Method for constructing transplanted tumor model based on macrophage co-culture

Abstract

The invention provides a method for constructing a transplanted tumor model based on macrophage co-culture, and belongs to the technical field of biology. The method aims at solving the problems of low construction success rate, slow growth speed and drug resistance of a traditional transplanted tumor model, and by introducing the macrophage co-culture step, the construction efficiency and the tumor growth speed of the transplanted tumor model are remarkably improved, and tumor drug screening and curative effect prediction are facilitated.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a method for constructing a transplanted tumor model based on macrophage co-culture. Background Art

[0002] Melanoma is one of the common malignant tumors. Although a variety of targeted drugs and immunotherapy drugs have achieved certain efficacy in the clinical treatment of melanoma in the past decade, the complex treatment, easy recurrence, and serious drug resistance problems seriously affect the survival of patients. Regarding melanoma drug resistance, current studies have found that macrophages in tumors are also one of the main causes of tumor development and resistance to immune or targeted therapy. Therefore, studying the interaction between melanoma and macrophages in the tumor microenvironment is of great significance for solving the problems of tumor progression and drug resistance.

[0003] Mouse tumor models are one of the important means to study tumor occurrence, development and tumor drug targeting and other treatment methods. However, the construction of human tumor cell lines in animals has always been related to the degree of immunodeficiency of mice. The more severe the immunodeficiency of mice, the easier it is for tumor cells to form tumors in mice. Therefore, for some human tumor cells, the degree of immunodeficiency of nude mice and the cleanliness of the breeding environment are required to be high. Currently, common nude mice include Balb / c Nude, CD-1Nude and NUNU. The tumor formation effect and time of the same type of tumor in nude mice are still slower than the growth rate of mouse homologous transplanted tumors. For some nude mice, such as Balb / c Nude, the tumor growth is usually slow after tumor bearing, up to 10 days or even longer, and the age of the mice also increases. The immunity of the mice may leak, affecting the growth of tumors and subsequent experiments. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a method for constructing a transplanted tumor model based on macrophage co-culture, which can increase the growth rate of the prepared transplanted tumor model.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The method for constructing a transplanted tumor model based on macrophage co-culture is as follows:

[0007] S1: Macrophage induction, THP-1 cells were seeded in culture flasks and cultured in 1640 complete medium for 24-48 h. After PMA induction, they were washed with PBS and cultured in DMEM complete medium to form adherent macrophages.

[0008] S2: Tumor cell culture, tumor cells were cultured with DMEM complete medium;

[0009] S3: co-culture, after the tumor cells are digested with the cell digestion solution, they are co-cultured with the macrophages in step S1;

[0010] S4: Construction of transplanted tumor model: the mixed cells co-cultured with macrophages and tumor cells in step S3 were digested and separated with cell digestion solution, and then inoculated subcutaneously into nude mice.

[0011] Furthermore, the macrophages are M0 macrophages.

[0012] Furthermore, the PMA induction culture was carried out for 48 hours, and the PMA concentration was 100 ng / mL.

[0013] Furthermore, the cell digestion solution is 0.25% trypsin-EDTA, and the tumor cells and macrophages are co-cultured for 1-3 times, each co-culture for 24 hours.

[0014] Furthermore, the number of cells inoculated subcutaneously in nude mice was 2×10 6 indivual.

[0015] Furthermore, the tumor cells are melanoma tumor cells A375.

[0016] Furthermore, the transplanted tumor model constructed by the method is a drug-resistant transplanted tumor model.

[0017] The beneficial effects of the present invention are:

[0018] A method for rapidly preparing a transplanted tumor model was constructed, which helps to increase the success rate of constructing tumor transplanted tumor model animals and facilitates the screening of tumor drugs.

[0019] Other advantages, objectives and features of the present invention will be described in the following description to some extent, and to some extent, will be obvious to those skilled in the art based on the following examination and study, or can be taught from the practice of the present invention. The objectives and other advantages of the present invention can be realized and obtained through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention will be described in detail below in conjunction with the accompanying drawings, wherein:

[0021] Figure 1 The expression level of CD68 after THP-1 was induced into M0 macrophages was detected by RT-PCR;

[0022] Figure 2The sensitivity of A375 and A375 co-cultured with M0 macrophages to PLX4032. The dotted line represents the survival rate of 50%, and the corresponding drug concentration is IC50. The IC50 of A375 and A375 co-cultured with M0 macrophages once (A375+M0 1) is about 0.1μM. The IC50 of A375 co-cultured with M0 macrophages for 2 times (A375+M0 2) and 3 times (A375+M0 3) is close to 10μM, which is about 100 times the original IC50.

[0023] Figure 3 Schematic diagram of tumor size (a) and volume statistics (b) 9 days after tumor cell inoculation in nude mice. A375+M0 3 is A375 co-cultured with M0 macrophages for 3 times. The growth rate of A375 co-cultured with M0 macrophages for 3 times in nude mice was significantly faster than that of primary A375, ****, P<0.0001;

[0024] Figure 4 This is the tumor growth curve of A375+M0 3 (A375 after co-culture with M0 macrophages for 3 times). Day 0 is the day of drug administration, and the data are recorded until day 8. Vehicle is the drug solvent (control group). PLX4032 is 10 mg / kg (drug treatment group). ns, not significant;

[0025] Figure 5 The size of A375+M0 3 tumor on day 8. Vehicle is the drug solvent (control group). PLX4032 is 10 mg / kg (drug treatment group);

[0026] Figure 6 A375 tumor growth curve. Day 0 is the day of drug administration, and data are recorded until day 14. Vehicle is the drug solvent (control group). PLX4032 is 10 mg / kg (drug treatment group). *, P < 0.05;

[0027] Figure 7 The size of A375 tumor on day 14. Vehicle is the drug solvent (control group). PLX4032 is 10 mg / kg (drug treatment group). DETAILED DESCRIPTION

[0028] The following describes the embodiments of the present invention by specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the illustrations provided in the following embodiments only illustrate the basic concept of the present invention in a schematic manner, and the following embodiments and features in the embodiments can be combined with each other without conflict.

[0029] Among them, the drawings are only used for illustrative explanations, and they only represent schematic diagrams rather than actual pictures, and should not be understood as limitations on the present invention. In order to better illustrate the embodiments of the present invention, some parts of the drawings may be omitted, enlarged or reduced, and do not represent the size of actual products. For those skilled in the art, it is understandable that some well-known structures and their descriptions in the drawings may be omitted.

[0030] The same or similar numbers in the drawings of the embodiments of the present invention correspond to the same or similar parts; in the description of the present invention, it should be understood that if the terms "upper", "lower", "left", "right", "front", "rear", etc. indicate the orientation or position relationship, they are based on the orientation or position relationship shown in the drawings, which is only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operate in a specific orientation. Therefore, the terms describing the position relationship in the drawings are only used for illustrative purposes and cannot be understood as limiting the present invention. For ordinary technicians in this field, the specific meanings of the above terms can be understood according to specific circumstances.

[0031] Example 1 Macrophage Induction Culture

[0032] 1. Human monocytic leukemia THP-1 cells (Cat. No. CL-0233, purchased from Pronocell) were cultured in 1640 complete medium (1640 basal medium, containing 10% Gibco serum, 1% streptomycin / penicillin double antibody and 0.05 mM β-mercaptoethanol) (37°C, 5% CO 2 )24-48h, when the cells reach a certain density, about 1-2×10 6 cells / mL, 5×10 cells were seeded into each T75 flask. 6 After induction with PMA (Invivogen, 100 ng / mL) for 48 h, the cells were washed twice with PBS and replaced with DMEM complete medium (DMEM basal medium containing 10% Gibco serum and 1% streptomycin / penicillin double antibody) for continued culture (culture conditions were the same as before, 37°C, 5% CO 2 ), at this time, the cells have changed from suspension cells to adherent cells and are M0 type macrophages.

[0033] 2. RT-PCR detection of changes in CD68 expression levels in induced M0 macrophages: THP-1 cells were plated at 1×10 6 The cells were inoculated in 6-well plates and induced with 100 ng / mL PMA for 48 h. The cells were washed twice with PBS and replaced with DMEM complete medium for 24 h. The medium was removed and 1 mL RNAiso Plus (Takara) was added to each well of the 6-well plates to collect the cells. The cells were transferred to 1.5 mL centrifuge tubes and 1×10 6 THP-1 was lysed in the same way and RNA was extracted as follows:

[0034] (1) Place the TRIzol-lysed cell sample at room temperature for 5 minutes;

[0035] (2) Add 200 μL of chloroform to each tube of sample, vortex thoroughly for 30-60 seconds to make the sample milky white, and place it at room temperature for 5 minutes;

[0036] (3) Centrifuge at 12,000 × g, 4°C for 15 min, and transfer the supernatant to another new centrifuge tube;

[0037] (4) Add an equal volume of isopropanol to the supernatant, mix thoroughly by inverting the tube, and let stand at room temperature for 10 min;

[0038] (5) Centrifuge at 12000×g, 4℃ for 10 min and discard the supernatant

[0039] (6) Add 1 mL of 75% ethanol, gently invert several times to resuspend the RNA precipitate, centrifuge at 7500 × g, 4°C for 5 min, and carefully discard the supernatant;

[0040] (7) RNA dissolution: Open the centrifuge tube cap and dry the precipitate at room temperature for 10-15 min. After the precipitate is dry, add an appropriate amount of TE buffer (30-50 ul) to dissolve the RNA precipitate for 10 min.

[0041] After RNA extraction, reverse transcription was performed immediately. The kit used was PrimeScript TM RT reagent Kit (Takara, catalog number #RR037A), and RT-PCR was performed using the TB Premix Ex Taq TMII (Takara, catalog #RR820A), the primer sequences used were: CD68 upstream primer "TCCAAGCCCAGATTCAGATTCG", CD68 downstream primer "CCTTGGTTTTGTTGGGGTTCAG", β-actin upstream primer "CACTCTTCCAGCCTTCCTTC", β-actin downstream primer "GTACAGGTCTTTGCGGATGT".

[0042] The results are as follows Figure 1 As shown, the expression level of CD68 after THP-1 was induced into M0 macrophages by RT-PCR, ***, P<0.005;

[0043] Example 2 Co-culture of M0 macrophages and A375 and drug sensitivity test

[0044] 1. Melanoma tumor cells A375 were purchased from Pronocell (Cat. No. CL-0014) and cultured with DMEM complete medium (containing 10% Gibco serum and 1% streptomycin / penicillin double antibody) to prepare A375 in the logarithmic growth phase. The cells were inoculated into square bottles containing M0 macrophages (24 hours after cytokine removal), with about 2×10 cells in each bottle. 6 cells, the culture medium was DMEM complete medium, macrophages were co-cultured with A375 in a 37°C incubator for 24 h, and the tumor cells at this time underwent the first co-culture;

[0045] 2. Digest the A375 cells co-cultured with macrophages for the first time with 0.25% trypsin-EDTA cell digestion solution, count them with abalone counting plate, and calculate 2×10 cells per T75 square bottle. 6 Tumor cells A375 were inoculated into a new T75 flask containing M0 macrophages (24 h after cytokine removal) and co-cultured for a second time for 24 h. At this time, the tumor cells underwent a second co-culture, and steps 1-2 were repeated until the third co-culture;

[0046] 3. After each co-culture, a portion of A375 cells was taken for drug sensitivity test: A375 is a tumor cell with BRAF mutation. A375 cells that have not been co-cultured with macrophages are sensitive to BRAF inhibitor (PLX4032, Selleck#S1267). The concentration gradient of PLX4032 was set to 0, 0.01, 0.1, 1, and 10 μM. After 72 hours of drug treatment, CCK8 was used to detect cell viability to evaluate the changes in the sensitivity of A375 to drugs after co-culture with macrophages; Figure 2As shown, the dotted line represents a survival rate of 50%, and the corresponding drug concentration is IC50. The IC50 of A375 and A375 co-cultured with M0 macrophages once (A375+M0 1) is about 0.1 μM. The IC50 of A375 co-cultured with M0 macrophages twice (A375+M0 2) and three times (A375+M0 3) is close to 10 μM, which is about 100 times the original IC50.

[0047] Example 3 Preparation of transplanted tumor model and drug sensitivity test

[0048] 1. 4-week-old Balb / c Nude male mice were purchased from Beijing Weitonglihua and adapted to the SPF animal room for 1 week. A375 after the third co-culture was digested, washed with PBS, and resuspended in 1640 basal medium. The cell density was adjusted to 1×10 7 cells / mL, inoculated cells on the right side of the back of nude mice, 200 μL each time, equivalent to inoculating 2×10 cells / mL 6 The tumor growth was observed after one week. Figure 3 As shown, A375+M0 3 is A375 after co-culture with M0 macrophages for 3 times. The growth rate of A375 tumors after co-culture with M0 macrophages for 3 times in nude mice was significantly faster than that of primary A375. ****, P<0.0001.

[0049] 2. When the tumor volume reaches 100-200mm 3 At 14:00, PLX4032 was intraperitoneally administered. The preparation method of PLX4032 was: 5% DMSO + 40% PEG300 + 5% Tween 80 + 50% ddH2O. The control group was given a solvent (Vehicle) without drugs. The experimental group was given 10 mg / kg PLX4032, with a volume of 100 μL, and the administration was continued every day. The tumor size was measured every two days. The tumor volume was calculated as follows: tumor volume (mm 3 ) = length × width × width / 2.

[0050] 3. Result analysis: Figure 4 As shown in the figure, day 0 is the day when drug administration started, and data is recorded until day 8. Vehicle is the drug solvent (control group). PLX4032 is 10 mg / kg (drug treatment group). ns, no significant difference. Figure 5 :The size of A375+M03 tumor on day 8. Vehicle is the drug solvent (control group). PLX4032 is 10 mg / kg (drug treatment group).

[0051] As shown Figure 6:A375 tumor growth curve on day 14. Day 0 is the day of drug administration, and data are recorded until day 14. Vehicle is the drug solvent (control group). PLX4032 is 10 mg / kg (drug treatment group). *, P<0.05. Figure 7 :The size of A375 tumor on day 14. Vehicle is the drug solvent (control group). PLX4032 is 10 mg / kg (drug treatment group).

[0052] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution, which should be included in the scope of the claims of the present invention.

Claims

1. A method for constructing a transplanted tumor model based on macrophage co-culture, characterized in that: The steps are as follows: S1: Macrophage induction, THP-1 cells were seeded in culture flasks and cultured in 1640 complete medium for 24-48 h. After PMA induction, they were washed with PBS and cultured in DMEM complete medium to form adherent macrophages. S2: Tumor cell culture, tumor cells were cultured with DMEM complete medium; S3: co-culture, after the tumor cells are digested with the cell digestion solution, they are co-cultured with the macrophages in step S1; S4: Construction of transplanted tumor model: the mixed cells co-cultured with macrophages and tumor cells in step S3 were digested and separated with cell digestion solution, and then inoculated subcutaneously into nude mice.

2. The method for constructing a transplanted tumor model based on macrophage co-culture according to claim 1, characterized in that: The macrophages are M0 macrophages.

3. The method for constructing a transplanted tumor model based on macrophage co-culture according to claim 1, characterized in that: The PMA induction culture was performed for 48 hours, and the PMA concentration was 100 ng / mL.

4. The method for constructing a transplanted tumor model based on macrophage co-culture according to claim 1, characterized in that: The cell digestion solution is 0.25% trypsin-EDTA, and the tumor cells and macrophages are co-cultured for 1-3 times, each co-culture for 24 hours.

5. The method for constructing a transplanted tumor model based on macrophage co-culture according to claim 1, characterized in that: The number of cells inoculated subcutaneously in nude mice was 2×10 6 indivual.

6. The method for constructing a transplanted tumor model based on macrophage co-culture according to any one of claims 1 to 5, characterized in that: The tumor cells are melanoma tumor cells A375.

7. The method for constructing a transplanted tumor model based on macrophage co-culture according to claim 6, characterized in that: The transplanted tumor model constructed by the method is a drug-resistant transplanted tumor model.

Images