A passion fruit PeGRX13 gene for improving drought resistance and its application

Abstract

The present invention provides a passion fruit PeGRX13 gene, and the nucleotide sequence thereof is shown in SEQ ID NO: 1. The present invention provides a passion fruit PeGRX13 gene cloned from passion fruit for the first time, and the transcription level of the PeGRX13 gene in passion fruit is upregulated under drought stress, indicating that the gene can improve the drought resistance of plants, etc. Studies have shown that the gene can also significantly improve the survival ability of yeast under drought stress, improve the antioxidant capacity of plants, make plant leaves slender, increase the length of plant petioles, etc. The present invention provides a new candidate gene for research on improving the stress resistance of yeast and plants, changing the morphology of plant leaves and petioles, etc.

Description

Technical Field

[0001] The invention belongs to the biological field, and particularly relates to a passion fruit PeGRX13 gene for improving drought resistance and an application thereof. Background Art

[0002] Passion fruit is a shallow-rooted plant with horizontal roots up to 4-5 m. During the planting process, there must be sufficient water supply throughout the entire growth period. In the early growth stage, a large amount of water is needed to meet the consumption of budding and shoot growth of the tree. More water is needed when flowering and fruit swelling occurs. Drought has an inhibitory effect on the growth of passion fruit plants. Generally, it grows well under conditions of annual rainfall of 1500-2000mm and uniform distribution. Once a drought occurs, it will seriously affect the normal growth and flowering of passion fruit plants, causing the fruit to wrinkle and the plant to die. Therefore, by exploring passion fruit genes with stress resistance functions and further verifying their regulatory functions in improving passion fruit's resistance to abiotic stresses such as drought, it provides a good foundation for studying the resistance mechanism of passion fruit and using it for genetic improvement. Summary of the invention

[0003] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a passion fruit PeGRX13 gene for improving drought resistance and an application thereof.

[0004] The first aspect of the present invention is to provide a passion fruit PeGRX13 gene, whose nucleotide sequence is shown in SEQ ID NO:1.

[0005] The second aspect of the present invention is to provide a protein encoded by the Passiflora PeGRX13 gene of the first aspect of the present invention.

[0006] The third aspect of the present invention is to provide a recombinant vector containing the passion fruit PeGRX13 gene coding region described in the first aspect of the present invention.

[0007] Wherein, the original vector of the recombinant vector can adopt the vector commonly used in the field of gene recombination, such as virus, plasmid, etc. The present invention is not limited to this. In a specific embodiment of the present invention, the original vector adopts pCAMBIA1304 expression vector and pYES 2 expression vector, but it should be understood that the present invention can also adopt other plasmids, or viruses, etc.

[0008] Preferably, the original vector of the recombinant vector is the pCAMBIA1304 expression vector, and the coding region of the passion fruit PeGRX13 gene is located between the NcoI and SpeI restriction endonuclease sites of the pCAMBIA1304 expression vector.

[0009] Preferably, the original vector of the recombinant vector is a pYES 2 expression vector, and the coding region of the passion fruit PeGRX13 gene is located between two restriction endonuclease sites, HinIII and BamHI, of the pYES 2 expression vector.

[0010] The fourth aspect of the present invention is to provide a host bacteria containing the passion fruit PeGRX13 gene coding region described in the first aspect.

[0011] The fifth aspect of the present invention is to provide an expression cassette containing the passion fruit PeGRX13 gene coding region described in the first aspect of the present invention.

[0012] The sixth aspect of the present invention is to provide the use of the passion fruit PeGRX13 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in improving the drought resistance of yeast.

[0013] The seventh aspect of the present invention is to provide the use of the passion fruit PeGRX13 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in responding to drought stress and / or improving plant drought resistance.

[0014] In a specific embodiment of the present invention, the plant is Arabidopsis thaliana.

[0015] The eighth aspect of the present invention is to provide the use of the passion fruit PeGRX13 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in improving the antioxidant capacity of plants, and / or reducing the malondialdehyde content in plant leaves, and / or increasing the proline content in plant leaves.

[0016] In a specific embodiment of the present invention, the plant is Arabidopsis thaliana.

[0017] The eighth aspect of the present invention is to provide the use of the passion fruit PeGRX13 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in making plant leaves slender and / or increasing the length of plant petioles.

[0018] In a specific embodiment of the present invention, the plant is Arabidopsis thaliana.

[0019] The ninth aspect of the present invention is to provide a primer pair, wherein the primer pair is F':ATGACGGGTGATTATCCGTTTA and R': TCAGACAAAGGACCAGTTGAT; or the primer pair is F':CCATCAACCCGGTCGTTAT and R': TGGTTGCCGCCGACGAA; or the primer pair is F':CCATGGATGGCAAATATCAAGGCCAA and R': ACTAGTCCATTTCATATTTCG; or the primer pair is F':AAGCTTATGGCAAATATCAAGGCCAA and R': GGATCCCCATTTCATATTTCG.

[0020] The present invention provides a passion fruit PeGRX13 gene cloned from passion fruit for the first time. The fluorescence quantitative detection results of passion fruit drought stress show that the transcription level of the PeGRX13 gene is upregulated, and it can respond to drought stress. It is transformed into yeast. Under drought stress treatment, the growth of the transgenic yeast is better than that of the wild type. PeGRX13 The promoter was constructed in an expression vector and transformed into Arabidopsis thaliana. Under drought treatment, PeGRX13 Induced expression under drought stress 。 Will PeGRX13 Arabidopsis thaliana was transformed and subjected to simulated drought treatment. The results showed that the Arabidopsis thaliana was stained with NBT (nitro blue tetrazolium). PeGRX13 It can improve the antioxidant capacity of transgenic Arabidopsis and the drought resistance of plants. PeGRX13 The transgenic Arabidopsis phenotype was identified, and the results showed that the leaves of the transgenic Arabidopsis were thinner and longer than those of the wild ones, and the petioles were longer. The present invention provides new candidate genes for studies on improving the stress resistance of yeast and plants, changing the morphology of plant leaves and petioles, etc., and lays a foundation for clarifying the abiotic stress and plant development regulation mechanism of passion fruit at the molecular level. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 for PeGRX13 Gene expression under drought abiotic stress.

[0022] Figure 2 for PeGRX13 Phenotypes of transgenic Arabidopsis. A: 4-week-old Arabidopsis; B: 4-week-old Arabidopsis leaves; C: Statistics of petiole length of 4-week-old Arabidopsis.

[0023] Figure 3 for PeGRX13 Results of transgenic Arabidopsis thaliana response to drought stress.

[0024] Figure 4 for PeGRX13 NBT staining of transgenic Arabidopsis.

[0025] Figure 5 These are the results of determination of malondialdehyde and proline contents in Arabidopsis thaliana with different treatments.

[0026] Figure 6 Under drought stress PeGRX13 Growth of transgenic yeast. DETAILED DESCRIPTION

[0027] The present invention will be further described below with reference to the accompanying drawings in conjunction with specific embodiments to better understand the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. Where the manufacturer of the reagents or instruments used is not indicated, they are all conventional products that can be obtained commercially.

[0028] Example 1: Cloning of the Passiflora PeGRX13 gene

[0029] Total RNA was extracted from the seedlings of Passiflora edulis, and the first chain of cDNA was obtained by reverse transcription. The first chain of cDNA was used as a template and the PCR primers shown in Table 2 were used to perform PCR amplification. The reaction system is shown in Table 1. The PCR amplification program was as follows: 95 °C pre-denaturation for 3 min, 95 °C for 40 s, 72 °C for 5 min, 35 cycles, and inactivation at 72 °C for 10 min. The annealing temperature, time and primers for each gene are shown in Table 2. The amplified product was recovered and sequenced to obtain the nucleotide sequence of the Passiflora PeGRX13 gene as shown in SEQ ID NO: 1.

[0030] Table 1 PeGRX13 PCR reaction system

[0031] Name of each component Usage cDNA 1µl Primer-F 1µl Primer-R 1µl 2×FastTaq Premix 12.5µl <![CDATA[H2O]]> 9.5µl Total volume 25µl

[0032] Table 2 PeGRX13 Full-length primers and PCR amplification procedure

[0033]

[0034] Example 2: Passionflower PeGRX13 Gene expression analysis under drought stress

[0035] The purple passion fruit ( Passiflora edulis ) of healthy passion fruit seedlings in an incubator (30 ℃, 200 μmol·m -2 ·s -1Light intensity, 12 h light / 12 h dark cycle, 70% relative humidity) grew to a height of about 1 m and had 8-10 functional leaves. The plants were subjected to drought treatment and samples were taken when the soil moisture was 50% and 10%. At least three leaves were extracted from each treated plant (three biological replicates), and the obtained passion fruit leaves were quickly frozen in liquid nitrogen. RNA was extracted for subsequent qRT-PCR detection.

[0036] Real-time fluorescence quantitative PCR (RT-PCR) primers for PeGRX13 gene were designed using an online website (https: / / www.genscript.com / tools / real-time-pcr-taqman-primer-design-tool). The primers are shown in Table 3. PeGRX13 The expression of PeGRX13 gene in Passiflora was detected by qRT-PCR with EF1α as the internal reference gene. Figure 1 As shown, the results show PeGRX13 The gene can be induced to express under drought stress, indicating that the gene is related to the drought resistance of passion fruit and can be used to improve the drought resistance of passion fruit.

[0037] Table 3 qPCR primer list

[0038] Gene-ID F-terminal primer R-terminal primer CCATCAACCCGGTCGTTATA TGGTTGCCGCCGACGAA

[0039] Embodiment 3: PeGRX13 The impact of genes on plants

[0040] 1. Transfer PeGRX13 Agrobacterium tumefaciens

[0041] Total RNA was extracted from the seedlings of Passiflora edulis and reverse transcribed to obtain the first strand of cDNA. The first strand of cDNA was used as a template and PCR amplification was performed with CCATGGATGGCAAATATCAAGGCCAA and ACTAGTCCATTTCATATTTCG. The reaction system and reaction procedure were as described in Example 1 to obtain a cDNA with NcoI and SpeI restriction sites. PeGRX13 The full-length sequence was obtained by inserting the pCAMBIA1304 empty vector and the PeGRX13 The full-length sequence was double-digested with NcoI and SpeI, and the two fragments were connected and transformed into competent E. coli. The competent cells were spread on LB solid medium, and a positive PCR test was performed after a single colony was grown to obtain pCAMBIA1304- PeGRX13 Expression vector.

[0042] Obtain pCAMBIA1304- PeGRX13 The plasmid of the expression vector is transferred into Agrobacterium GV3101 competent cells, and the Agrobacterium is spread on a solid YEP medium supplemented with kanamycin and rifampicin antibiotics. After the colonies grow, PCR identification is performed, and the PCR-positive colonies are shaken and preserved for subsequent plant infection.

[0043] 2. Transgenic Arabidopsis

[0044] Arabidopsis thaliana is planted in vermiculite as the substrate, the temperature is controlled at 21-23℃, the light duration is 8h per day during the vegetative growth period, the light duration is 16h per day during the reproductive growth period, the light intensity is 2000lx, and the relative humidity in the culture room is 70%-90%. When the seedlings grow true leaves, they can be transplanted and cultured until the seedlings grow new leaves, the flower mosses grow to 5-10cm, the side mosses are pulled out, and the Arabidopsis thaliana flowers are not fully opened for transformation.

[0045] Will turn PeGRX13 The gene-positive Agrobacterium solution was propagated using YEB medium and shaken to OD600≈1. The solution was centrifuged at 5000rpm for 10min, and the supernatant was discarded and resuspended in 50g / L sugar water to OD≈0.8. The Arabidopsis inflorescence was completely immersed in the bacterial solution resuspended in sugar water for 1min. The infected Arabidopsis inflorescence was wrapped with plastic wrap and placed in a 0-light incubator for 12h, then cultured under normal light. After the fruit pods grew, the Arabidopsis T0 generation seeds were harvested.

[0046] The infected Arabidopsis was cultured normally until seeds were obtained. The seeds were soaked in 75% alcohol + 2.5% Tween 100 for 1 min, repeated three times, washed once with sterile water, and sown in MS solid medium with hygromycin (25µg / ml) after thorough sterilization. After vernalization in a refrigerator at 4°C for three days, positive plants were cultured normally to obtain positive plants. The planting and sowing process was repeated three times until transgenic Arabidopsis with stable inheritance was obtained.

[0047] 3. Phenotype of transgenic Arabidopsis

[0048] At the same time, wild-type Arabidopsis and transgenic Arabidopsis seeds were sown in MS medium and then transplanted into the matrix. The growth of the 4-week-old plants was observed and photographed. Figure 2 As shown. PeGRX13 Compared with the wild type, the Arabidopsis thaliana phenotype has slender leaves and longer petioles. The average length of the wild type's petioles is 0.9 cm, while the average length of the transgenic plants' petioles is 2.1 cm. In addition, compared with the wild type, the transgenic plants grow more vigorously and show better growth performance. This lays the foundation for further research on the developmental function of this gene in plants.

[0049] 4. Detection of transgenic Arabidopsis response to drought stress

[0050] Transgenic Arabidopsis seeds were sown in MS medium (control) and MS medium supplemented with mannitol (200 mg / L) (drought), and the plants were subjected to GUS staining and GUS enzyme activity tests 10 days later. Figure 3 As shown in the figure, under normal growth conditions (control), the GUS staining of transgenic Arabidopsis was lighter and mainly concentrated in the stems, while under drought stress conditions (MS medium with mannitol added), GUS staining was enhanced and mainly concentrated in the leaves of seedlings. GUS enzyme activity test was performed and it was found that the GUS activity of transgenic Arabidopsis after drought treatment was 1.2 times higher than that of the control. The results showed that drought stress has an effect on PeGRX13 It has an inducing effect.

[0051] 5. Antioxidant capacity detection of transgenic Arabidopsis

[0052] The wild-type and transgenic Arabidopsis were sown in MS medium (control) and MS medium (drought) supplemented with mannitol (200 mg / L), respectively. NBT staining was performed after 20 days of growth. Nitroblue tetrazolium (NBT) can react with superoxide anions to form blue formazan. NBT solution can be used to detect superoxide anions in plant leaves. The plants were immersed in NBT solution for 30 minutes, the NBT dye solution was discarded, and the chlorophyll in the leaves was decolorized with anhydrous ethanol, and photographed and recorded with a stereo microscope. The results showed that when the wild-type and transgenic plants were not treated (control), the staining was basically the same, and the blue was lighter. After drought stress treatment, the staining of both the wild-type and transgenic plants deepened, and the staining of transgenic leaves was lighter than that of the wild-type, indicating that PeGRX13 Enhanced the antioxidant capacity of transgenic plants and improved their drought resistance ( Figure 4 ).

[0053] After drought stress treatment, the malondialdehyde and proline contents in the leaves of wild-type and transgenic Arabidopsis in MS medium (control) and MS medium (drought) supplemented with mannitol (200 mg / L) were measured, respectively. The acid ninhydrin colorimetric method was used to determine proline. For the determination of malondialdehyde, refer to the method in the plant physiology experimental guide. Fresh leaves were ground with liquid nitrogen, extracted with trichloroacetic acid, and thiobarbituric acid was added for reaction. The absorbance values ​​at 532nm, 600nm, and 450nm were measured. Under drought conditions, the malondialdehyde content of transgenic Arabidopsis was significantly reduced, while the proline content was significantly increased; this indicates that transgenic Arabidopsis has stronger drought resistance, which further indicates that PeGRX13 enhances the drought resistance of transgenic plants. Under normal cultivation conditions (control), the malondialdehyde content also decreased, while the proline content increased significantly, indicating that compared with the wild type, the transgenic plants showed superior growth performance ( Figure 5 ).

[0054] Embodiment 4: PeGRX13 Functional verification of genes under drought stress in yeast

[0055] Total RNA was extracted from the seedlings of Passiflora edulis and reverse transcribed to obtain the first strand of cDNA. The first strand of cDNA was used as a template and AAGCTTATGGCAAATATCAAGGCCAA and GGATCCCCATTTCATATTTCG were used as primers to perform PCR amplification. The reaction system and reaction procedure were as described in Example 1 to obtain a cDNA with HinIII and BamHI restriction sites. PeGRX13 The full-length sequence was obtained by inserting the pYES2 empty vector and the PeGRX13 The full-length sequence was double-digested with HinIII and BamHI, and the two fragments were connected and transformed into competent E. coli. The competent cells were spread on LB solid medium, and a positive PCR test was performed after a single colony was grown to obtain pYES2- PeGRX13 Plasmid.

[0056] (1) Take 100 µl of INVSc1 competent cells melted on ice and add the pre-cooled target plasmids (pYES2 empty vector, pYES2- PeGRX13) 2 µg, pre-treated Carrier DNA 10 µl (place the Carrier DNA in a 95℃ water bath for 3 min and then quickly put it in ice for 1 min, treat twice), PEG / LiAc 500 µl and mix by pipetting several times, and bathe at 30℃ for 30 min (invert 6-8 times at 15 min to mix).

[0057] (2) Place the tube in a 42°C water bath for 15 min (invert 6-8 times at 7.5 min to mix).

[0058] (3) Centrifuge at 5000 rpm for 40 s and discard the supernatant. Resuspend the sample in 400 µl of ddH2O and centrifuge for 30 s and discard the supernatant.

[0059] (4) Resuspend in 50 µl ddH2O and apply to SD-U medium for plasmid screening. Incubate at 29°C for 48-96 h.

[0060] (5) Select bacteria and verify the successful transformation of competent yeast by colony PCR.

[0061] (6) The successfully transformed yeast was subjected to drought stress treatment and treated with 8M sorbitol for 6 h, 12 h, 24 h, 36 h, and 48 h. The treated yeast was diluted 10 -1 , 10 -2 , 10 -3After doubling, take 3 µl of each point and culture on SD-Ura solid plate at 29°C until obvious colonies grow for observation.

[0062] The results are as follows Figure 6 As shown ( Figure 6 1×, 10×, 100×, 1000× respectively represent diluting the bacterial solution by 1, 10, 100, and 1000 times. Under drought stress, PeGRX13 The growth of PeGRX13 Can improve the drought resistance of transgenic yeast.

[0063] The specific embodiments of the present invention are described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modification and substitution of the practical is also within the scope of the present invention. Therefore, the equalization transformation and modification made without departing from the spirit and scope of the present invention should be included in the scope of the present invention.

Claims

1. A passion fruit PeGRX13 gene, characterized in that Its nucleotide sequence is shown in SEQ ID NO:

1.

2. The protein encoded by the Passiflora edulis PeGRX13 gene as claimed in claim 1.

3. A recombinant vector or host bacteria or expression cassette containing the passion fruit PeGRX13 gene coding region according to claim 1.

4. The recombinant vector according to claim 3, characterized in that The original vector of the recombinant vector is the pCAMBIA1304 expression vector, and the passion fruit PeGRX13 gene coding region is located between the NcoI and SpeI restriction endonuclease sites of the pCAMBIA1304 expression vector.

5. The recombinant vector according to claim 3, characterized in that The original vector of the recombinant vector is a pYES 2 expression vector, and the passion fruit PeGRX13 gene coding region is located between two restriction endonuclease sites, HinIII and BamHI, of the pYES 2 expression vector.

6. Use of the passion fruit PeGRX13 gene as claimed in claim 1, or the protein as claimed in claim 2, or the recombinant vector or host bacteria or expression cassette as claimed in claim 3 in improving yeast drought resistance.

7. Use of the passion fruit PeGRX13 gene as claimed in claim 1, or the protein as claimed in claim 2, or the recombinant vector or host bacteria or expression cassette as claimed in claim 3 in improving plant drought resistance, wherein the plant is Arabidopsis thaliana.

8. The application of the passion fruit PeGRX13 gene as claimed in claim 1, or the protein as claimed in claim 2, or the recombinant vector or host bacteria or expression cassette as claimed in claim 3 in improving plant antioxidant capacity, and / or reducing the malondialdehyde content of plant leaves, and / or promoting the proline content of plant leaves, wherein the plant is Arabidopsis thaliana.

9. Use of the passion fruit PeGRX13 gene as claimed in claim 1, or the protein as claimed in claim 2, or the recombinant vector or host bacteria or expression cassette as claimed in claim 3 in making plant leaves elongated and / or increasing plant petiole length, wherein the plant is Arabidopsis thaliana.

Images