and efficiency are high, and an effective breeding tool and technology are provided for molecular marker-assisted selection breeding of the petal size of the muskmelon.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker-assisted breeding, and specifically relates to a molecular marker, a method, a primer pair, a kit and an application thereof for identifying petal size traits of thin-skinned melon. Background Art

[0002] Muskmelon (Cucumis melo L.) is an annual vine herbaceous plant of the genus Cucurbitaceae. It is widely cultivated in my country and around the world and is an important economic crop in the world. Flowers are important reproductive organs of melons and are closely related to pollination quality and fruit setting rate. The morphological construction of floral organs is a key link in the growth of melons and directly affects the growth and development of melons. Thin-skinned melon (Cucumis melo ssp. agrestis) has a short maturity period and high quality. Thick-skinned melon and thin-skinned melon have obvious independent domestication patterns in the evolution process. In terms of trait variation, the regulatory genes of the two subspecies are not the same. Therefore, in the breeding process, corresponding molecular markers should be selected according to different subspecies for screening and identification to ensure higher and more accurate breeding efficiency. It is of great significance to explore the key main effect loci of petal size of thin-skinned melon and apply them to germplasm resource screening and molecular breeding.

[0003] InDel molecular markers are polymorphic molecular markers formed by the deletion and insertion of bases in chromosome sequences. This type of marker is widely distributed in the genome, easy to operate, easy to observe, and generally applicable to different germplasm resources of the same species. Therefore, it is of great significance to explore InDel molecular markers that can be used for the identification of petal size traits in thin-skinned melons and apply them to the screening of melon germplasm resources and molecular breeding. Summary of the invention

[0004] The purpose of the present invention is to apply molecular markers to the screening of thin-skinned melon germplasm resources with different petal sizes, obtain chromosome segments and molecular markers closely linked to the petal size of thin-skinned melons, and then more quickly and accurately identify the petal size of thin-skinned melons in the seedling stage.

[0005] The invention provides a molecular marker for identifying the petal size trait of thin-skinned melon, and the molecular marker is shown as SEQ ID NO.1 or SEQ ID NO.2.

[0006] The invention provides a primer pair for amplifying and identifying a molecular marker for petal size trait of thin-skinned melon. The sequences of the primer pair are shown as SEQ ID NO.3 and SEQ ID NO.4.

[0007] The invention provides a kit for identifying the petal size trait of thin-skinned melon, and the kit comprises the above-mentioned primer pair.

[0008] The present invention provides an application of the molecular marker, the primer pair or the kit in identifying the petal size trait of thin-skinned melon.

[0009] The present invention provides an application of the molecular marker, the primer pair or the kit in auxiliary identification, auxiliary breeding and screening of petal size traits of thin-skinned melon.

[0010] It is further defined that the petal length range of the large petal trait is 16.6mm-20.7mm, the petal width range is: 11.7mm-14.9mm, the petal length range of the small petal trait is: 8.6mm-12.8mm, the petal width range is: 7.2mm-9.7mm.

[0011] The present invention provides a method for identifying the size trait of petals of thin-skinned melon, and the method is as follows:

[0012] Step 1: Extracting the genomic DNA of the thin-skinned melon to be tested;

[0013] Step 2: Using the DNA obtained in step 1 as a template, perform PCR amplification using the primer pair described in claim 2 to obtain a PCR product to determine the size characteristics of the petals of the thin-skinned melon.

[0014] Further defined, the PCR reaction system in step 1 is: 1 μL of upstream and downstream primers each (primer concentration is 2 pM), 2 μL of DNA template (concentration is 30 ng / μL), 1 μL of 10×PCR Buffer (containing 15 mM Mg2+), 0.15 μL of dNTP (concentration is 10 mM), 0.1 μL of Taq enzyme (5 U / μL), and 6.75 μL of sterile deionized water; the PCR reaction program is: pre-denaturation at 94°C for 7 min, denaturation at 94°C for 30 s, annealing at 53°C for 30 s, extension at 72°C for 30 s, 30 cycles, extension at 72°C for 10 min, and storage at 4°C.

[0015] It is further defined that in step 2, if the amplified product contains a 204 bp fragment, it is determined to be a large petal type; if the amplified product contains a 185 bp fragment, it is determined to be a small petal type.

[0016] It is further defined that the petal length range of the large petal trait is 16.6mm-20.7mm, the petal width range is: 11.7mm-14.9mm, the petal length range of the small petal trait is: 8.6mm-12.8mm, the petal width range is: 7.2mm-9.7mm.

[0017] Beneficial effects: In the early stage of the present invention, a genetic population with large petals (cultivated species of thin-skinned melon) and small petals (wild species of thin-skinned melon) as parents was constructed, and a chromosome segment closely linked to the petal size trait of thin-skinned melon was obtained by using genome resequencing and BSA-seq (Bulked Segregation Analysis) technology. A stable main effect positioning interval was obtained by conducting two years of phenotypic identification and QTL (Quantitative Trait Loci) analysis in the genetic population, and it was named Cmqps8.1. InDel molecular markers were developed in the main effect chromosome segment. The markers were located in the positioning interval of the key site Cmqps8.1 of the petal size trait of thin-skinned melon, and were closely linked to the petal size trait. By using the method of molecular marker-assisted selection, the genomic DNA of the sample to be tested can be extracted at the seedling stage of thin-skinned melon to perform molecular marker-assisted selection on the petal size of thin-skinned melon, thereby improving the accuracy and efficiency of breeding. The molecular marker can be applied to molecular breeding of thin-skinned melon, and provides an efficient molecular breeding tool for the identification of macromolecules of thin-skinned melon petals.

[0018] The present invention designs primer pairs using molecular markers closely linked to the petal size trait of thin-skinned melons developed and obtained using parent resequencing data. Due to the polymorphism of short sequence insertion and deletion in the molecular marker fragments in different melon materials, PCR amplification of melon seedling genomic DNA is performed using the obtained primer pairs, and the size of the PCR product fragments is detected using polyacrylamide gel electrophoresis, so that the size of the petals of thin-skinned melons can be molecularly identified at the seedling stage. The identification method can identify the size of the petals of thin-skinned melons by extracting the genomic DNA of the thin-skinned melon samples to be tested at the seedling stage. The operation is simple, and the accuracy and efficiency of the identification are high, providing an effective breeding tool and technology for molecular marker-assisted selection breeding of the petal size of thin-skinned melons. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 These are the two-year positioning results of the main effect site Cmqps8.1 of the petal size of thin-skinned melon in Example 1; Figure A is the result map of 2023, and Figure B is the result map of 2024;

[0020] Figure 2 This is a result diagram of polyacrylamide gel electrophoresis detection of amplification products obtained after PCR amplification of large petal and small petal materials in natural populations using the primer pairs described in Example 2; DETAILED DESCRIPTION

[0021] The present invention is further described in detail below in conjunction with specific embodiments and drawings. Except for the contents specifically mentioned below, the processes, conditions, experimental methods and reagents for implementing the present invention are common knowledge in the art and conventional products on the market, and the present invention has no particular limitations.

[0022] Method for extraction of genomic DNA:

[0023] The genomic DNA extraction method was based on the method of Murray et al. (1980) (Murray M., Thompson WF, Rapid isolation of high molecular weight plant DNA [J]. Nucl. Acid. Res., 1980, 8: 668-673.), and was improved on this basis.

[0024] The specific steps are as follows:

[0025] ① Wash and dry the collected young true leaves with sterile water, take 0.2 g and put them into a 1.5 mL centrifuge tube, add liquid nitrogen and grind them thoroughly into white powder, add 800 μL of 2% CTAB solution preheated at 65°C (2% CTAB, 100 mmol / L Tris-HCl pH=8.0), 1.4 mol / L NaCl, 20 mmol / L EDTA pH=8.0, 2% β-mercaptoethanol) and mix thoroughly, place in a 65°C water bath for 1 hour, and shake gently every 10 minutes.

[0026] ②Take out the centrifuge tube, wait for it to cool to room temperature, and centrifuge at 13000rpm for 10 minutes. Aspirate the supernatant and place it in a new centrifuge tube. To prevent mechanical shear force from damaging the DNA, the tip of the pipette used for transfer needs to be cut off with scissors in advance to expand the pipette port.

[0027] ③ Add 750 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the cell wall, mix thoroughly, let it stand for 10 minutes, and then centrifuge at 13000 rpm for 10 minutes.

[0028] ④ Take out the centrifuge tube and use the same method as above to suck out 700 μL of supernatant with the pipette tip against the wall and place it in a new centrifuge tube.

[0029] ⑤ Add 700 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the wall, gently shake the centrifuge tube to fully mix the solution, let it stand for 10 minutes, then centrifuge at 13000 rpm for 10 minutes.

[0030] ⑥ Aspirate 650 μL of supernatant and place it in a new tube, add 2 μL RNase (10 mg / mL), mix well, and place in a 37°C water bath for 2 hours.

[0031] ⑦ Add 650 μL of chloroform:isoamyl alcohol (24:1, V / V) solution to the cell wall, mix thoroughly, let it stand for 10 minutes, and then centrifuge at 13000 rpm for 10 minutes.

[0032] ⑧ Aspirate 550 μL of supernatant from the tube and place it in a new tube. Add 550 μL of -20℃ pre-cooled isopropanol (add it to the tube wall). Close the tube cap tightly, turn it upside down several times, and place it in a -20℃ refrigerator for 60 minutes.

[0033] ⑨Take out the centrifuge tube and centrifuge it at 13000rpm for 10min. Carefully discard the supernatant and retain the sediment at the bottom of the centrifuge tube.

[0034] ⑩ Wash the precipitate three times with pre-cooled 70% ethanol, place the centrifuge tube in a clean bench, blow dry with sterile air, add 200 μL ddH2O to dissolve, and store at -20°C for later use.

[0035] The female and male parents in Example 1 are disclosed in Liu Shi, Gao Peng, Zhu Qianglong, Zhu Zicheng, Liu Hongyu, Wang Xuezheng, Weng Yiqun, Gao Meiling and Luan Feishi*. Resequencing of 297 melon accessions reveals the genomic history of improvement and loci related to fruit traits in melon. 2020, 18, 2545-2558, Plant Biotechnology Journal.

[0036] Example 1. Molecular markers tightly linked to the petal size trait of muskmelon and methods for obtaining the same

[0037] This embodiment provides a key gene linkage locus for the petal size trait of thin-skinned melon, an InDel marker, and a method for obtaining the marker.

[0038] (1) Selection of test materials:

[0039] The test materials include maternal, paternal, F1 and F2 generation populations;

[0040] The male material is: m1-15, cultivar thin-skinned melon, with a petal length of 18.4±0.7mm and a petal width of 13.1±0.4mm;

[0041] The female material is: 1190wd, wild thin-skinned melon, petal length is 10.8±0.6mm, petal width is 7.9±0.4mm;

[0042] The F1 generation is: the F1 generation obtained by hybridizing the above two materials as parents;

[0043] The F2 generation population is: the F2 generation population obtained by self-pollination of the above F1 generation, with 607 and 451 F2 generation populations sown in 2023 and 2024 respectively.

[0044] (2) Phenotypic identification of petal size of test materials: Three flowers of each plant were collected on the day of flowering, and the length and width of the petals were measured using a vernier caliper;

[0045] According to the survey results of this step, the petal length of the F1 generation is 15.7±0.6mm, and the petal width is 11.1±0.4mm, which is between the two parents. The petal length and petal width in the F2 generation show a normal distribution, indicating that the petal size of melon is a quantitative trait.

[0046] (3) Using BSA-seq and genetic linkage analysis methods, we obtained the chromosome segment that is closely linked to the petal size trait of thin-skinned melon:

[0047] Thirty plants with large petals (21.4-23.4 mm) and 30 plants with small petals (9.2-12.4 mm) were selected from the F2 generation, and DNA from each plant was extracted. After adjusting the DNA concentration to be consistent, equal amounts were mixed to construct a gene pool for petal size of thin-skinned melon, and BSA-seq analysis was performed. Based on the analysis results and the genome resequencing data of the two parents, InDel molecular markers were developed within the chromosome segment of the BSA-seq analysis results, and genetic linkage analysis was performed on the F2 populations in 2023 and 2024. Finally, the key major effect locus of the petal size trait of thin-skinned melon was located within about 1.42 Mb on chromosome 8 of the melon genome, and it was named Cmqps8.1. Figure 1 These are the preliminary results of localizing the main locus Cmqps8.1 affecting the petal size of muskmelon.

[0048] (4) Development of candidate InDel markers:

[0049] Based on the resequencing data of the two parents, InDel molecular markers were developed, and genotyping of each plant in the natural population was performed. Combined with the phenotypic data, the consistency between genotype and phenotype was determined. The results showed that the change of an InDel site in this segment was closely linked to the petal size.

[0050] Furthermore, the Chr08_9521560 molecular marker tightly linked to the petal size of the thin-skinned melon was obtained. The Chr08_9521560 molecular marker was a 204bp nucleotide fragment with a nucleotide sequence as shown in SEQ ID NO.1 and a 185bp nucleotide fragment with a nucleotide sequence as shown in SEQ ID NO.2; the SEQ ID NO.1 was tightly linked to the large petal shape, and the SEQ ID NO.2 was tightly linked to the small petal trait.

[0051] The petal length of the large petal trait ranges from 16.6mm to 20.7mm, and the petal width ranges from 11.7mm to 14.9mm. The petal length of the small petal trait ranges from 8.6mm to 12.8mm, and the petal width ranges from 7.2mm to 9.7mm.

[0052] SEQ ID NO.1:

[0053] CACGATAAGTTATGGGAGAAAA ACGTCAAAGTTTTGTTGGGTGTTATTAAGTGCC AATAGGAAACTTCAAAGTCTTGAGTTATATTTGAATTAAAGGGAATGGAAAGAAATTCT TGTAGGGTC[CATGGAAATCCTCATATGGA]ATGGAAATCCTCATATGGAATGGAAATTT CCGCAATAGAA TTGTCGGTTCGAA ATAATCAT;

[0054] SEQ ID NO.2:

[0055] CACGATAAGTTATGGGAGAAAA ACGTCAAAGTTTTGTTGGGTGTTATTAAGTGCC AATAGGAAACTTCAAAGTCTTGAGTTATATTTGAATTAAAGGGAATGGAAAGAAATTCT TGTAGGGTC[C]ATGGAAATCCTCATATGGAATGGAAATTTCCGCAATAGAA TTGTCGGT TCGAAATAATCAT.

[0056] Example 2. Acquisition of primer pairs for identifying petal size traits of thin-skinned melon

[0057] According to the results of parental resequencing data development, the Chr08_9521560 molecular marker tightly linked to the petal size trait of thin-skinned melon was designed, and a primer pair for amplifying the molecular marker was designed. Specifically, within the positioning interval of Example 1, primers were designed based on the InDel differences in the sequencing data of the two parents, and an upstream primer with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.4 were obtained.

[0058] The upstream primer sequence was Chr08_9521560-F (SEQ ID NO. 3): 5′-CACGATAAGTTATGGGAGAAAA-3′;

[0059] The downstream primer sequence is Chr08_9521560-R (SEQ ID NO. 4): 5'-ATGATTATTTCGAACCGACAA-3'.

[0060] Example 3. A method for identifying the petal size of thin-skinned melon

[0061] A method for identifying the size of petals of thin-skinned melons, comprising the following steps:

[0062] (1) Extracting genomic DNA from leaves or other tissues of the tested thin-skinned melon samples.

[0063] The identification method of the present invention can use thin-skinned melon seedlings at different stages as materials. In order not to affect the optimal period of subsequent growth, this embodiment uses leaves of melon seedlings (two leaves and one heart stage) as materials to extract DNA.

[0064] (2) Using the Chr08_9521560 primer pair obtained in Example 2, PCR amplification was performed on the genomic DNA of different samples to obtain amplified products, and the amplified products were detected by polyacrylamide gel electrophoresis. If the amplified product contained a 204 bp fragment, it was determined to be a large petal type; if the amplified product contained a 185 bp fragment, it was determined to be a small petal type.

[0065] The petal length of the large petal trait ranges from 16.6mm to 20.7mm, and the petal width ranges from 11.7mm to 14.9mm. The petal length of the small petal trait ranges from 8.6mm to 12.8mm, and the petal width ranges from 7.2mm to 9.7mm.

[0066] The PCR reaction system is as follows: 1 μL of upstream and downstream primers (primer concentration is 2 pM), 2 μL of DNA template (concentration is 30 ng / μL), 1 μL of 10× PCR Buffer (containing Mg 2+ 15mM), dNTP 0.15μL (concentration is 10mM), Taq enzyme 0.1μL (5U / μL), sterile deionized water 6.75μL.

[0067] The PCR reaction program was as follows: 94°C pre-denaturation for 7 min, 94°C denaturation for 30 s, 53°C annealing for 30 s, 72°C extension for 30 s, 30 cycles, 72°C extension for 10 min, and storage at 4°C.

[0068] PCR product detection method: Take 2μL of PCR product, add 2μL Loading Buffer, mix well and spot into polyacrylamide gel, perform electrophoresis at 220V / 400mA for 50-60min.

[0069] The identification method of the present invention can be used to determine the petal size characteristics of thin-skinned melons during the seedling stage, and the sampling time is approximately the two-leaf and one-heart period; while conventional breeding requires measurement during the flowering period, the identification method of the present invention can effectively shorten the breeding time and speed up the breeding speed.

[0070] Example 4. Screening the petal size of a natural melon population using the primer pairs obtained in Example 2

[0071] In order to determine the accuracy of the molecular markers obtained in Example 1, the primer pairs obtained in Example 2, and the identification method obtained in Example 3 in identifying the petal size of thin-skinned melons, samples from a natural population of thin-skinned melons were selected, and the petal size of each sample was identified according to the identification method described in Example 3. During the flowering period of the melons, the field phenotypic data of the petal size, including the petal length and petal width, were measured.

[0072] In this example, genomic DNA of each individual plant in the male parent, female parent, F1 generation and natural population in Example 1 was extracted respectively, and the genomic DNA of the above samples was amplified by PCR using the primer pairs obtained in Example 2 to obtain PCR products. The PCR products were detected by polyacrylamide gel electrophoresis. The results are shown in FIG. Figure 2 .

[0073] Natural group materials Figure 2 Lane 24 to Lane 42, these natural population materials are disclosed in the following articles:

[0074] Liu Shi,Gao Peng,Zhu Qianglong,Zhu Zicheng,Liu Hongyu,Wang Xuezheng,Weng Yiqun,Gao Meiling and Luan Feishi*.Resequencing of 297melon accessions reveals the genomic history of improvement and loci related to fruit traits in melon.2020,18,2545-2558,Plant Biotechnology Journal.

[0075] like Figure 2As shown, the leftmost lane of the picture is a molecular weight marker (fragment sizes are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom), lanes 33-42 are the amplification product detection results of large petal thin-skinned melon materials (thin-skinned cultivated melons) in natural populations, lanes 24-32 are the amplification product detection results of small petal melon materials (thin-skinned wild melons) in natural populations, P1 is the amplification product detection result of the female parent in Example 1, P2 is the amplification product detection result of the male parent in Example 1, and F1 is the amplification product detection result of the F1 generation obtained by hybridization of P1 and P2. The PCR product detection result of the female parent (P1) shows a fragment of 185bp, and the enzyme digestion result of the male parent (P2) shows a fragment of 204bp, judging that the female parent has small petals and the male parent has large petals, which is consistent with the petal size measurement results of the male parent and the female parent in Example 1. The PCR product detection results of the natural population of lanes 24-32 showed a fragment of 185bp, and the PCR product detection results of the natural population of lanes 33-42 showed a fragment of 204bp, judging that the natural population of lanes 24-32 had a small petal trait, and the natural population of lanes 33-42 had a large petal trait. According to the actual measurement of the petal size of the natural population, it was found that the petal length of the natural population of lanes 24-32 varied in the range of 8.6-12.8mm, the petal width varied in the range of 7.2-9.7mm, and the petal length of the natural population of lanes 33-42 varied in the range of 16.6-20.7mm, and the petal width varied in the range of 11.7-14.9mm. Therefore, the petal size trait of the thin-skinned melon determined by the PCR product electrophoresis results (marker gene typing results) was highly consistent with the actual petal size of each melon variety, the genotype and phenotype were completely consistent, and the molecular marker identification results were 100% consistent with the actual petal size trait. This further illustrates that the molecular markers provided in Example 1, the primer pairs provided in Example 2, and the method for identifying the petal size trait of muskmelon provided in Example 3 are feasible and accurate, and can be applied to the molecular marker identification of the petal size of muskmelon in the seedling stage.

[0076] Example 5. A kit for identifying the petal size of thin-skinned melon

[0077] A kit for identifying the petal size trait of thin-skinned melon includes the following reagents:

[0078] Chr08_9521560-F and Chr08_9521560-R described in Example 2 (both at 2 pM), 10×PCRBuffer (containing Mg 2+ 15 mM), dNTP (concentration of 10 mM), Taq enzyme (5 U / μL), sterile deionized water.

[0079] Example 6. Method for using a kit for identifying the petal size trait of thin-skinned melon

[0080] (1) Extract genomic DNA from the tested thin-skinned melon and adjust the genomic DNA concentration to 30 ng / μL.

[0081] (2) Add samples and reagents according to the following PCR system:

[0082]

[0083] (3) PCR amplification was performed. The reaction procedure of PCR amplification was as follows: 94°C pre-denaturation for 7 min, 94°C denaturation for 30 s, 53°C annealing for 30 s, 72°C extension for 30 s, 30 cycles, 72°C extension for 10 min, and storage at 4°C.

[0084] (4) The PCR products were detected by polyacrylamide gel electrophoresis, and the petal size of the thin-skinned melon was determined by the detection results. Specifically, if the amplified product contained a 204 bp fragment, it was determined to be a large petal trait; if the amplified product contained a 185 bp fragment, it was determined to be a small petal trait. The results showed that the petal length of the large petal trait was 16.6 mm-20.7 mm, and the petal width was 11.7 mm-14.9 mm, and the petal length of the small petal trait was 8.6 mm-12.8 mm, and the petal width was 7.2 mm-9.7 mm.

[0085] Although the present invention has been disclosed as above in the form of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A molecular marker for identifying the petal size trait of thin-skinned melon, characterized in that: The molecular marker is shown as SEQ ID NO.1 or SEQ ID NO.

2.

2. A primer pair for amplifying and identifying molecular markers for petal size traits of thin-skinned melon, characterized in that: The sequences of the primer pair are shown in SEQ ID NO.3 and SEQ ID NO.

4.

3. A kit for identifying the size of petals of muskmelon, characterized in that: The kit comprises the primer pair according to claim 2.

4. Use of the molecular marker according to claim 1, the primer pair according to claim 2 or the kit according to claim 3 in identifying the petal size trait of thin-skinned melon.

5. Use of the molecular marker according to claim 1, the primer pair according to claim 2 or the kit according to claim 3 in auxiliary identification, auxiliary breeding and screening of the petal size trait of thin-skinned melon.

6. The use according to claim 4 or 5, characterized in that: The petal length of the large petal trait ranges from 16.6mm to 20.7mm, and the petal width ranges from 11.7mm to 14.9mm. The petal length of the small petal trait ranges from 8.6mm to 12.8mm, and the petal width ranges from 7.2mm to 9.7mm.

7. A method for identifying the size of petals of muskmelon, characterized in that: The method described is as follows: Step 1: Extracting the genomic DNA of the thin-skinned melon to be tested; Step 2: Using the DNA obtained in step 1 as a template, perform PCR amplification using the primer pair described in claim 2 to obtain a PCR product to determine the size characteristics of the petals of the thin-skinned melon.

8. The method according to claim 7, characterized in that The PCR reaction system in step 1 is: 1 μL of upstream and downstream primers, primer concentration is 2 pM, DNA template 2 μL, DNA template concentration is 30 ng / μL, 1 μL of 10×PCR Buffer, 0.15 μL of dNTP, dNTP concentration is 10 mM, 0.1 μL of Taq enzyme, Taq enzyme concentration is 5 U / μL, and 6.75 μL of sterile deionized water; the PCR reaction program is: 94°C pre-denaturation for 7 min, 94°C denaturation for 30 s, 53°C annealing for 30 s, 72°C extension for 30 s, 30 cycles, 72°C extension for 10 min, and storage at 4°C.

9. The method according to claim 7, characterized in that: In step 2, if the amplified product contains a 204 bp fragment, it is determined to be a large petal type; if the amplified product contains a 185 bp fragment, it is determined to be a small petal type.

10. The method according to claim 9, characterized in that The petal length of the large petal trait ranges from 16.6mm to 20.7mm, and the petal width ranges from 11.7mm to 14.9mm. The petal length of the small petal trait ranges from 8.6mm to 12.8mm, and the petal width ranges from 7.2mm to 9.7mm.

Images