Use of fusarium nf01 in the production of spermidine and catalyzing lignite liquefaction
By using Fusarium sp. NF01 strain in MM-SGC medium to secrete spermidine synthase, which catalyzes the synthesis of spermidine from putrescine and the liquefaction of lignite, the problem of low efficiency in microbial preparation of spermidine has been solved, achieving high-efficiency production and industrial application.
Patent Information
- Application Number
- CN202411539201.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-31
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2044-10-31
AI Technical Summary
In the existing technology, the microbial efficiency for preparing spermidine is low, which limits its widespread application in the medical field, and there is little research on the preparation of spermidine by Fusarium strains.
Fusarium sp. NF01, obtained through adaptive screening, was cultured in MM-SGC medium and secreted spermidine synthase. This enzyme catalyzes the synthesis of spermidine from putrescine and decarboxylation of S-adenosylmethionine. Spermine then interacts with other biogenic amines in lignite to catalyze its liquefaction.
This technology enables the efficient preparation of spermidine, improves production efficiency, reduces costs, minimizes environmental pollution, and advances the industrial process of microbial liquefaction of lignite.
Smart Images

Figure CN119307563B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of spermidine preparation and application, and particularly relates to application of fusarium NF01 in preparation of spermidine and catalysis of lignite liquefaction. BACKGROUND
[0002] Spermidine is a kind of aliphatic nitrogenous alkaloid with high biological activity, which belongs to biologically derived polycationic polyamine. Basicity is an important chemical property of spermidine. Spermidine can inhibit neuronal NO synthase, bind and precipitate DNA, and can also be used for purifying DNA binding protein and stimulating T4 polynucleotide kinase activity. Related research results prove that spermidine can also effectively delay cell aging, optimize immune regulation, inhibit cell oxidative stress and necrosis through the mechanism of cell autophagy.
[0003] The preparation method of spermidine includes chemical method and biological method. The chemical method mainly extracts the crushed tissues of animals and plants through organic solvents or acid-base solutions, and then spermidine is obtained through separation and purification. The biological method is a kind of high-efficiency and environmentally friendly method. The biological method for synthesizing spermidine mainly secretes biological enzymes through specific microorganisms, and then spermidine is obtained through a series of complex biochemical conversion processes. The prepared spermidine is mainly used in the field of medicine, such as anti-aging, neuroprotection and immunotherapy, so that it becomes an important target for future drug development.
[0004] At present, the microorganisms used for preparing spermidine mainly include intestinal bacteria such as lactobacillus reuteri and bifidobacterium, and engineering strains constructed through modern biological technology. However, the efficiency of these microorganisms in preparing spermidine is low, which limits the wide application of spermidine. At the same time, there are few research reports on fusarium strains capable of preparing spermidine, and it is necessary to develop a new application of fusarium strain in preparing spermidine. SUMMARY
[0005] In order to develop a new application of fusarium strain in preparing spermidine, the application of fusarium NF01 in preparing spermidine and catalyzing lignite liquefaction is proposed. In order to achieve the above purpose, the technical scheme is adopted as follows.
[0006] There are mainly two pathways for synthesizing spermidine in organisms. The first one is to synthesize spermidine directly from carboxylated adenosine methionine and putrescine under the action of spermidine synthase, and the carboxylated adenosine methionine can be obtained by methionine through adenylation and decarboxylation catalyzed by related enzymes. This pathway is a common traditional spermidine synthesis pathway in animals, plants and microorganisms. The second one is to synthesize spermidine from aspartic acid-beta-semialdehyde and putrescine under the catalysis of carboxyspermidine dehydrogenase and decarboxylase, and the aspartic acid-beta-semialdehyde can be synthesized from common amino acids such as aspartic acid through phosphorylation and dehydrogenation catalyzed by related enzymes. This pathway is a newly discovered alternative synthesis pathway, mainly existing in some bacteria, including important human pathogens, intestinal flora, etc.
[0007] Both of the above two pathways involve an important intermediate, putrescine, which can be synthesized from common amino acids such as ornithine or arginine through related enzyme catalysis, and is an important intermediate substrate in the synthesis of spermidine. Because the enzymes in these pathways are highly regulated, the spermidine content in animals and plants is low, and currently no microorganism can produce spermidine in large quantities. Based on this background, the application provides the application of fusarium NF01 in preparing spermidine and catalyzing lignite liquefaction. The fusarium NF01 provided by the application can produce spermidine in large quantities, and the prepared spermidine has high efficiency, and a new product application of a fusarium strain in preparing spermidine is developed. The fusarium NF01 is fusarium strain Fusarium sp. NF01. The strain is screened by in-situ coal seam collection of coal samples, and has significant advantages in adaptability to coal seam environment, conversion efficiency of coal and technical feasibility.
[0008] Preferably, the fusarium strain Fusarium sp. NF01 is inoculated in a culture medium for culture. The culture medium is MM-SGC solid culture medium, which is prepared by adding 1.4% to 1.6% of agar by mass percentage in MM-SGC liquid culture medium.
[0009] The composition and final concentration of the MM-SGC liquid culture medium are as follows: 8 g / L to 12 g / L of sodium gluconate, 2 g / L to 4 g / L of KH2PO4, 0.5 g / L to 2.5 g / L of MgSO4·7H2O, 0.5 g / L to 1.5 g / L of (NH)2SO4, 0.05 mg / L to 0.15 mg / L of FeSO4·7H2O, 0.1 mg / L to 0.3 mg / L of CuSO4·5H2O, and 0.5 mg / L to 1 mg / L of ZnSO4, and the solvent is water. The culture medium components can better realize the synthesis of spermidine by the fusarium strain Fusarium sp. NF01.
[0010] The fusarium strain Fusarium sp. NF01 secretes agmatine synthase, and the agmatine is synthesized through the agmatine synthase.
[0011] Preferably, the culture condition is constant temperature incubation at 28-32 DEG C.
[0012] Preferably, the culture time is 8-12 days.
[0013] Preferably, the method of inoculating the fusarium strain Fusarium sp. NF01 is directly inoculating the mycelium of the fusarium strain Fusarium sp. NF01 into the culture medium.
[0014] The application also provides the use of the fusarium NF01 in catalyzing lignite liquefaction, wherein the lignite is placed on the mycelium of the fusarium strain Fusarium sp. NF01 after the fusarium strain Fusarium sp. NF01 is cultured in the culture medium for 8-12 days, and then the lignite is continuously incubated for 17-23 days.
[0015] The fusarium strain Fusarium sp. NF01 is used for secreting putrescine, spermine, tyramine, phenylethylamine and tryptamine, and the lignite is catalyzed to liquefy through the cooperation of the agmatine.
[0016] Preferably, the amount of the lignite placed on the mycelium of the fusarium strain Fusarium sp. NF01 is that the volume of the culture medium is 50 mL, and the mass of the lignite is 0.28-0.32 g.
[0017] The particle size of the lignite is 0.070-0.078 cm.
[0018] In this process, the fusarium strain Fusarium sp. NF01 can convert the pretreated lignite into liquid.
[0019] Preferably, the lignite is pretreated by nitric acid.
[0020] The lignite is mixed with nitric acid with a concentration of 6 mol / L and placed for 36-72 h.
[0021] The mass of the lignite and the volume of the nitric acid with a concentration of 6 mol / L are in a ratio of 1:3-5. The lignite is pretreated by nitric acid, so as to oxidize the macromolecular structure of the lignite, break the structure, promote the oxidation activity, and improve the lignite liquefaction rate.
[0022] Preferably, the culture medium is a solid culture medium.
[0023] Specifically, the solid culture medium is MM-SGC solid culture medium, which is prepared by adding 1.4-1.6% (mass fraction) agar into MM-SGC liquid culture medium.
[0024] The MM-SGC liquid culture medium comprises the following components and has the following final concentrations: 8-12 g / L sodium gluconate, 2-4 g / L KH2PO4, 0.5-2.5 g / L MgSO4·7H2O, 0.5-1.5 g / L (NH)2SO4, 0.05-0.15 mg / L FeSO4·7H2O, 0.1-0.3 mg / L CuSO4·5H2O, 0.5-1 mg / L ZnSO4, and 1.5% wt agar, and water is used as the solvent. The medium components can better achieve the liquefaction amount of lignite by the fusarium strain Fusarium sp. NF01.
[0025] Preferably, the culture is incubated at a constant temperature of 28-32°C. The culture time is 25-35 days. The specific culture method is as follows:
[0026] The fusarium strain Fusarium sp. NF01 is first incubated for 8-12 days, and then the lignite is placed on the grown mycelium for further incubation for 17-23 days. The first incubation of the fusarium strain Fusarium sp. NF01 for 8-12 days can make the mycelium grow well, secrete spermidine, and more easily liquefy lignite, thereby increasing the liquefaction amount of lignite.
[0027] Preferably, the fusarium strain Fusarium sp. NF01 can secrete spermidine synthetase, which catalyzes the biosynthesis of spermidine from putrescine and decarboxylated S-adenosyl methionine. Spermidine can be synthesized by the fusarium strain Fusarium sp. NF01, and the process is simple, and the yield of spermidine obtained is high. At the same time, in the process of synthesizing spermidine, lignite can be liquefied, which can promote the technical progress and application expansion in the field of coal development.
[0028] The fusarium strain Fusarium sp. NF01 is used for secreting putrescine, spermine, tyramine, phenylethylamine, tryptamine, and acting on lignite together with spermidine to catalyze the liquefaction of lignite. The above method provided by the present application has a simple production process, easily available raw materials, low cost, good industrial application prospect, and is different from the production of spermidine by genetically engineered bacteria. The present application only needs to incubate the fusarium strain Fusarium sp. NF01 in the culture medium added with lignite for culture, so that spermidine can be synthesized, which is simple to operate and efficient.
[0029] Compared with the prior art, the present application has the following beneficial effects:
[0030] 1. The present application provides the application of Fusarium sp. NF01 in preparing spermidine and catalyzing lignite liquefaction. The Fusarium sp. NF01 provided by the present application can produce spermidine in large quantities, and the prepared spermidine has high efficiency, and a new product application of a Fusarium sp. strain in preparing spermidine is developed. The present application quantitatively and qualitatively analyzes the significantly differentially expressed proteome of the Fusarium sp. NF01 cultivated in lignite through proteomics technology, reveals the biological strategy of the Fusarium sp. NF01 strain responding to the lignite environment, determines the target protein and the reason of the lignite being bioliquefied by adopting the targeted detection of biological amines and the lignite bioliquefaction test under the inhibition of polyamines, and finally infers the pathway of the Fusarium sp. NF01 synthesizing spermidine. The present application reveals the mechanism of the Fusarium sp. NF01 liquefying lignite, promotes the realization of the industrial process of lignite microbial liquefaction, and improves the production efficiency, reduces the cost, and reduces the environmental pollution.
[0031] 2. The present application reveals the coping strategy of the Fusarium sp. NF01 responding to the lignite cultivation environment, and reveals the reason of the lignite being liquefied by the Fusarium sp. NF01, that is, the spermidine synthase catalyzes the biogenesis of spermidine from putrescine and decarboxylated S-adenosylmethionine, so that the culture solution presents alkaline liquefaction in the lignite. BRIEF DESCRIPTION OF DRAWINGS
[0032] Figure 1 FIG. 1 is a volcano plot of the relative protein abundance change of two groups of samples in the present application.
[0033] Figure 2 FIG. 2 is the biological liquefaction of lignite under the addition / non-addition of polyamine inhibitors in the present application; wherein, Figure 2 A figure in FIG. 2 is a biological liquefaction figure of adding polyamine inhibitors; Figure 2 B figure in FIG. 2 is a biological liquefaction figure of not adding polyamine inhibitors. DETAILED DESCRIPTION
[0034] The present application will be described in detail below in combination with the drawings and specific embodiments, but should not be understood as limiting the present application. If not specially stated, the technical means used in the following examples are the conventional means familiar to those skilled in the art, and the materials, reagents and the like used in the following examples, if not specially stated, can be obtained from commercial channels.
[0035] The culture medium and reagents used in the following examples are as follows:
[0036] (1) Culture medium
[0037] MM-SGC solid medium. The MM-SGC solid medium was prepared by adding 1.5% (mass percentage) agar into the MM-SGC liquid medium.
[0038] MM-SGC liquid medium: 10 g / L sodium gluconate, 3 g / L K2H2PO4, 1.5 g / L MgSO4·7H2O, 1 g / L (NH)2SO4, 0.1 mg / L FeSO4·7H2O, 0.2 mg / L CuSO4·5H2O, 0.68 mg / L ZnSO4, water to 1 L, and the pH was adjusted to 7.1.
[0039] (2) Reagents and materials
[0040] The raw lignite sample was obtained from the ground coal yard of Liujia Coal Mine in Yuanbaoshan Coalfield, Chifeng City, Inner Mongolia Autonomous Region.
[0041] The sodium gluconate, K2H2PO4, MgSO4·7H2O, and (NH)2SO4 in the above-mentioned medium were purchased from Shanghai Maikelin Biotechnology Co., Ltd.
[0042] The FeSO4·7H2O, CuSO4·5H2O, and ZnSO4 were purchased from Tianjin Fuchen Chemical Reagent Co., Ltd.
[0043] The inorganic salt reagents in the above-mentioned medium were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.
[0044] Example 1: Obtaining of strain Fusarium sp. NF01
[0045] I. Isolation and purification of the strain
[0046] Coal blocks were collected from the in-situ coal seam of the 6-8 working face of the north third section of the west two mining area of Liujia Coal Mine, and the coal blocks were quickly loaded into sterile bags and sealed for transportation to the laboratory for storage at 4°C. The coal blocks were crushed in a super workbench, and the center coal sample was taken for enrichment, separation, and purification to obtain the strain. The specific separation and purification method is described in “Biological Characteristics and Microstructure Analysis of Indigenous Bacteria for Lignite Degradation” (first author: Niu Xian, DOI: 10.13800 / j.cnki.xakjdxxb.2021.0510).
[0047] The strain obtained above is referred to as strain Fusarium sp. NF01. The strain Fusarium sp. NF01 is described in “Biological Characteristics and Microstructure Analysis of Indigenous Bacteria for Lignite Degradation” (first author: Niu Xian, DOI: 10.13800 / j.cnki.xakjdxxb.2021.0510). The strain is the indigenous bacteria F. spp. NF01 in the above-mentioned literature.
[0048] II. Identification of strain Fusarium sp. NF01
[0049] 1. The morphological and cultural characteristics of strain Fusarium sp. NF01 were observed in detail in "Biological characteristics and microstructure analysis of lignite degradation by original bacteria", the first author of which is Niu Xian, DOI: 10.13800 / j.cnki.xakjdxxb.2021.0510.
[0050] 2. The ITS sequence of strain Fusarium sp. NF01 was determined.
[0051] The determined ITS sequence of strain Fusarium sp. NF01 is shown as SEQ ID NO. 1:
[0052] TGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCAGCTTGGTGTTGGGACTCGCGAGTCAAATCGCGTTCCCCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATC.
[0053] The strain Fusarium sp. NF01 is preliminarily identified as Fusarium according to the comprehensive morphological characteristics and molecular identification results. The strain is recorded in "Biological characteristics and microstructure analysis of lignin-degrading bacteria in lignite", the first author of which is Niu Xian, DOI: 10.13800 / j.cnki.xakjdxxb.2021.0510. The strain is the original strain F. spp. NF01 in the above-mentioned literature.
[0054] The strain Fusarium sp. NF01519bq sequence number has been recorded in the NCBI GenBank database, and the accession number is MN822700.
[0055] Example 2: Application research of strain Fusarium sp. NF01 in preparation of spermidine
[0056] 1. Significantly different proteins
[0057] The present application has found that the strain Fusarium sp. NF01 can secrete spermidine synthetase, and then catalyze putrescine and decarboxylated S-adenosyl methionine to biosynthesize spermidine through spermidine synthetase. The present application uses TMT technology in proteomics to analyze the significantly different proteins of the strain during liquefaction of lignite. The specific research is as follows:
[0058] Two test groups are established. The first test group is that the strain Fusarium sp. NF01 is cultured in a medium without lignite at a constant temperature of 30 DEG C and a shaking table cultivation condition of 130 rpm for 30 days. The medium without lignite is MM-SGC liquid medium.
[0059] The second test group is that the strain Fusarium sp. NF01 is cultured in MM-SGC liquid medium with 0.3g lignite at a constant temperature of 30 DEG C and a shaking table cultivation condition of 130 rpm for 30 days.
[0060] Among them, the lignite added in the MM-SGC liquid medium is lignite obtained after nitric acid pretreatment, and the specific pretreatment method is as follows:
[0061] The original lignite sample is mixed with 6mol / L HNO3 according to the mass and volume ratio of 1:3.5g / mL, and after pretreatment for 48h, it is washed by suction filtration to neutral, pH6.7, and dried at 30 DEG C to obtain the pretreated lignite sample.
[0062] The particle size of the original lignite sample is 0.074mm.
[0063] In the above two test groups, the Fusarium sp. NF01 strain was inoculated by directly inoculating the mycelium of the Fusarium sp. NF01 strain into the MM-SGC liquid culture medium.
[0064] After 30 days of cultivation, the protein samples in the above two test groups were subjected to proteome detection and comparison by TMT technology.
[0065] The specific sample preparation and detection method is as follows:
[0066] (1) Protein extraction: The test sample was first placed in a pre-cooled ultrafiltration tube and centrifuged at 3000 x g and 4°C for 30 min to obtain a concentrated sample. 20 μL of the concentrated sample was mixed with 5 times the volume of lysis buffer, ultrasonically treated for 5 min, and centrifuged at 20,000 x g and 4°C for 30 min. The above steps were repeated 3 times. Then, 10 mM dithiothreitol was added to the supernatant, and the sample was incubated at 56°C for 1 hour. Finally, 55 mM iodoacetamide was added and alkylated in the dark for 1 hour, centrifuged at 20,000 x g and 4°C for 30 min, and the supernatant was used for subsequent analysis.
[0067] The test sample refers to the protein samples corresponding to the above two test groups, i.e., the mixed culture solution composed of the strains and the culture medium after 30 days of cultivation in the two test groups.
[0068] The formula of the lysis buffer is: 8M urea, 30mM HEPES, 1mM PMSF, 2mM EDTA and 10mM DTT, with water as the solvent.
[0069] Ultrafiltration tube: 10K; EMD Millipore.
[0070] The ultrasonic treatment conditions are 2s pulse on, 3s pulse off and 180W power.
[0071] (2) Protein quantification and quality control: The Bradford method was used to quantify the protein samples. 6 μg of protein in each sample was mixed with 5 times the volume of buffer and boiled at 98°C for 10 min. Then, the proteins in the sample were separated by 12.5% sodium dodecyl sulfate-polyacrylamide gel electrophoresis for 120 min at a constant 120V. After electrophoresis, the gel was stained with Coomassie Brilliant Blue G250.
[0072] The buffer is: 0.1M tris buffer, pH 6.8, v / v 4% sodium dodecyl sulfate, v / v 0.2% β-mercaptoethanol, v / v 40% glycerol and w / v 0.002% bromophenol blue. Sodium dodecyl sulfate is also known as SDS.
[0073] Mas Brilliant Blue G250: Thermo Fisher Scientific, Waltham, MA, USA.
[0074] (3) Stable isotope labeling of proteins: A sample containing 30 μg of protein was first placed in a pre-chilled ultrafiltration tube and centrifuged at 14,000 × g and 4 °C for 40 min to obtain a concentrated sample. The concentrated sample was mixed with 200 μL of 50 mM tetraethylammonium bromide and centrifuged at 14,000 × g and 4 °C for 40 min. The above steps were repeated 3 times. Then, 30 μg of trypsin was added to the protein sample and digested overnight in a water bath at 37 °C. The resulting polypeptide digest was lyophilized. The lyophilized polypeptide was resuspended in 25 μL of 200 mM TMEAB and labeled according to the manufacturer's instructions for the TMT-10-plex™ isobaric labeling kit. The samples were labeled as follows: NF1-1, 129C; NF1-2, 130N; NF2-1, 130C; and NF2-2, 131. After labeling, equal volumes of each sample were thoroughly mixed and dried in a vacuum concentrator.
[0075] Trypsin: Promega, Madison, WI, USA.
[0076] Labeling kit: Thermo Fisher Scientific, Waltham, MA, USA.
[0077] (4) Reverse-phase pre-separation: The labeled peptide mixture was fractionated using an L-3220 reverse-phase separator. Specific steps: First, the mixture was dissolved in 1 mL of buffer A and centrifuged at 15000 × g and 4 °C for 10 min. Then, the supernatant was injected into a C18 column and eluted with buffer B at a flow rate of 1 mL / min using a gradient: 0–5% buffer B for 101 min; 5%–9% buffer B for 101 min–107 min; 9%–13% buffer B for 107 min–113 min; 13%–19% buffer B for 113 min–119 min; 19%–80% buffer B for 119 min–125 min; 80%–5% buffer B for 125 min–130 min; after 130.01 min, buffer B was reset to 0%. Finally, the peptides were separated into 10 pre-separated fractions and vacuum dried.
[0078] Among them, the C18 column is: Phenomenex Gemini NX-C18; 250mm × 4.60mm; 5μm; Phenomenex, Torrance, CA, USA.
[0079] L-3220 reversed-phase separation instrument: RIGOL, Beijing, China.
[0080] Buffer A: 95% H2O and 5% acetonitrile; pH adjusted to 9.8 with ammonia water. Buffer B: 95% acetonitrile plus 5% H2O; pH adjusted to 9.8 with ammonia water.
[0081] (5) Liquid chromatography / tandem mass spectrometry analysis: LC-MS / MS analysis of samples was performed using a Dionex Ultimate 3000 Nano-LC liquid chromatograph coupled with a Q-ExActive mass spectrometer. The specific steps are as follows: first, the sample was loaded into a reversed-phase trapping column connected to a C18 reversed-phase analysis column in buffer A, and gradient separation was performed using buffer B at a flow rate of 0.4 μL / min. The linear gradient was as follows: 0-40 min, 5%-30% buffer B; 40 min-45 min, 30%-60% buffer B; 45 min-48 min, 60%-80% buffer B; 48 min-65 min, 80%-5% buffer B. Then, the separated components were identified by Q-ExActive MS mass spectrometry, and the main parameters were as follows: positive ion mode; scan range 350-2,000 m / z; full scan resolution 70,000; MS / MS scan resolution 35,000; capillary temperature 320°C; ion source voltage 1,800 V; collision energy normalization 30 eV.
[0082] Among them, the C18 reversed-phase analysis column: 75 μm x 15 cm; nanoviper C18; 5 μm; Thermo Fisher Scientific.
[0083] Dionex Ultimate 3000 Nano-LC liquid chromatograph: Thermo Fisher Scientific.
[0084] Buffer A: 0.1% formic acid, 2% acetonitrile, 98% water. Buffer B: 0.1% formic acid plus 98% acetonitrile plus 2% water.
[0085] Reversed-phase trapping column: Acclaim PepMap 100: 150 μm x 2 cm; 5 μm; Thermo Fisher Scientific.
[0086] (6) Bioinformatics analysis: Proteome Discoverer v.1.4 software platform combined with Mascot v.2.3.01 search engine was used for proteomic analysis. The protein database of Fusarium was downloaded from UniProt: http: / / www.uniprot.org database. The results of the search were standardized and quantified. The protein identification threshold was false discovery rate <0.01, and a maximum of 1 non-specific cleavage site was allowed. The difference significance evaluation of protein quantification took p<0.05 as the difference screening standard. Among them, the fold change of differential proteins ≥2 was up-regulated proteins, and FC≤0.5 was down-regulated proteins. Gene ontology and Kyoto Encyclopedia of Genes and Genomes database were used for analysis of GO function annotation and KEGG pathway enrichment, respectively.
[0087] Proteome Discoverer v.1.4: Thermo Fisher Scientific.
[0088] Mascot v.2.3.01: Matrix Science, London, UK.
[0089] Protein database: Uniprot-taxonomy 5506_Fusarium; 900,164 sequences.
[0090] Gene ontology: GO; http: / / geneontology.org.
[0091] The English abbreviation of false discovery rate is FDR. The English abbreviation of fold change of differential proteins is FC.
[0092] The English abbreviation of genome encyclopedia database is KEGG, and the specific website is https: / / www.kegg.jp.
[0093] Used for analysis of GO function annotation and KEGG pathway enrichment, respectively.
[0094] The above detection results are shown in Table 1. Figure 1
[0095] From the volcano plot of protein DEPs of Figure 1 , it can be seen that after proteomic detection, a total of 18 significantly differentially expressed proteins were identified. Among them, 8 DEPs were up-regulated: significant differential protein fold ≥1.2 and P value ≤0.05, and 10 DEPs were down-regulated: FC≤0.83 and P value ≤0.05.
[0096] Based on the protein fold change (FC) value, the top 3 up-regulated DEPs were analyzed, which were spermidine synthase, plasma membrane ATPase, and gamma-glutamyltransferase, respectively. The top 3 down-regulated DEPs were 6-hydroxy-d-nicotine oxidase, 3-phosphoinositol synthase, and aspartate aminotransferase, respectively.
[0097] Among them, DEPs refer to significantly different proteins.
[0098] The protein number of spermidine synthase is X0JZR4, EC 2.5.1.16, the protein number of plasma membrane ATPase is A0A365MSF8; PM H + The protein number of gamma-glutamyltransferase is A0A420Q050; GGT, EC 2.3.2.2. The protein number of 6-hydroxy-d-nicotine oxidase is A0A2H3TJF9; 6-HDNO, EC 1.5.3.6, the protein number of 3-phosphoinositol synthase is A0A1B8B876; IPS, EC 5.5.1.4, and the protein number of aspartate aminotransferase is A0A3L6NBM6; AST, EC 2.6.1.1.
[0099] Through the analysis of the 6 proteins, it is found that the strain Fusarium sp. NF01 adopts a multi-level protein regulation strategy to respond to the culture environment containing lignite. In the analysis of significantly up-regulated proteins, the main strategies include nutrient transport and synthesis, active regulation of the plasma membrane, optimization of immunity, and inhibition of cell damage and death. In the analysis of significantly down-regulated proteins, the strain Fusarium sp. NF01 shows growth retardation and poor metabolism in the MM-SGC liquid medium with lignite added. In addition, the most significantly up-regulated protein of the differential protein, spermidine synthase, is selected as the target protein. Because spermidine synthase can catalyze the transfer of propylamine from S-adenosylmethionine to putrescine to synthesize spermidine. Spermidine is a class of low-molecular-weight nitrogen-containing basic organic compounds belonging to aliphatic amines. When spermidine encounters water, it undergoes a hydrolysis reaction to release hydroxyl ions, making the solution alkaline. Previously, the strain Fusarium sp. NF01 was cultured in the MM-SGC liquid medium, which was alkaline. Therefore, spermidine synthase is selected as the target protein.
[0100] From the above experimental results, it can be known that the strain Fusarium sp. NF01 can secrete spermidine synthase, and it mainly adopts a multi-protein regulation strategy to respond to the lignite culture environment, including nutrient transport and synthesis, active regulation of the plasma membrane, optimization of immunity, and inhibition of cell damage and death.
[0101] 2. Targeted detection of biological amines
[0102] The present application carries out targeted detection of biological amine on strain Fusarium sp. NF01 by spermidine synthase to synthesize biological amine, and the specific research is as follows:
[0103] Two test groups are established, and each group has three repeated samples.
[0104] The first test group is that strain Fusarium sp. NF01 is cultivated in MM-SGC solid culture medium without adding lignite at 30℃ constant temperature.
[0105] The second test group is that strain Fusarium sp. NF01 is first cultivated in MM-SGC solid culture medium without adding lignite at 30℃ constant temperature for 10 days; 0.3g of lignite powder is evenly placed on the mycelium after 10 days of cultivation, and then cultivated for 20 days.
[0106] Among them, the lignite is nitric acid pretreated lignite. The specific pretreatment method is as follows:
[0107] The raw coal sample is mixed with 6mol / L HNO3 at a ratio of 1:3.5g / mL, and after pretreatment for 48h, it is filtered and washed to neutral: pH6.7, and then dried at 30℃ to obtain the pretreated coal sample.
[0108] When most of the lignite powder in the culture dish of the second test group is liquefied, 100±0.2mg of mycelium of the first test group and 100±0.2mg of mycelium of the second test group which is not covered by lignite are respectively picked up, and then they are placed in-80℃ freezer for detection. The specific detection method is as follows:
[0109] Take 50 mg of mycelium sample into a centrifuge tube, then add 1 mL of 0.1M hydrochloric acid, vortex mix, extract at room temperature for 1h. Then, the sample is centrifuged at 10000 rpm at 4℃ for 15 min, 10 μL of supernatant sample is taken into a bottle, 70 μL of AccQ Tag Ultra Borate buffer and 20 μL of AccQ Tag reagent are added. Finally, the sample is mixed and heated at 55℃ for 10 min, and after cooling, the sample is detected by high performance liquid chromatography and high resolution mass spectrometry. Among them, the chromatographic column is Waters BEH C18, the specification is 50*2.1mm, 1.7 μm. The mobile phase A is ultrapure water containing 0.1% (V / V) formic acid, the mobile phase B is acetonitrile containing 0.1% (V / V) formic acid, the flow rate is 0.5 mL / min, the column temperature is 55℃, and the injection amount is 1 μL. The elution gradient is 0 min water / acetonitrile: 95:5 V / V, 5.5 min water / acetonitrile: 90:10 V / V, 7.5 min water / acetonitrile: 75:25 V / V, 8 min water / acetonitrile: 40:60 V / V, 8.5 min water / acetonitrile: 95:5 V / V, 13 min water / acetonitrile: 95:5 V / V. The mass spectrometer uses an electrospray ion source, the sheath gas is 40 arb, the auxiliary gas is 10 arb, the ion spray voltage is +3000V, the temperature is 350℃, the ion transmission tube temperature is 320℃, and the full scan is in positive ion mode, with a primary scan range of 150-700.
[0110] Among them, the target biological amines of the sample to be tested are shown in Table 1.
[0111] High performance liquid chromatography: Vanquish, UPLC, Thermo, USA. High resolution mass spectrometry: Q Exactive, Thermo, USA.
[0112] Table 1 Information of biological amine standards
[0113] Name English Name CAS No. Molecular Formula Putrescine Cadaverine 110-60-1 [C4H 12 N2]]> Phenethylamine Tyramine 462-94-2 [C5H 14 N2]]> Spermine Spermidine 64-04-0 [C8H 11 N]]> Tryptamine Histamine 51-67-2 [C8H 11 N O ]]> Figure 2 Figure 2 71-44-3 C 10 H 26 N4]]> Figure 2 Figure 2 124-20-9 [C7H 19 N3]]> 61-54-1 C 10 H 12 N2]]> 51-45-6 [C5H9N3]
[0114] A total of 6 biological amines were detected, namely spermidine, putrescine, spermine, tyramine, phenethylamine and tryptamine, as shown in Table 2.
[0115] Table 2 Qualitative and quantitative results of biological amines
[0116]
[0117] Among them, the content of spermidine in the first test group is 132.838 ug / g, accounting for 68% in this group; the content of spermidine in the second test group is 128.903 ug / g, accounting for 65% in this group.
[0118] The content of putrescine in the first test group was 31.435 ug / g, accounting for 16.1% in the group; the content of putrescine in the second test group was 40.541 ug / g, accounting for 20.4% in the group.
[0119] The content of spermine in the first test group was 15.696 ug / g, accounting for 8% in the group; the content of spermine in the second test group was 16.616 ug / g, accounting for 8.4% in the group.
[0120] The above data show that the strain Fusarium sp. NF01 secretes a large amount of biogenic amines. Among them, the biogenic amines secreted by the strain Fusarium sp. NF01 are mainly composed of spermidine, putrescine and spermine, and the content of spermidine is the highest. No significant increase or decrease in the content of each biogenic amine was found in the second test group compared with the first test group, indicating that lignite powder has little effect on the secretion of biogenic amines by the strain.
[0121] In addition, biogenic amines are a kind of small molecular weight nitrogen-containing organic basic compounds with biological activity, and their basicity principle is similar to that of inorganic ammonia, such as: The nitrogen atom on the biogenic amine has an unshared pair of electrons, which is protonated to form a stable ammonium ion and a hydroxyl negative ion, thereby showing basicity. Therefore, biogenic amines are the reason why the culture medium of the strain Fusarium sp. NF01 cultivated in the MM-SGC solid culture medium is alkaline, and the content of spermidine in the first group of samples is the highest, accounting for more than 65%, which is the main alkaline substance of the alkaline culture medium.
[0122] At the same time, combined with the above proteomic analysis results, it is shown that the spermidine synthase secreted by the strain Fusarium sp. NF01 cultivated in the MM-SGC solid culture medium can catalyze the biosynthesis of spermidine from putrescine and decarboxylated S-adenosyl methionine.
[0123] Example 3: Application of strain Fusarium sp. NF01 in catalyzing lignite liquefaction
[0124] From the above research results, it can be seen that the spermidine synthase secreted by the strain Fusarium sp. NF01 cultivated in the MM-SGC solid culture medium can catalyze the biosynthesis of spermidine from putrescine and decarboxylated S-adenosyl methionine, and polyamines.
[0125] Polyamines refer to spermidine, putrescine and spermine.
[0126] To further determine whether the polyamines secreted by the strain Fusarium sp. NF01, namely 65% spermidine, 20.4% putrescine and 8.4% spermine, are the main reason for the biological liquefaction of lignite, the present application carries out a comparative test of the biological liquefaction of lignite by using polyamine mixed inhibitors, difluoromethylornithine and propylamidine hydrazone, so as to determine the change of the amount of biological liquefaction of lignite under the condition that the polyamines are inhibited and not inhibited, and thus reveal the reason for the biological liquefaction of lignite.
[0127] Among them, the polyamine mixed inhibitor is purchased from Shanghai Maikelin Biochemical Technology Co., Ltd. Difluoromethylornithine is also called DFMO; propylamidine hydrazone is also called MGBG.
[0128] The specific comparative test is as follows:
[0129] The experimental design has two groups of control samples, each group has 3 biological repeats, and a total of 6 petri dish samples. The first group of petri dishes are respectively filled with 45 mL of sterilized MM-SGC, and polyamine mixed inhibitors, namely 1 mmol / L difluoromethylornithine and 1 mmol / L propylamidine hydrazone, are added. The second group of petri dishes are respectively filled with 45 mL of sterilized MM-SGC. The first group and the second group of petri dishes are respectively inoculated with a ring of Fusarium sp. NF01 mycelium. After 10 days of cultivation, 1.8 g of nitric acid pretreated coal samples are evenly placed on the mycelium of the 6 petri dish samples of the first group and the second group, 0.3 g of nitric acid pretreated coal samples for each petri dish. Continue to cultivate for 20 days, use 2.0 μL of a pipette to suck the biological liquefaction of lignite droplets in each petri dish, and record the amount of biological liquefaction. Among them, propylamidine hydrazone is also called MGBG. Difluoromethylornithine is also called DFMO.
[0130] The nitric acid pretreatment method is as described above.
[0131] The results are shown in , and The comparative pictures of the biological liquefaction of lignite with and without the addition of inhibitors are shown. Among them, A figure in the A figure is the biological liquefaction figure with the addition of polyamine inhibitors; B figure in the B figure is the biological liquefaction figure without the addition of polyamine inhibitors.
[0132] After the strain Fusarium sp. NF01 is cultivated in the MM-SGC solid culture medium for 30 days, the first group only collects 0.28 mL of black droplets of the amount of biological liquefaction of lignite, and the second group collects 2.2 mL. The amount of biological liquefaction of lignite of the first group (with the addition of polyamine inhibitors) is significantly reduced by 87.3% compared with the amount of biological liquefaction of lignite of the second group (without the addition of polyamine inhibitors).
[0133] The above results show that the polyamines secreted by the strain Fusarium sp.NF01 cultivated in the MM-SGC solid culture medium, i.e., 65% spermidine, 20.4% putrescine and 8.4% spermine, are the main reasons for the brown coal bio-liquefaction.
[0134] The disclosure of the mechanism of the brown coal microbial liquefaction can effectively promote the industrial process of the brown coal microbial liquefaction, thereby improving the production efficiency, reducing the environmental pollution, increasing the product value and significantly reducing the mining cost.
[0135] The Fusarium NF01 is the strain Fusarium sp.NF01.
[0136] The Fusarium NF01 provided by the present application has the characteristics of cleanness and safety in the process of catalyzing the brown coal liquefaction and can quickly liquefy the brown coal.
[0137] It should be noted that when the numerical range is involved in the present application, the two endpoints of each numerical range and any number between the two endpoints can be selected.
[0138] Although the preferred embodiments of the present application have been described, those skilled in the art can make further changes and modifications to the embodiments once they know the basic inventive concept, and all the changes and modifications fall within the scope of the present application.
Claims
1. Use of Fusarium sp. NF01 for the preparation of spermidine, characterized in that, The Fusarium NF01 is a Fusarium strain Fusarium sp. NF01.
2. Use of Fusarium sp. NF01 according to claim 1 for the preparation of spermidine, characterized in that, culturing the fusarium strain Fusarium sp. NF01 was inoculated into the medium and cultured for 8 to 12 days; The culture medium is MM-SGC solid culture medium, which is prepared by adding 1.4-1.6% agar by mass percentage in MM-SGC liquid culture medium; The composition and final concentration of the MM-SGC liquid culture medium are as follows: 8-12 g / L sodium gluconate, 2-4 g / L KH2PO4, 0.5-2.5 g / L MgSO4·7H2O, 0.5-1.5 g / L (NH)2SO4, 0.05-0.15 mg / L FeSO4·7H2O, 0.1-0.3 mg / L CuSO4·5H2O, 0.5-1 mg / L ZnSO4, and water as solvent; The fusarium strain Fusarium sp . NF01 secretes an agmatine synthase, from which agmatine is synthesized.
3. Use of F. oxysporum NF01 according to claim 2 for the preparation of spermidine, characterized in that, The culture condition is constant temperature incubation at 28-32℃.
4. Use of F. oxysporum NF01 according to claim 2 for the preparation of spermidine, characterized in that, the Fusarium strain Fusarium sp. The method for NF01 at inoculation is to inoculate the mycelium of the Fusarium strain Fusarium sp. The mycelium of NF01 is inoculated directly into the culture medium.
5. Use of Fusarium sp. NF01 in catalyzing lignite liquefaction, characterized in that, The Fusarium strain as claimed in claim 1 Fusarium sp. After 8-12 days of culture of NF01 in the medium, the lignite is placed in the Fusarium strain Fusarium sp. The mycelium grown by NF01 is further incubated for 17-23 days; The fusarium strain Fusarium sp. NF01 for secretion of spermidine, putrescine, spermine, tyramine, phenylethylamine, tryptamine, catalyzing brown coal liquefaction.
6. Use of the Fusarium sp. NF01 according to claim 5 for catalyzing lignite liquefaction, characterized in that, The fusarium strain Fusarium sp. The amount of lignite placed on the hyphae grown by the NF01 was 50 mL of culture medium to 0.28 g to 0.32 g of lignite. The particle size of the lignite is 0.070-0.078 cm.
7. Use of the Fusarium sp. NF01 according to claim 5 for catalyzing lignite liquefaction, characterized in that, The lignite is lignite pretreated by nitric acid.
8. Use of the Fusarium sp. NF01 according to claim 7 for catalyzing lignite liquefaction, characterized in that, The method for the nitric acid pretreatment is as follows: The lignite is mixed with concentrated nitric acid and placed for 36-72 h; The mass ratio of the lignite to the volume of the concentrated nitric acid is 1:3-5; The concentration of the concentrated nitric acid is greater than or equal to 6 mol / L.
9. Use of the Fusarium sp. NF01 according to claim 8 for catalyzing lignite liquefaction, characterized in that, The concentration of the concentrated nitric acid is 6 mol / L nitric acid.
Citation Information
Patent Citations
Microbial cells for spermidine production
CN111201316A
KR20200040981A