Serine recombinase and application thereof in plants

Abstract

The invention discloses a serine recombinase and application thereof in plants, the serine recombinase R4 is utilized to specifically recognize two att sites, site-specific recombination occurs, two vectors are recombined so as to restore the expression of EGFP, one vector comprises a complete R4 enzyme expression cassette, the downstream is a 35S-driven attB site and an N-terminal EGFP sequence, and the other vector comprises a complete R4 enzyme expression cassette and a 35S-driven attB site and an N-terminal EGFP sequence. One carrier comprises an attP site and a C-terminal EGFP sequence, the other carrier comprises an attP site and a C-terminal EGFP sequence, the two carriers are co-transformed into protoplasts, and after overnight incubation, it is found that the recombination efficiency of the R4 enzyme in the cotton protoplast reaches 83.8%, and the recombination efficiency of the R4 enzyme in the rice protoplast reaches 94.7%. The efficient serine recombinase R4 disclosed by the invention can broaden the application (fragment replacement, gene stacking and the like) of the serine recombinase in plants, and is expected to become an important tool enzyme for large fragment DNA integration in the plants.

Description

Technical Field

[0001] The present application belongs to the field of bioengineering technology, and specifically relates to a serine recombinase and its application in plants. Background Art

[0002] Site-specific recombinases are widely present in prokaryotes and lower eukaryotes, but not in higher multicellular eukaryotes such as plants. Site-specific recombinases are divided into serine recombinases and tyrosine recombinases, both of which can recognize two specific sequences and catalyze the recombination between two DNA fragments.

[0003] Serine recombinase has two specific recombinase recognition sites. The recombinase can bind to the two recombination sites to form a synaptic complex with juxtaposed crossover sites. The recombinase then catalyzes the cutting, strand exchange and reconnection of DNA within the synaptic complex. Serine recombinase R4 recognizes two recombinase recognition sites, attB and attP. The recombinase binds to the two recognition sites to form a tetramer. Recombination occurs around the central twelve nucleotides of the recognition site, producing attL and attR sites, thereby achieving excision, inversion or integration. And this reaction is irreversible, unless the associated recombinase directionality factor (RDF) participates, the reaction of attL and attR sites to attB and attP sites can be achieved. In the absence of an associated RDF, the recombination reaction of serine recombinase is irreversible and unidirectional.

[0004] In recent years, the directional and irreversible nature of serine recombinases has made them play an increasingly important role in the insertion of foreign genes, especially in the integration of large DNA fragments. The att site is very small (<50 bp) and can be introduced into the desired position in the genome. Under the action of serine recombinase, it can undergo site-specific recombination with another att site, thereby achieving the insertion of foreign DNA fragments. Currently, the efficient recombinases that have been reported for large DNA fragment integration in plants include Bxb1 enzyme and ΦC31 enzyme, but there are few types of them, which limits the application of serine recombinases in plants, such as gene stacking and gene replacement.

[0005] Therefore, it is very necessary to broaden the application of serine recombinases in plants. Summary of the invention

[0006] In response to the problems existing in the prior art, the present invention provides a highly efficient serine recombinase R4 enzyme, which has been found to have a high recombination efficiency in both monocotyledonous and dicotyledonous plants, can broaden the application of serine recombinase in plants (gene stacking, etc.), and is expected to become an important tool enzyme for large-fragment DNA integration in plants.

[0007] The specific scheme of the present invention is as follows: A serine recombinase R4 enzyme, the coding sequence of the R4 enzyme is shown in Sequence 1.

[0008] Preferably, the R4 enzyme coding sequence is a sequence optimized according to the codon preference of cotton species.

[0009] A serine recombinase R4 enzyme system comprises a gene sequence of the R4 enzyme, a vector a constructed with attB sites, and a vector b constructed with attP sites.

[0010] Preferably, the R4 enzyme system also includes the EGFP gene.

[0011] Preferably, the R4 enzyme system includes a vector containing R4 recombinase, attB site and N-terminal EGFP (pUC-N-R4) and a vector containing attP site and C-terminal EGFP (pUC-C-R4).

[0012] Preferably, the N-terminal EGFP gene in the pUC-N-R4 vector is connected to the attB site via the N-terminal intron, and the C-terminal EGFP gene in the pUC-C-R4 vector is connected to the attP site via the C-terminal intron.

[0013] The pUC-N-R4 vector uses pUC-EGFP as the vector backbone and can be used to detect the efficiency of different recombinases.

[0014] A method for constructing a serine recombinase R4 enzyme system comprises the following steps: pUC-N-R4 vector and pUC-C-R4 vector were constructed, the gene sequence of R4 recombinase and attB site were constructed on one vector, and the attP site was constructed on another vector; pUC-EGFP was used as the vector backbone, and the EGFP gene and intron were split into N-terminus and C-terminus, wherein the N-terminus was connected to the attB site through the N-terminal intron, and the C-terminus was connected to the attP site through the C-terminal intron; The above two vectors were co-transformed into cotton and rice protoplasts; The number of cells with fluorescence recovery was counted to indicate the recombination efficiency of the R4 enzyme.

[0015] The reporter system in the method for constructing the serine recombinase R4 enzyme system utilizes the serine recombinase R4 to specifically recognize the attB site and the attP site, and site-specific recombination occurs to form the attL site and the attR site.

[0016] The invention also discloses the application of the R4 enzyme, the R4 enzyme system and the construction method thereof in preparing transgenic plants.

[0017] Preferably, the plant is cotton or rice.

[0018] The advantages and positive effects of the present invention are as follows: the R4 recombinase optimized according to the codon preference of cotton species has a higher recombination efficiency in plants. The present invention provides a new type of efficient recombinase suitable for plants, especially cotton and rice, and provides a new molecular tool for genetic manipulation such as large fragment replacement and gene stacking in plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show the embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without creative work.

[0020] Figure 1 This is a schematic diagram of the pUC-N-R4 vector in a preferred embodiment of the present invention; Figure 2 Schematic diagram of pUC-C-R4 vector in a preferred embodiment of the present invention Figure 3 Schematic diagram of the recombination of pUC-N-R4 vector and pUC-C-R4 vector; Figure 4 Schematic diagram of fluorescence after transformation of cotton protoplasts; Figure 5 The fluorescence schematic diagram after transformation of rice protoplasts; Figure 6 This is a diagram of the recombination efficiency of serine recombinase R4 in cotton protoplasts; Figure 7 This is a diagram of the recombination efficiency of serine recombinase R4 in rice. DETAILED DESCRIPTION

[0021] The specific implementation of the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments.

[0022] Before introducing the specific embodiments, some experimental backgrounds in the following embodiments are briefly described as follows.

[0023] Biomaterials: The vector was constructed based on the pUC-EGFP vector backbone; Escherichia coli strain DH5αChemically Competent Cell was purchased from Shanghai Weidi Biotechnology Co., Ltd.; The relevant sequence synthesis and sequencing work were provided and completed by GenScript Biotech Co., Ltd. and Sangon Biotech (Shanghai) Co., Ltd.; Main reagents: PCR products and vectors were recovered using an agarose gel DNA recovery kit (enhanced) and an ultrathin DNA product purification kit, purchased from Beijing Tiangen Biotechnology Co., Ltd.; Kits for DNA extraction: Polysaccharide and polyphenol plant genomic DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; The recombination reaction kit, ClonExpress ® II One Step Cloning Kit, was purchased from Nanjing Novozyme Co., Ltd.; Related restriction endonucleases are all products of New England Biolabs (NEB); Plasmid extraction was performed using an endotoxin-free plasmid extraction kit purchased from Beijing Tiangen Biotechnology Co., Ltd.

[0024] Example 1 Construction of related vectors for expressing R4 enzyme in cotton

[0025] In this example, the gene sequence of the R4 enzyme was first optimized according to the codon preference of cotton species and synthesized by GenScript Biotech Co., Ltd. The specific sequence is shown in Sequence 1.

[0026] Sequence 1:

[0027] The specific implementation process is briefly described as follows: 1. Construction of pUC-N-R4 and pUC-C-R4 vectors The attB site (sequence 2) is 57 bp long. The sequence is: gcgcccaagttgcccatgaccatgccgaagcagtggtagaagggcaccggcagacac.

[0028] The target fragment was amplified using complementary PCR primer pairs.

[0029] The following primer pairs were used for the attB site: attB F: atttcggacggcagggtaccgcgcccaagttgcccatgaccatgccgaagcagtggtag; attB R: aaacgacggccagtgaattcgtgtctgccggtgcccttctaccactgcttcggcatgg.

[0030] The PCR reaction system is as follows:

[0031] PCR amplification procedure:

[0032] The amplified PCR product was recovered using an agarose gel DNA recovery kit.

[0033] The N-terminal EGFP fragment was amplified using the pUC-EGFP vector as a template using the following primer pairs: EGFP-N F:tttacgaacgatagactagtgtacatggtgagcaagggcgag EGFP-N R:ggagaggagaagcagcgtacctgcttgtcggccatgatatagacg The PCR reaction system is as follows:

[0034] PCR amplification procedure:

[0035] The amplified PCR product was recovered using an agarose gel DNA recovery kit.

[0036] The N-terminal intron fragment was 52 bp long and was amplified by overlapping PCR primers complementary to the N-EGFP fragment using the following primer pair: EGFP-N F:tttacgaacgatagactagtgtacatggtgagcaagggcgag intron R:tgccgtccgaaatcgaatcgaaacgaagcgaggagaggagaagcagcgtacc The N-EGFP-intron sequence was amplified, with a full length of 526 bp, the sequence is as follows: atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaa gctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagt ccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgactt caaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcaggtacgctgcttctcctctcctcgcttcgtttcgattcgatttcggacggcag The PCR reaction system is as follows:

[0037] PCR amplification procedure:

[0038] The amplified PCR product was recovered using an agarose gel DNA recovery kit.

[0039] Use restriction endonucleases SpeI and EcoRI to linearize the vector pUC-EGFP. The restriction enzyme system is as follows:

[0040] The reaction system was placed in a 37°C incubator for overnight digestion.

[0041] Recover the linearized vector using the Ultrathin DNA Product Purification Kit; Using the ClonExpress ® II One Step Cloning Kit, according to the instructions of the kit, the PCR product attB site and EGFP-N were inserted into the linearized vector; the recombinant product was transformed into the Escherichia coli strain DH5α; after overnight growth on the plate, single clones were picked for colony PCR identification and positive transformants were screened; using the Sanger sequencing method, it was confirmed that the attB site and EGFP-N were correctly inserted into the plasmid and named pUC-N-EGFP. R4 recombinase was synthesized by GenScript Biotech Co., Ltd. after codon optimization in cotton and inserted into the pUC-N-EGFP vector to obtain the pUC-N-R4 vector, such as Figure 1 shown.

[0042] The relevant part of pUC-C-R4 vector was synthesized by GenScript Biotech Co., Ltd. into the pUC-EGFP vector by adding the attP site, C-terminal intron and C-terminal EGFP to obtain the pUC-C-R4 vector. Figure 2 shown. Among them, the full-length sequence of attP-C-EGFP has 326 bp, the sequence is as follows: ggtttgctgtttgatccgttgttgtgtccttaatcttgtgctagttcttaccctatctctgttggtgattatttcttgcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagc agaacaccccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa.

[0043] Sequence 3: tcatcacccgcagagtgtacccacaagcagtaccactgcttcaagtggtatcgctttggggaacatgcct.

[0044] Example 2 Protoplast transformation and result analysis

[0045] 1. Protoplast transformation The pUC-N-R4 and pUC-C-R4 plasmids were extracted using an endotoxin-free plasmid miniprep kit.

[0046] Add 10μg pUC-N-R4 and 10μg pUC-C-R4 to 100μL extracted and separated cotton protoplasts (about 10,000 cells), and add 10μg pUC-EGFP to 100μL extracted and separated cotton protoplasts (about 10,000 cells), flick to mix, and place in the dark for 10 minutes. Then add the protoplast transformation solution, flick to mix, and place in the dark for 30 minutes. Add W5 solution to terminate the reaction, centrifuge to discard the transformation solution, and resuspend the transformed protoplasts with W5 solution (the steps for preparing and transforming cotton protoplasts are specifically described in the patent "A method for preparing protoplasts and a method for transforming protoplasts and their applications", and the preparation and transformation methods of rice protoplasts refer to "Isolation and transformation of rice protoplasts").

[0047] (II) Observation of recombination results After the transformed protoplasts are incubated at room temperature overnight, an inverted microscope is used to observe whether the protoplasts show green fluorescence. If green fluorescence is present, it indicates that recombination has occurred. The principle is as follows Figure 3 As shown, the number of fluorescent cells was counted, and the ratio of the number of fluorescent cells to the number of cells under the bright field was the original recombination efficiency, which included the efficiency of plasmid transformation into protoplasts, and the efficiency of plasmid transformation into protoplasts was expressed by the ratio of fluorescent cells after pUC-EGFP transformation; the original recombination efficiency was corrected to obtain the final recombination efficiency, that is, the final recombination efficiency = original recombination efficiency / plasmid transformation into protoplasts efficiency. The results are shown in Figure 4 and Figure 5 As shown in the figure, green fluorescence can be detected in the protoplasts of cotton and rice, indicating that the R4 recombinase recognizes attB and attP sites in both cotton and rice, promoting DNA recombination. After calculating the final recombination efficiency, it was found that Figure 6-7 As shown, in cotton protoplasts, the transformation efficiency of protoplasts was 47.7%, the original recombination efficiency of R4 recombinase was 40%, and the final recombination efficiency after correction was 83.8%. In rice protoplasts, the transformation efficiency of protoplasts was 81%, the original recombination efficiency of R4 recombinase was 76.7%, and the final recombination efficiency after correction was 94.7%.

[0048] The results show that the optimized R4 recombinase has a higher recombination efficiency in plants. The present invention provides a new type of efficient recombinase suitable for plants, especially cotton and rice, and provides a new molecular tool for genetic manipulation such as large fragment replacement and gene stacking in plants.

[0049] The above embodiments are only preferred embodiments of the present invention, and are not intended to limit the present invention in other forms. Any person skilled in the art can use the above disclosed technical contents to change or modify them into equivalent embodiments with equivalent changes. However, any modification, equivalent change and modification made to the above embodiments according to the technical essence of the present invention without departing from the technical solution of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. A serine recombinase R4 enzyme, characterized in that The coding sequence of the R4 enzyme is shown in Sequence 1.

2. The serine recombinase R4 enzyme according to claim 1, characterized in that The R4 enzyme coding sequence is a sequence optimized according to the codon preference of cotton species.

3. A serine recombinase R4 enzyme system, characterized in that: The R4 enzyme system comprises the gene sequence of the R4 enzyme according to claim 1, a vector a constructed with attB sites, and a vector b constructed with attP sites, wherein the attB site sequence is shown in sequence 2, and the attP site sequence is shown in sequence 3.

4. The serine recombinase R4 enzyme system according to claim 3, characterized in that: The R4 enzyme system also includes the EGFP gene.

5. The serine recombinase R4 enzyme system according to claim 4, characterized in that: The R4 enzyme system includes R4 recombinase and attB site and N-terminal EGFP vector pUC-N-R4 and attP site and C-terminal EGFP vector pUC-C-R4.

6. The serine recombinase R4 enzyme system according to claim 5, characterized in that: The N-terminal EGFP gene in the pUC-N-R4 vector is connected to the attB site via the N-terminal intron, and the C-terminal EGFP gene in the pUC-C-R4 vector is connected to the attP site via the C-terminal intron.

7. A method for constructing a serine recombinase R4 enzyme system, comprising the following steps: (1) constructing a pUC-N-R4 vector and a pUC-C-R4 vector, constructing the gene sequence of the R4 enzyme described in claim 1 and the attB site into one vector, and constructing the attP site into another vector; designing a reporter system, using pUC-EGFP as the vector backbone, splitting the EGFP gene and intron into the N-terminus and the C-terminus, wherein the N-terminus is connected to the attB site through the N-terminal intron, and the C-terminus is connected to the attP site through the C-terminal intron; (2) Co-transform cotton and rice protoplasts with the pUC-N-R4 vector and the pUC-C-R4 vector; (3) Counting the number of cells with fluorescence recovery indicates the recombination efficiency of the R4 enzyme.

8. Use of the R4 enzyme according to any one of claims 1 to 2, or the serine recombinase R4 enzyme system according to any one of claims 3 to 6, or the method for constructing the serine recombinase R4 enzyme system according to claim 7 in preparing transgenic plants.

9. The use according to claim 8, characterized in that The plant is cotton or rice.

Images