PLAU and / or PLAUR gene modified non-human animal

Abstract

A non-human animal expressing human or chimeric (e.g., humanized) PLAU and / or PLAUR proteins and methods of use thereof are provided.

Description

A non-human animal modified with PLAU and / or PLAUR genes

[0001] Priority claim

[0002] This patent application claims priority to Chinese patent application No. 202210631316.5 filed on June 6, 2022, the entire contents of which are incorporated herein by reference. Technical Field

[0003] The present invention provides a non-human animal expressing human or chimeric (eg, humanized) PLAU and / or PLAUR protein and methods of use thereof.

[0004] background

[0005] Traditional drug development typically uses in vitro screening methods. However, these screening methods cannot provide the body's environment (such as the tumor microenvironment, stromal cells, extracellular matrix components, and immune cell interactions), resulting in a high rate of drug development failure. In addition, given the differences between humans and animals, the results of in vivo pharmacology trials using conventional experimental animals may not reflect the actual disease state and the interaction of target sites, resulting in significant differences between the results of many clinical trials and those of animal experiments.

[0006] Therefore, developing humanized animal models suitable for screening and evaluation of human antibodies will significantly improve the efficiency of new drug development and reduce drug development costs.

[0007] Overview

[0008] The present application provides an animal model with human or chimeric PLAU and / or PLAUR proteins. The animal model can express human or chimeric PLAU (e.g., humanized PLAU) protein and / or human or chimeric PLAUR (e.g., humanized PLAUR) protein. It can be used for the study of PLAU and PLAUR gene functions, and can also be used for the screening and evaluation of PLAU / PLAUR signaling pathway regulators (e.g., anti-human PLAU antibodies or anti-human PLAUR antibodies). In addition, the animal model prepared by the method described herein can be used for drug screening, pharmacodynamic studies, treatment of immune-related diseases, and cancer treatment of human PLAU / PLAUR target sites; the model can also be used to promote new drug development and design, saving time and cost. In summary, the present invention provides a powerful tool for studying the function of PLAU / PLAUR proteins and provides a platform for screening anti-cancer drugs.

[0009] In one aspect, the present invention provides a genetically modified non-human animal, one or more cells of which express a human or chimeric PLAUR protein, and a human PLAUR ligand (PLAU) can bind to the expressed human or chimeric PLAUR protein to activate a downstream signaling pathway. In some embodiments, the nucleotide sequence encoding the human or chimeric PLAUR protein is operably linked to an endogenous regulatory element (e.g., endogenous 5'UTR and / or 3'UTR) of an endogenous PLAUR locus on at least one chromosome. In some embodiments, the nucleotide sequence encoding the human or chimeric PLAUR protein comprises three homologous domains encoding a human PLAUR protein. In some embodiments, the amino acid sequence encoded by the nucleotide sequence encoding the human or chimeric PLAUR protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to human PLAUR (NP_002650.1, SEQ ID NO: 10). In some embodiments, the amino acid sequence encoded by the nucleotide sequence encoding the human or chimeric PLAUR protein comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identity to the amino acid sequence set forth at positions 24-335 of SEQ ID NO: 10. In some embodiments, the nucleotide sequence encoding the human or chimeric PLAUR protein comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identity to the nucleotide sequence set forth in SEQ ID NO: 15. In some embodiments, the animal is a mammal, such as a monkey, rodent, mouse or rat. In some embodiments, the animal is a mouse. In some embodiments, one or more cells of the animal express a human or chimeric PLAUR protein. In some embodiments, one or more cells of the animal express a human or chimeric PLAUR protein, and an endogenous PLAUR ligand (PLAU) can bind to a cell expressing a human or chimeric PLAUR protein and activate a downstream signaling pathway. In some embodiments, one or more cells of the animal express human or chimeric PLAUR protein, and human PLAUR ligand (PLAU) can bind to the expressed human or chimeric PLAUR protein to activate downstream signaling pathways.

[0010] In one aspect, the present invention provides a genetically modified non-human animal, the genome of which comprises a nucleotide sequence encoding an endogenous PLAUR region at an endogenous PLAUR locus replaced by a nucleotide sequence of a human PLAUR corresponding region. In some embodiments, the nucleotide sequence encoding the human PLAUR corresponding region is operably linked to an endogenous regulatory element of the endogenous PLAUR locus, and one or more cells of the animal express a human or humanized PLAUR protein. In some embodiments, the endogenous PLAUR protein of the animal is not expressed or is expressed at a reduced level compared to PLAUR in wild-type animals. In some embodiments, the nucleotide sequence encoding the human PLAUR corresponding region comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, and / or a portion of exon 7 of a human PLAUR gene. In some embodiments, the nucleotide sequence encoding the human PLAUR corresponding region is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence set forth in SEQ ID NO: 13. In some embodiments, the nucleotide sequence encoding the endogenous PLAUR region comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, and / or exon 7 of a mouse PLAUR gene. In some embodiments, the modified gene in the genome of the animal is homozygous or heterozygous for the endogenous replaced locus.

[0011] In one aspect, the present invention provides a non-human animal comprising at least one cell encoding a nucleotide sequence of a human or humanized PLAUR protein, wherein the human or humanized PLAUR protein comprises at least 50, 100, 150, 200, 250, 300, 310, 311, 312, 320, 330, 331, 332, 333, 334 or 335 consecutive amino acid sequences that are identical to the corresponding region of a human. In some embodiments, the human or humanized PLAUR protein comprises three homologous domains of a human PLAUR protein. In some embodiments, the amino acid sequence of the human or humanized PLAUR protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 10. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAUR is operably linked to an endogenous PLAUR regulatory element. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAUR can be integrated into the endogenous PLAUR locus of the animal. In some embodiments, the human or humanized PLAUR protein has at least one mouse PLAUR activity and / or human PLAUR activity.

[0012] In one aspect, the present invention provides a method for constructing a genetically modified non-human animal, wherein in at least one cell of the animal, at the animal's endogenous PLAUR locus, a nucleotide sequence encoding an endogenous PLAUR region is replaced with a nucleotide sequence of a corresponding region of human PLAUR. In some embodiments, the animal's endogenous PLAUR protein is not expressed or is expressed at a reduced level compared to PLAUR in wild-type animals. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAUR comprises three homologous domains encoding a human PLAUR protein. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAUR comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, and / or a portion of exon 7 of the human PLAUR gene. In some embodiments, the amino acid sequence encoded by the nucleotide sequence encoding the corresponding region of human PLAUR comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 10, pp. 24-335. In some embodiments, the nucleotide sequence encoding the endogenous PLAUR region comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, and / or exon 7 of the mouse PLAUR gene. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAUR is operably linked to an endogenous PLAUR regulatory element, such as a promoter. In some embodiments, the animal is a mammal, such as a monkey, a rodent, a mouse, or a rat. In some embodiments, the animal is a mouse. On the one hand, the present invention provides a method for constructing a non-human animal expressing a human or chimeric PLAUR gene modification, the method comprising replacing the nucleotide sequence encoding the endogenous PLAUR region with the nucleotide sequence of the corresponding region of human PLAUR at the endogenous mouse PLAUR locus, producing a genetically modified non-human animal cell, the animal cell expressing a human or chimeric PLAUR protein. In some embodiments, the human or chimeric PLAUR protein comprises three homologous domains of a human PLAUR protein. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAUR comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, and / or a portion of exon 7 of the human PLAUR gene. In some embodiments, the amino acid sequence encoded by the nucleotide sequence encoding the corresponding region of human PLAUR comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 10, 24-335. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAUR is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 13.In some embodiments, the nucleotide sequence of the endogenous PLAUR comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, and / or exon 7 of the mouse PLAUR gene. In some embodiments, the nucleotide sequence encoding the human or chimeric PLAUR protein is operably linked to a regulatory element of the endogenous PLAUR, such as a promoter. In some embodiments, the animal is a mammal, such as a monkey, rodent, mouse, or rat. In some embodiments, the non-human animal is a mouse.

[0013] In one aspect, the present invention provides a method for constructing a genetically modified non-human animal cell expressing a human or chimeric PLAUR, the method comprising replacing a nucleotide sequence encoding an endogenous PLAUR region at an endogenous mouse PLAUR locus with a nucleotide sequence of a corresponding region of human PLAUR, thereby producing a genetically modified non-human animal cell that expresses a human or chimeric PLAUR protein. In some embodiments, the human or chimeric PLAUR protein comprises three homologous domains of a human PLAUR protein. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAUR comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, and / or a portion of exon 7 of a human PLAUR gene. In some embodiments, the amino acid sequence encoded by the nucleotide sequence encoding the corresponding region of human PLAUR comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 10, pp. 24-335. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAUR is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence shown in SEQ ID NO: 13. In some embodiments, the nucleotide sequence of the endogenous PLAUR comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, and / or exon 7 of the mouse PLAUR gene. In some embodiments, the nucleotide sequence encoding the human or chimeric PLAUR protein is operably linked to a regulatory element of the endogenous PLAUR, such as a promoter. In some embodiments, the non-human animal is a mouse. In some embodiments, the non-human animal further comprises a nucleotide sequence of a human or chimeric protein encoded by other genes, the human or chimeric protein being selected from at least one of PLAUR ligand (PLAU), IL1B, IL6, IL15, PD-1, PD-L1, TIGIT, LAG3, CD226, CTLA4, and TNF-α. In some embodiments, the human or chimeric protein is a human or chimeric PLAU protein. In some embodiments, the human or chimeric PLAU protein comprises a full-length protein encoded by a human PLAU gene. In some embodiments, the amino acid sequence of the human or chimeric PLAU protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 2. In some embodiments, the non-human animal further comprises a nucleotide sequence of a human or chimeric protein encoded by another gene, wherein the human or chimeric protein is selected from at least one of PLAUR ligand (PLAU), IL1B, IL6, IL15, PD-1, PD-L1, TIGIT, LAG3, CD226, CTLA4, and TNF-α.In some embodiments, the human or chimeric protein is a human or chimeric PLAU protein. In some embodiments, the human or chimeric PLAU protein comprises the full-length protein encoded by the human PLAU gene. In some embodiments, the amino acid sequence of the human or chimeric PLAU protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO:2.

[0014] In one aspect, the present invention provides a genetically modified non-human animal, the genome of which comprises at least one chromosome comprising a nucleotide sequence encoding a human or chimeric urokinase-type plasminogen activator (PLAU) protein. In some embodiments, the nucleotide sequence encoding the human or chimeric PLAU protein is operably linked to a regulatory element (e.g., endogenous 5'UTR and / or 3'UTR) of an endogenous PLAU locus on at least one chromosome. In some embodiments, the amino acid sequence encoded by the nucleotide sequence encoding the human or chimeric PLAU protein comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the animal is a mammal, such as a monkey, rodent, mouse, or rat. In some embodiments, the animal is a mouse. In some embodiments, the endogenous PLAUR protein of the animal is not expressed or is expressed at a reduced level compared to PLAU in wild-type animals. In some embodiments, one or more cells of the animal express the human or chimeric PLAU protein. In some embodiments, one or more cells of the animal express human or chimeric PLAU protein, and endogenous PLAU receptors (PLAURs) can bind to the expressed human or chimeric PLAU protein to activate downstream signaling pathways. In some embodiments, one or more cells of the animal express human or chimeric PLAU protein, and human PLAU receptors (PLAURs) can bind to the expressed human or chimeric PLAU protein to activate downstream signaling pathways.

[0015] In one aspect, the present invention provides a genetically modified non-human animal, the genome of which is included in an endogenous PLAU locus, and the nucleotide sequence encoding the endogenous PLAU region is replaced by the nucleotide sequence of the corresponding region of human PLAU. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU is operably linked to a regulatory element of the endogenous PLAU locus, and one or more cells of the animal express human or humanized PLAU protein. In some embodiments, the endogenous PLAUR protein of the animal is not expressed or is expressed at a reduced level compared to PLAU in wild-type animals. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or exon 11 of the human PLAU gene. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU comprises the entire nucleotide sequence of the human PLAU coding region. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 8. In some embodiments, the nucleotide sequence encoding the endogenous PLAU region comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or exon 11 of the mouse PLAU gene. In some embodiments, the modified gene in the genome of the animal is homozygous or heterozygous for the endogenous replaced locus.

[0016] In one aspect, the present invention provides a non-human animal comprising at least one cell encoding a nucleotide sequence encoding a human or humanized PLAU protein, wherein the humanized PLAU protein comprises at least 50, 100, 150, 200, 250, 300, 350, 400, 410, 420, 430, or 431 consecutive amino acids identical to a corresponding region of a human PLAU protein. In some embodiments, the amino acid sequence of the humanized PLAU protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 2. In some embodiments, the nucleotide sequence encoding the human or humanized PLAU protein is operably linked to an endogenous PLAU regulatory element. In some embodiments, the nucleotide sequence encoding the human or humanized PLAU protein is integrated into an endogenous PLAU locus of the animal. In some embodiments, the humanized PLAU protein exhibits at least one mouse PLAU activity and / or human PLAU activity.

[0017] In one aspect, the present invention provides a method for constructing a genetically modified non-human animal, wherein in at least one cell of the animal, a nucleotide sequence encoding an endogenous PLAU region is replaced with a nucleotide sequence encoding a corresponding region of human PLAU at the animal's endogenous PLAU locus. In some embodiments, the non-human animal's endogenous PLAU protein is not expressed or is expressed at a reduced level compared to PLAU in a wild-type animal. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU comprises the entire sequence encoding a human PLAU protein. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or exon 11 of the human PLAU gene. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO:2. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the nucleotide sequence encoding the endogenous PLAU region comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or exon 11 of the mouse PLAU gene. In some embodiments, the modified gene in the genome of the animal is homozygous or heterozygous for the endogenous replaced locus.

[0018] In one aspect, the present invention provides a non-human animal comprising at least one cell encoding a nucleotide sequence encoding a human or humanized PLAU protein, wherein the humanized PLAU protein comprises at least 50, 100, 150, 200, 250, 300, 350, 400, 410, 420, 430, or 431 consecutive amino acids identical to a corresponding region of a human PLAU protein. In some embodiments, the amino acid sequence of the humanized PLAU protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 2. In some embodiments, the nucleotide sequence encoding the human or humanized PLAU protein is operably linked to an endogenous PLAU regulatory element. In some embodiments, the nucleotide sequence encoding the human or humanized PLAU protein is integrated into an endogenous PLAU locus of the animal. In some embodiments, the humanized PLAU protein exhibits at least one mouse PLAU activity and / or human PLAU activity.

[0019] In one aspect, the present invention provides a method for constructing a genetically modified non-human animal, wherein in at least one cell of the animal, a nucleotide sequence encoding an endogenous PLAU region is replaced with a nucleotide sequence encoding a corresponding region of human PLAU at the animal's endogenous PLAU locus. In some embodiments, the non-human animal's endogenous PLAU protein is not expressed or is expressed at a reduced level compared to PLAU in a wild-type animal. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU comprises the entire sequence encoding a human PLAU protein. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or exon 11 of the human PLAU gene. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO:2. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the nucleotide sequence encoding the endogenous PLAU region comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or exon 11 of the mouse PLAU gene. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU is operably linked to a regulatory element of endogenous PLAU, such as a promoter. In some embodiments, the animal is a mammal, such as a monkey, rodent, mouse, or rat. In some embodiments, the animal is a mouse.

[0020] In one aspect, the present invention provides a method for constructing a genetically modified non-human animal cell that expresses a human or chimeric PLAU protein. The method comprises replacing a nucleotide sequence encoding an endogenous PLAU region at the endogenous mouse PLAU locus with a nucleotide sequence encoding a corresponding region of human PLAU, thereby generating a genetically modified non-human animal cell, wherein the animal cell expresses a human or chimeric PLAU protein. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU comprises the entire sequence of a human PLAU protein. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or exon 11 of the human PLAU gene. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU encodes an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 2. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the nucleotide sequence encoding the endogenous PLAU region comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or exon 11 of the mouse PLAU gene. In some embodiments, the animal is a mouse. In some embodiments, the nucleotide sequence encoding the human or chimeric PLAU protein is operably linked to a regulatory element of endogenous PLAU, such as a promoter. In some embodiments, the animal further comprises a nucleotide sequence encoding a human or chimeric protein from another gene, wherein the human or chimeric protein is selected from at least one of PLAU receptor (PLAUR), IL1B, IL6, IL15, PD-1, PD-L1, TIGIT, LAG3, CD226, CTLA4, and TNF-α. In some embodiments, the human or chimeric protein is a human or chimeric PLAUR protein. In some embodiments, the amino acid sequence of the human or chimeric PLAUR protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 14. In some embodiments, the animal further comprises a nucleotide sequence of a human or chimeric protein encoded by other genes, wherein the human or chimeric protein is selected from at least one of PLAUR receptor (PLAUR), IL1B, IL6, IL15, PD-1, PD-L1, TIGIT, LAG3, CD226, CTLA4, and TNF-α.In some embodiments, the human or chimeric protein is a human or chimeric PLAUR protein. In some embodiments, the amino acid sequence of the human or chimeric PLAUR protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 14.

[0021] In one aspect, the present invention provides a method for determining the effectiveness of anti-PLAU and / or PLAUR antibodies in treating cancer, the method comprising: 1) administering anti-PLAU and / or PLAUR antibodies to the animal described herein, wherein the animal has a tumor; 2) determining the inhibitory effect of the anti-PLAU and / or PLAUR antibodies on the tumor. In some embodiments, the tumor comprises one or more tumor cells, wherein the tumor cells are injected into the animal. In some embodiments, determining the inhibitory effect of the anti-PLAU / PLAUR antibody on the tumor comprises measuring the tumor volume in the animal. In some embodiments, the tumor comprises breast cancer, pancreatic cancer, endocrine cancer, head and neck cancer, gastrointestinal cancer, colorectal cancer, bladder cancer, non-small cell lung cancer, glioblastoma, prostate cancer, neuroendocrine tumor, mesothelial tumor, oropharyngeal tumor, female reproductive system cancer or meningioma.

[0022] In one aspect, the present invention provides a method for determining the effectiveness of anti-PLAU and / or PLAUR antibodies and other therapeutic agents in treating cancer, the method comprising: 1) administering anti-PLAU and / or PLAUR antibodies to an animal as described herein, wherein the animal has a tumor; 2) determining the inhibitory effect of anti-PLAU and / or PLAUR antibodies on the tumor. In some embodiments, the animal further comprises a sequence encoding human or chimeric PD-1, human or chimeric PD-L1 and / or human or chimeric CTLA4. In some embodiments, the additional therapeutic agent is an anti-PD-1 antibody, an anti-PD-L1 antibody and / or an anti-CTLA4 antibody. In some embodiments, the tumor comprises one or more cells expressing PD-L1 protein. In some embodiments, the tumor comprises one or more tumor cells, wherein the tumor cells are injected into the animal. In some embodiments, determining the inhibitory effect of anti-PLAU / PLAUR antibodies on the tumor comprises measuring the tumor volume in the animal. In some embodiments, the tumor is breast cancer, pancreatic cancer, endocrine cancer, head and neck cancer, gastrointestinal cancer, colorectal cancer, bladder cancer, non-small cell lung cancer, glioblastoma, prostate cancer, neuroendocrine tumor, mesothelial tumor, oropharyngeal tumor, female reproductive system cancer, or meningioma.

[0023] In one aspect, the present invention provides a method for determining the effectiveness of an anti-PLAU and / or PLAUR antibody in treating an immune disease, the method comprising: 1) administering an anti-PLAU and / or PLAUR antibody to a non-human animal as described herein, wherein the non-human animal has an immune disease; and 2) determining the effect of the anti-PLAU and / or PLAUR antibody in treating the immune disease. In some embodiments, the immune disease is skin ulcer disease, rheumatoid arthritis, or stroke.

[0024] In one aspect, the present invention provides a method for determining the effectiveness of an anti-PLAU and / or PLAUR antibody in treating inflammation, the method comprising: 1) administering an anti-PLAU and / or PLAUR antibody to an animal as described herein, wherein the animal has inflammation; 2) determining the effectiveness of the anti-PLAU and / or PLAUR antibody in treating inflammation. In some embodiments, the inflammation is sepsis or an inflammatory disease.

[0025] In one aspect, the present invention provides a method for determining the toxicity of an anti-PLAU and / or PLAUR antibody, the method comprising: 1) administering an anti-PLAU and / or PLAUR antibody to an animal as described herein; 2) determining the effect of the anti-PLAU and / or PLAUR antibody on the animal. In some embodiments, determining the effect of the anti-PLAU and / or PLAUR antibody on the animal involves measuring the animal's weight, red blood cell count, hematocrit, and / or hemoglobin.

[0026] In one aspect, the present invention provides a humanized PLAUR protein comprising three homologous domains of a human PLAUR protein. In some embodiments, the amino acid sequence of the humanized PLAUR protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of positions 24-335 of SEQ ID NO: 10. In some embodiments, the amino acid sequence of the humanized PLAUR protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 15.

[0027] In one aspect, the present invention provides a humanized PLAUR gene, which encodes the above-mentioned humanized protein. The humanized PLAUR gene comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, and / or a portion of exon 7 of the human PLAUR gene. In some embodiments, the nucleotide sequence comprised by the humanized PLAUR gene is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 14.

[0028] In one aspect, the present invention provides a humanized PLAU protein comprising all or a portion of a human PALU protein. In some embodiments, the amino acid sequence of the humanized PLAU protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 2.

[0029] In one aspect, the present invention provides a humanized PLAU gene encoding the above-described humanized protein. In some embodiments, the humanized PLAU gene comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or a portion of exon 11 of the human PLAU gene. In some embodiments, the humanized PLAU gene comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 8.

[0030] In one aspect, the present invention provides a cell comprising the above-mentioned humanized PLAUR gene and / or the above-mentioned humanized PLAU gene, and / or the cell expresses any of the above-mentioned humanized PLAUR proteins and / or any of the above-mentioned humanized PLAU proteins.

[0031] In one aspect, the present invention provides an animal model, comprising any of the humanized PLAUR genes and / or any of the humanized PLAU genes, and / or, expressing any of the humanized PLAUR proteins and / or any of the humanized PLAU proteins.

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. Methods and materials for use in the present invention are described herein, and other suitable methods and materials known in the art may also be used. The materials, methods, and examples are illustrative only and not restrictive. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In the event of a conflict, the present specification (including definitions) shall prevail. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1: Schematic comparison of the mouse PLAU gene and the human PLAU locus (not to scale);

[0034] Figure 2: Schematic diagram of the humanized mouse PLAU gene (not to scale);

[0035] Figure 3: Schematic diagram of the PLAU gene targeting strategy and targeting vector design (not to scale);

[0036] Figure 4: Schematic diagram of the FRT recombination process of the humanized PLAU gene in mice (not to scale);

[0037] Figure 5: Schematic diagram of the PLAU gene targeting strategy and targeting vector design (not to scale);

[0038] Figure 6: PCR identification results of the tail of F1 generation of humanized PLAU mice, where WT is the wild-type control, H2O is the water control, and M is the marker;

[0039] Figure 7: Schematic diagram of Southern Blot detection results, where WT is the wild-type control;

[0040] Figure 8: RT-PCR results of C57BL / 6 wild-type mice (+ / +) and humanized PLAU heterozygous mice (H / +), where H2O is the water control and GAPDH is the internal control for glyceraldehyde-3-phosphate dehydrogenase;

[0041] Figure 9: Schematic comparison of the mouse PLAUR gene and the human PLAUR locus (not to scale);

[0042] Figure 10: Schematic diagram of the humanized mouse PLAUR gene (not to scale);

[0043] Figure 11: Schematic diagram of the PLAUR gene targeting strategy and targeting vector design (not to scale);

[0044] Figure 12: Schematic diagram of the FRT recombination process of the humanized PLAUR gene in mice (not to scale);

[0045] Figure 13: Tail PCR identification results of F1 generation mice carrying the humanized PLAUR gene, where WT is the wild-type control, PC is the positive control, H2O is the water control, and M is a marker;

[0046] Figure 14: RT-PCR test results of C57BL / 6 wild-type mice (+ / +) and humanized PLAUR gene heterozygous mice (H / +), where H2O is the water control and GAPDH is the internal control for glyceraldehyde-3-phosphate dehydrogenase;

[0047] Figure 15: Western blot analysis results of C57BL / 6 wild-type mice (+ / +) and humanized PLAU homozygous mice (H / H), where hPLAU is human PLAU protein and β-actin is the internal control of β-actin.

[0048] Figure 16: ELSA detection of PLAU expression in serum, where Figure 16A shows the expression detection results of mouse PLAU protein; Figure 16B shows the expression detection results of human PLAU protein

[0049] Figure 17: Schematic diagram of the tumor volume of mice after anti-tumor efficacy testing after PLAU / PLAUR double humanized homozygous mice were implanted with PLAU humanized colon cancer cells MC38.

[0050] Figure 18: Schematic diagram of the body weight of mice after anti-tumor efficacy testing after PLAU / PLAUR double humanized homozygous mice were implanted with PLAU humanized colon cancer cells MC38.

[0051] Figure 19: Human PLAU amino acid sequence (NP_002649.2; SEQ ID NO: 2) and mouse PLAU amino acid sequence (NP_032899.1; SEQ ID NO: 1);

[0052] Figure 20: Human PLAU amino acid sequence (NP_002649.2; SEQ ID NO: 2) and rat PLAU amino acid sequence (NP_037217.3; SEQ ID NO: 54);

[0053] Figure 21: Human PLAUR amino acid sequence (NP_002650.1; SEQ ID NO: 10) and mouse PLAUR amino acid sequence (NP_035243.1; SEQ ID NO: 9);

[0054] Figure 22: Human PLAUR amino acid sequence (NP_002650.1; SEQ ID NO: 10) and rat PLAUR amino acid sequence (NP_599179.2; SEQ ID NO: 55);

[0055] Detailed description

[0056] The urokinase plasminogen activator system (UPAS) regulates numerous important physiological processes, including fibrin degradation, extracellular matrix (ECM) remodeling, and cell migration, by activating the ubiquitous protein plasmin. Members of this system include prourokinase activator (PLAU), prourokinase activator receptor (PLAUR), plasminogen activator inhibitor-1 (PAI-1), and plasminogen activator inhibitor-2 (PAI-2). UPAS regulation is stringent and cell-specific, involving the regulation of zymogens, inhibitors, and receptors. It plays a crucial role in ECM remodeling during physiological processes such as embryonic development, wound healing, and post-lactation mammary gland development. In addition to its role in physiological processes, UPAS is active in most tumors, and abnormalities in its regulation are associated with tumor metastatic phenotypes and progression. Studies have found that PLAU and PLAUR are closely related to the invasion and metastasis of malignant tumors, and play an important role in the degradation of extracellular matrix, tissue remodeling, angiogenesis, cell infiltration and proliferation, and have certain guiding significance for the judgment of the malignancy and prognosis of tumors.

[0057] PLAUR

[0058] The urokinase-type plasminogen activator (uPA) receptor (PLAUR) is a cysteine-rich, glycosylated, single-chain protein and a glycosylphosphatidylinositol (GPI)-anchored receptor located on the cell surface. It comprises three homologous domains (DI, DII, and DIII) linked by disulfide bonds. Because it lacks transmembrane and intracellular regions, PLAUR must form co-receptors with integrins, protein-coupled receptors (GPCRs), and growth factor receptors to activate intracellular signaling and promote cell motility, invasion, proliferation, and survival. In addition to PLAU, vitronectin is another key ligand for PLAUR; these two ligands have separate binding sites with the receptor. PLAUR binds to both ligands simultaneously to promote downstream regulation of proteases, cell adhesion, and signal transduction. PLAUR gene expression is regulated through transcriptional and posttranscriptional binding mechanisms. The upstream region of the PLAUR gene contains cis-acting elements for numerous transcription factors, including Sp1, AP1, AP2, PEA3, Kruppel-ike factor 4, hypoxia factor 1α (HIF-1α), NF-κB, TCF, and LEF. These transcription factors, acting on the PLAUR gene, are activated by numerous signaling pathways, thereby coordinating PLAUR expression in tumors. Furthermore, multiple studies in recent years have found that PLAU and PLAUR are expressed in macrophages, neutrophils, and endothelial cells of the inflamed synovium of rheumatoid arthritis (RA) patients, but not in the synovium of healthy individuals. Consequently, PLAU and PLAUR are receiving increasing attention in the treatment of RA.

[0059] In the human genome, the PLAUR gene (Gene ID: 5329) contains seven exons: exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, and exon 7 ( Figure 9 ). The nucleotide sequence of human PLAUR mRNA is NM_002659.4, and the amino acid sequence of human PLAUR is NP_002650.1 (SEQ ID NO: 10). Based on the nucleotide and amino acid sequences of transcript NM_002659.4 and its encoded protein NP_002650.1, the corresponding positions of each exon are as follows:

[0060] Table 1

[0061] The human PLAUR gene (NCBI Gene ID: 5329) is located at positions 43646095 to 43670197 of NC_000019.10 on chromosome 19 (GRCh38.p13 (GCF_000001405.39). The specific positions of each exon based on the nucleotide sequence of transcript NM_002659.4 are as follows: the 5'UTR is located at positions 43670169 to 43670121 of NC_000019.10; exon 1 is located at positions 43670169 to 43670121 of NC_000019.10; 9 to 43670066, intron 1 is located at NC_000019.10 positions 43670065 to 43667692, exon 2 is located at NC_000019.10 positions 43667691 to 43667581, intron 2 is located at NC_000019.10 positions 43667580 to 43665460, exon 3 is located at NC_000019.10 positions 43665459 to 43665316, intron 3 is located at NC_000019.10 positions 43665460 to 43665470. 0 at positions 43665315 to 43656641, exon 4 at positions 43656640 to 43656479 of NC_000019.10, intron 4 at positions 43656478 to 43655574 of NC_000019.10, exon 5 at positions 43655573 to 43655439 of NC_000019.10, intron 5 at positions 43655438 to 43652372 of NC_000019.10, exon 6 at positions 43656479 to 43656478 of NC_000019.10 _000019.10 positions 43652371 to 43652225, intron 6 is located at positions 43652224 to 43649144, and exon 7 is located at positions 43649143 to 43648579 of NC_000019.10. The 3' UTR is located at positions 43648889 to 43648579 of NC_000019.10. All relevant information about the human PLAUR locus can be retrieved on the NCBI website (Gene ID: 5329). The entire content of which is incorporated herein by reference.

[0062] In the mouse genome, the PLAUR gene (Gene ID: 18793) contains seven exons: exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, and exon 7 ( Figure 9 ). The nucleotide sequence of mouse PLAUR mRNA is NM_011113.4, and the amino acid sequence of mouse PLAUR is NP_035243.1 (SEQ ID NO: 9). Based on the nucleotide and amino acid sequences of transcript NM_011113.4 and its encoded protein NP_035243.1, the corresponding positions of each exon are as follows:

[0063] Table 2

[0064] The mouse PLAUR gene (NCBI Gene ID: 18793) is located at positions 24161857 to 24175393 of NC_000073.7 on chromosome 7 (GRCm39 (GCF_000001635.27)). The specific positions of each exon based on the nucleotide sequence of transcript NM_011113.4 are as follows: 5'UTR is located at positions 24161909 to 24161934 of NC_000073.7, exon 1 is located at positions 24161909 to 24161992 of NC_000073.7, intron 1 is located at positions 24161993 to 24164555 of NC_000073.7, and exon 2 is located at positions 24161909 to 24161993 of NC_000073.7. Exon 2 is located at position 24164556 to 24164666 of NC_000073.7, intron 2 is located at position 24164667 to 24166099 of NC_000073.7, exon 3 is located at position 24166100 to 24166243 of NC_000073.7, intron 3 is located at position 24166244 to 24171323 of NC_000073.7, exon 4 is located at position 24164667 to 24166099 of NC_000073.7, exon 5 is located at position 24166100 to 24166243 of NC_000073.7, intron 6 is located at position 24166244 to 24171323 of NC_000073.7, exon 7 is located at position 24164667 to 24166099 of NC_000073.7 Exon 4 is located at position 24171324 to 24171479 of NC_000073.7, intron 4 is located at position 24171480 to 24171997 of NC_000073.7, exon 5 is located at position 24171998 to 24172132 of NC_000073.7, intron 5 is located at position 24172133 to 24173634 of NC_000073.7, exon 6 is located at position 24171998 to 24172132 of NC_000073.7, intron 7 is located at position 24172134 to 24173635 of NC_000073.7, exon 8 is located at position 24171998 to 24172133 of NC_000073.7, exon 9 is located at position 24171998 to 24172133 of NC_000073.7, exon 10 is located at position 24171998 to 24172133 of NC_000073.7, exon 11 is located at position 24171998 to 24172133 of NC_000073.7, exon 12 is located at position 24171998 to 24172133 of NC_000073.7, exon 13 is located at position 24171998 to 24172133 of NC_000073.7, exon 14 is located at position 24171998 to 2417213 Exon 6 is located at positions 24173635 to 24173781 of NC_000073.7, intron 6 is located at positions 24173782 to 24174663 of NC_000073.7, exon 7 is located at positions 24174664 to 24175392 of NC_000073.7, and the 3' UTR is located at positions 24174897 to 24175392 of NC_000073.7. All relevant information about the mouse PLAUR locus can be found on the NCBI website (Gene ID: 18793), the entire contents of which are incorporated herein by reference.

[0065] Figure 21 shows an alignment of the human PLAUR amino acid sequence (NP_002650.1; SEQ ID NO: 10) and the mouse PLAUR amino acid sequence (NP_035243.1; SEQ ID NO: 9). Thus, corresponding amino acid residues or regions between human and mouse PLAUR can be found in Figure 21.

[0066] PLAUR genes, proteins, and gene loci for other species are also known in the art. For example, the PLAUR of Rattus norvegicus (rat) has Gene ID: 50692, the PLAUR of Macaca mulatta (rhesus monkey) has Gene ID: 710662, the PLAUR of Canis lupus familiaris (dog) has Gene ID 476446, and the PLAUR of Sus scrofa (pig) has Gene ID 100521017. Relevant information (e.g., intron sequences, exon sequences, and amino acid sequences) for these genes can be found in NCBI, the entire contents of which are incorporated herein by reference.

[0067] Figure 22 shows the human PLAUR amino acid sequence (NP_002650.1; SEQ ID NO: 10) and the rat PLAUR amino acid sequence (NP_599179.2; SEQ ID NO: 55). Thus, in Figure 22, homologous regions of the human and rat PLAUR amino acid sequences can be retrieved.

[0068] The present invention provides a human or chimeric (e.g., humanized) PLAUR nucleotide sequence or amino acid sequence. In some embodiments, all or part of the nucleotide sequence of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, and / or exon 7 of the mouse PLAUR gene is replaced by the corresponding nucleotide sequence of the human PLAUR gene. In some embodiments, a "region" or "portion" of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, and / or exon 7 of the mouse PLAUR gene is replaced by the corresponding nucleotide sequence or amino acid sequence of the human PLAUR gene. The term "region" or "portion" refers to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 910, 911, 912, 913, 914, 915, 916, 917, 918, 919, 920, 930, 940, 950, 1000, 1100, 1200, 1250 304, 305, 306, 307, 308, 309, 310, 320, 321, 322, 323, 324, 325, 326, or 327 consecutive amino acid sequences. In some embodiments, the "region" or "portion" is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or at least 100% identical to the amino acid sequence encoded by exon 1, exon 2, exon 3, exon 4, exon 5, exon 6 and / or exon 7. In some embodiments, a "region," "part," or "entire" sequence of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, and / or exon 7 (e.g., a portion of exon 2, all of exons 3-6, and a portion of exon 7) of a mouse PLAUR gene is replaced by a "region," "part," or "entire" sequence of the corresponding exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, and / or exon 7 (e.g., a portion of exon 2, all of exons 3-6, and a portion of exon 7) of a human PLAUR gene.

[0069] In some embodiments, a "region" or "portion" of endogenous exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, and / or exon 7 is deleted.

[0070] In some embodiments, the present invention provides a genetically modified non-human animal, wherein the genome of the non-human animal comprises a human, chimeric, or humanized PLAUR nucleotide sequence. In some embodiments, the protein encoded by the human, chimeric, or humanized PLAUR nucleotide sequence is at least 70%, 80%, 85%, 90%, 95%, or 100% identical to the amino acid sequence of SEQ ID NO: 10. In some embodiments, the genome of the non-human animal comprises a nucleotide sequence that is at least 70%, 80%, 85%, 90%, 95%, or 100% identical to the nucleotide sequence of SEQ ID NO: 11, 12, 13, or 14.

[0071] In some embodiments, the non-human animal described herein comprises a nucleotide sequence encoding a human or humanized PLAUR protein. In some embodiments, the human or humanized PLAUR protein comprises three homology domains of a human PLAUR protein, wherein the homology domains comprise DI, DII, and DIII.

[0072] In some embodiments, the non-human animals described herein comprise a human or humanized PLAUR gene. In some embodiments, the humanized PLAUR gene comprises 7 exons. In some embodiments, the humanized PLAUR gene comprises humanized exon 2, human exon 3, human exon 4, human exon 5, human exon 6, and / or human exon 7. In some implementations, the humanized PLAUR gene comprises human intron 2, human intron 3, human intron 4, human intron 5, and / or human intron 6. In some embodiments, the humanized PLAUR gene comprises a human or humanized 5'UTR. In some implementations, the humanized PLAUR gene comprises a human or humanized 3'UTR. In some embodiments, the humanized PLAUR gene comprises an endogenous 5'UTR. In some embodiments, the humanized PLAUR gene comprises an endogenous 3'UTR.

[0073] In some embodiments, the genetically modified non-human animal can express human PLAUR and / or chimeric (e.g., humanized) PLAUR proteins, wherein the endogenous PLAUR gene sequence is replaced by a human PLAUR gene and / or nucleotide sequence. Furthermore, the human PLAUR gene and / or nucleotide sequence encodes an amino acid sequence of human PLAUR that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 100% identical to the amino acid sequence of human PLAUR. In various embodiments, the PLAUR gene of the endogenous non-human animal is replaced in whole or in part by a nucleotide sequence encoding a mature PLAUR protein.

[0074] In some embodiments, the genetically modified non-human animal expresses human PLAUR and / or chimeric PLAUR proteins (e.g., humanized PLAUR) under mouse endogenous promoters and / or regulatory elements. Replacement of the mouse endogenous locus provides a non-human animal that expresses human or chimeric PLAUR proteins (e.g., humanized PLAUR) in the same cell type. The genetically modified mice do not show potential diseases observed in certain other transgenic mice known in the art. The human PLAUR or chimeric PLAUR protein expressed in the non-human animal can maintain the function of one or more wild-type or human PLAUR proteins, for example, the expressed PLAUR protein can bind to human or non-human PLAUR protein. Further, in some embodiments, the genetically modified non-human animal does not express endogenous PLAUR protein. In some embodiments, the expression of endogenous PLAUR protein in the genetically modified non-human animal is reduced. "Endogenous PLAUR protein" described herein refers to the PLAUR protein encoded by the endogenous PLAUR nucleotide sequence of the non-human animal (e.g., mouse) before genetic modification.

[0075] The genome of the non-human animal comprises a nucleotide sequence encoding an amino acid that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of human PLAUR protein (NP_002650.1; SEQ ID NO: 10). In some embodiments, the genome comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or at least 100% identical to the nucleotide sequences of SEQ ID NO: 13 and SEQ ID NO: 14.

[0076] The nucleotide sequence encoding the endogenous PLAUR region in the non-human animal genome is replaced by the nucleotide sequence encoding the corresponding region of human PLAUR. In some embodiments, the nucleotide sequence encoding the endogenous PLAUR region is any sequence of the endogenous PLAUR locus, such as exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, 5'UTR, 3'UTR, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6 or any combination thereof. In some embodiments, the nucleotide sequence encoding the endogenous PLAUR region is located within the endogenous PLAUR regulatory region. In some embodiments, the nucleotide sequence encoding the endogenous PLAUR region is exon 1, exon 2, exon 3, exon 4, exon 5, exon 6 and / or exon 7, or a portion thereof.

[0077] One or more cells of the genetically modified non-human animal express a human or chimeric PLAUR protein (e.g., a humanized PLAUR protein). In some embodiments, the human or chimeric PLAUR protein comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 220, 240, 260, 280, 300, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 330, 331, 332, 333, 334, or 335 consecutive amino acids of the amino acid sequence of SEQ ID NO: 10.

[0078] In some embodiments, the genome of the genetically modified non-human animal contains all or part of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6 and / or exon 7 of the human PLAUR gene, or all or part of the nucleotide sequence shown in SEQ ID NO: 13.

[0079] In some embodiments, the genetically modified non-human animal genome comprises a portion of exon 2 of the human PLAUR gene, all of exons 3-6, and a portion of exon 7. In some embodiments, the portion of exon 2 comprises at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 91, 93, 95, 97, 100, or 111 bp of contiguous nucleotide sequence of exon 2 of the human PLAUR gene. In some embodiments, the portion of exon 2 comprises a 97 bp contiguous nucleotide sequence. In some embodiments, the portion of exon 2 comprises at least 50 bp or at least 100 bp of nucleotide sequence. In some embodiments, the portion of exon 7 comprises at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 251, 252, 253, 254, 300, 350, 400, 450, 500, 550, 560, or 565 bp of contiguous nucleotide sequence of human PLAUR gene exon 7. In some implementations, the portion of exon 7 comprises 254 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 7 comprises at least 50 bp or at least 100 bp of nucleotides. The portion of exon 2, all of exons 3-6, and the portion of exon 7 of the human PLAUR gene comprise at least 100-500 bp, 500-800 bp, or 800-900 bp of contiguous nucleotide sequence. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAUR is located at nucleotide sequence 119-1057 of human PLAUR gene transcript NM_002659.4.

[0080] In some embodiments, the PLAUR gene of the genetically modified non-human animal is heterozygous or homozygous for the endogenous modified locus.

[0081] In some embodiments, the humanized PLAUR genome lacks the 5'UTR of the human PLAUR gene. In some embodiments, the humanized PLAUR genome comprises an endogenous (e.g., mouse) 5'UTR. In some embodiments, the humanized PLAUR genome comprises an endogenous (e.g., mouse) 3'UTR. Where appropriate, based on the similarity of the 5' flanking sequences, it is reasonable to infer that mouse and human PLAUR genes are subject to similar regulation. As described herein, the humanized PLAUR mouse comprises a replacement of the endogenous mouse locus, which retains the mouse endogenous regulatory elements but comprises a humanized PLAUR coding sequence. The expression of PLAUR in genetically modified heterozygous or homozygous mice is completely normal.

[0082] In another aspect, the present invention provides a genetically modified non-human animal, the genome of which comprises a deletion of an endogenous PLAUR gene, wherein the deletion of the endogenous PLAUR gene comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6 and / or exon 7, or a portion of the endogenous PLAUR locus.

[0083] In some embodiments, the deletion of the endogenous PLAUR gene comprises one or more exons or portions of exons selected from exon 1, exon 2, exon 3, exon 4, exon 5, exon 6 and / or exon 7.

[0084] In some embodiments, the endogenous PLAUR gene deletion further comprises one or more introns or portions of introns selected from the group consisting of PLAUR gene intron 1, intron 2, intron 3, intron 4, intron 5, and intron 6.

[0085] In some embodiments, the deletion comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1501, 1502, 1503, 1504, 1505, 1506, 1507 or 1508 bp of consecutive nucleotide sequence or more.

[0086] In some embodiments, the deletion of the endogenous PLAUR gene comprises at least 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 910, 911 or 912 bp of contiguous nucleotide sequence or more of exon 2, exon 3, exon 4, exon 5, exon 6 and / or exon 7 (e.g., a deletion of at least 50 bp of contiguous nucleotide sequence of exon 2, all of exons 3-6, and at least 100 bp of contiguous nucleotide sequence of exon 5).

[0087] The present invention provides a humanized mouse PLAUR genomic DNA sequence, a construct expressing the amino acid sequence of the humanized PLAUR protein, a cell comprising the construct, and a tissue comprising the cell.

[0088] Thus, in some embodiments, the present invention provides a chimeric (e.g., humanized) PLAUR nucleotide sequence and / or amino acid sequence, wherein in some embodiments, the chimeric nucleotide sequence is fused to mouse endogenous PLAUR mRNA (e.g., NM_011113.4), mouse PLAUR amino acid sequence (e.g., NP_035243.1, SEQ ID NO:9) or a portion thereof (e.g., 5'UTR, all of exon 1, a portion of exon 2, a portion of exon 7, and the 3'UTR) and has a sequence identity of at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the chimeric nucleotide sequence has at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a human PLAUR mRNA sequence (e.g., NM_002659.4), a human PLAUR amino acid sequence (e.g., NP_002650.1, SEQ ID NO: 10), or a portion thereof (e.g., a portion of exon 2, exons 3-6, and a portion of exon 7).

[0089] In some embodiments, the chimeric nucleic acid sequence described above is operably linked to a promoter or regulatory element, for example, an endogenous mouse PLAUR promoter, an inducible promoter, an enhancer and / or mouse or human regulatory elements.

[0090] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a contiguous or non-contiguous nucleotide sequence) of a chimeric nucleic acid sequence described herein differs from all or a portion of a mouse PLAUR nucleotide sequence (e.g., a portion of exon 2, exons 3-6, and a portion of exon 7 of the mouse PLAUR gene transcript NM_011113.4).

[0091] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a contiguous or non-contiguous nucleotide sequence) of the chimeric nucleic acid sequence is identical to all or a portion of a mouse PLAUR nucleotide sequence (e.g., exon 1, a portion of exon 2, and a portion of exon 7 of the mouse PLAUR gene transcript NM_011113.4).

[0092] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a contiguous or non-contiguous nucleotide sequence) of the chimeric nucleic acid sequence described above differs from all or a portion of a human PLAUR nucleotide sequence (e.g., exon 1, a portion of exon 2, and a portion of exon 7 of the human PLAUR gene transcript NM_002659.4).

[0093] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a contiguous or non-contiguous nucleotide sequence) of the chimeric nucleic acid sequence is identical in whole or in part to a human PLAUR nucleotide sequence (e.g., a portion of exon 2, exons 3-6, and a portion of exon 7 of the human PLAUR gene transcript NM_002659.4).

[0094] In some embodiments, the chimeric nucleic acid sequence encodes at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) of the amino acid sequence that differs from all or a portion of the mouse PLAUR protein amino acid sequence (e.g., amino acids 25-327 of mouse PLAUR protein sequence NP_035243.1 (SEQ ID NO: 9)).

[0095] In some embodiments, at least a portion of the amino acid sequence (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) is identical to all or part of the amino acid sequence of a mouse PLAUR protein (e.g., amino acids 1-24 of mouse PLAUR protein sequence NP_035243.1 (SEQ ID NO: 9)).

[0096] In some embodiments, at least a portion of the amino acid sequence (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) is different from all or a portion of the amino acid sequence of a human PLAUR protein (e.g., amino acids 1-23 of the human PLAUR protein sequence NP_002650.1 (SEQ ID NO: 10)).

[0097] In some embodiments, at least a portion of the amino acid sequence (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) is identical to all or part of the amino acid sequence of a human PLAUR protein (e.g., amino acids 24-335 of human PLAUR protein sequence NP_002650.1 (SEQ ID NO: 10)).

[0098] The present invention also provides a humanized PLAUR mouse amino acid sequence, wherein the amino acid sequence comprises any one of the following groups:

[0099] A) amino acid sequences shown in SEQ ID NOs: 9, 10, and 15;

[0100] B) at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identical to the amino acid sequence of SEQ ID NO: 9, 10, or 15;

[0101] C) differs from the amino acid sequence of SEQ ID NO: 9, 10, or 15 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid; or

[0102] D) an amino acid sequence as shown in SEQ ID NO: 9, 10, or 15, including substitution, deletion, and / or insertion of one or more amino acid residues.

[0103] The present invention also provides a humanized PLAUR amino acid sequence, wherein the amino acid sequence comprises any one of the following groups:

[0104] A) the amino acid sequence shown in positions 24-335 of SEQ ID NO: 10;

[0105] B) is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO: 10, positions 24-33;

[0106] C) differs from the amino acid sequence of positions 24-33 of SEQ ID NO: 10 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid; or

[0107] D) an amino acid sequence comprising substitutions, deletions and / or insertions of one or more amino acid residues as shown in positions 24-33 of SEQ ID NO: 10.

[0108] The present invention also provides a humanized PLAUR nucleotide (eg, DNA or RNA) sequence, wherein the nucleotide sequence comprises any one of the following groups:

[0109] A) nucleic acid sequences as shown in SEQ ID NOs: 13 and 14 or nucleic acid sequences encoding humanized mouse PLAUR homologous amino acid sequences;

[0110] B) a nucleic acid sequence capable of hybridizing to the nucleotide sequences shown in SEQ ID NOs: 13 and 14 under low stringency conditions or stringent conditions;

[0111] C) a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or at least 90% homology, and 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleotide sequences set forth in SEQ ID NOs: 13 and 14;

[0112] D) the amino acid sequence it encodes is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identical to the amino acid sequence shown in SEQ ID NO: 9, 10, or 15;

[0113] E) the encoded amino acid sequence differs from the amino acid sequence of SEQ ID NO: 9, 10, or 15 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid; or

[0114] F) The amino acid sequence encoded by the amino acid sequence is the same as that shown in SEQ ID NO: 9, 10, 15, including the amino acid sequence with substitution, deletion and / or insertion of one or more amino acid residues.

[0115] The present invention further provides a humanized mouse PLAUR genomic DNA sequence, which is obtained by reverse transcription of mRNA transcribed from the humanized mouse PLAUR and is identical to or complementary to a DNA sequence homologous to the sequence shown in SEQ ID NO: 13 or 14.

[0116] PLAU

[0117] Urokinase type plasminogen activator (PLAU) is a pancreatic serine endopeptidase that is synthesized by fibroblasts, neutrophils, monocytes, epithelial cells, and tumor cells. PLAU is initially secreted into the extracellular matrix as an enzymatically inactive single-chain zymogen (pro-uPA). Once outside the cell, PLAU can be activated by binding to PLAUR on the cell membrane or by a series of proteases, such as plasmin, cathepsin B, cathepsin L, kallikrein, trypsin, and thermolysin. It is cleaved at Lys 158 into a disulfide-linked two-chain structure. This activated structure consists of an EGF-like domain, a kringle domain, and a serine-active contact domain (peptidase S1 domain). This structure serves to restrict plasminogen as a primary substrate. Activated uPA can convert plasminogen into plasmin. While plasmin degrades ECM, it can activate matrix metalloproteinases (MMPs) into active MMPs, thereby enhancing the degradation of ECM.

[0118] In the human genome, the human PLAU gene (Gene ID: 5328) contains 11 exons: exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and exon 11 (Figure 1). The nucleotide sequence of human PLAU mRNA is NM_002658.6, and the amino acid sequence of human PLAU is NP_002649.2 (SEQ ID NO: 2). Based on the nucleotide and amino acid sequences of transcript NM_002658.6 and its encoded protein NP_002649.2, the corresponding positions of each exon are as follows:

[0119] Table 3

[0120] The human PLAU gene (NCBI Gene ID: 5328) is located on chromosome 10 at positions 73909182 to 73917497 of NC_000010.11 (GRCh38.p13 (GCF_000001405.39)).The specific positions of each exon based on the nucleotide sequence of transcript NM_002658.6 are as follows: the 5′UTR is located at positions 73911132 to 73911218 and 73911525 to 73911555 of NC_000010.11, exon 1 is located at positions 73911132 to 73911218 of NC_000010.11, intron 1 is located at positions 73911219 to 73911524 of NC_000010.11, exon 2 is located at positions 73911525 to 73911612 of NC_000010.11, and intron 3 is located at positions 73911132 to 73911218 of NC_000010.11. 11613 to 73912040, exon 3 is located at NC_000010.11 positions 73912041 to 73912068, intron 3 is located at NC_000010.11 positions 73912069 to 73912214, exon 4 is located at NC_000010.11 positions 73912215 to 73912322, intron 4 is located at NC_000010.11 positions 73912323 to 73912923, exon 5 is located at NC_000010.11 positions 73912924 to 73913098, intron 5 is located at NC_000010.11 positions 73912215 to 73912322 099 to 73913289, exon 6 is located at NC_000010.11 positions 73913290 to 73913381, intron 6 is located at NC_000010.11 positions 73913382 to 73913538, exon 7 is located at NC_000010.11 positions 73913539 to 73913758, intron 7 is located at NC_000010.11 positions 73913759 to 73913979, exon 8 is located at NC_000010.11 positions 73913980 to 73914128, intron 8 is located at NC_000010.11 positions 73913412 The PLAU locus is located at positions 73914776 to 73914916 of NC_000010.11, intron 9 is located at positions 73914917 to 73915250, exon 10 is located at positions 73915251 to 73915399 of NC_000010.11, intron 10 is located at positions 73915400 to 73916388 of NC_000010.11, exon 11 is located at positions 73916389 to 73917494 of NC_000010.11, and the 3'UTR is located at positions 73916566 to 73917494 of NC_000010.11. All relevant information about the human PLAU locus can be retrieved from NCBI (Gene ID: 5328). The entire contents of which are incorporated herein by reference.

[0121] The mouse PLAU gene (Gene ID: 18792) contains 11 exons: exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and exon 11 (Figure 1). The nucleotide sequence of mouse PLAU mRNA is NM_008873.3, and the amino acid sequence of mouse PLAU is NP_032899.1 (SEQ ID NO: 1). Based on the nucleotide and amino acid sequences of transcript NM_008873.3 and its encoded protein NP_032899.1, the corresponding positions of each exon are as follows:

[0122] Table 4

[0123] The mouse PLAU gene (NCBI Gene ID: 18792) is located on chromosome 14 at positions 20886730 to 20893456 of NC_000080.7 (GRCm39 (GCF_000001635.27)).The specific positions of each exon based on the nucleotide sequence of transcript NM_008873.3 are as follows: the 5′UTR is located at positions 20886728 to 20886802 and 20887117 to 20887146 of NC_000080.7, exon 1 is located at positions 20886728 to 20886802 of NC_000080.7, intron 1 is located at positions 20886803 to 20887116 of NC_000080.7, exon 2 is located at positions 20887117 to 20887203 of NC_000080.7, and intron 3 is located at positions 20886724 to 20887146 of NC_000080.7. 677, exon 3 is located at NC_000080.7 positions 20887678 to 20887708, intron 3 is located at NC_000080.7 positions 20887709 to 20887845, exon 4 is located at NC_000080.7 positions 20887846 to 20887953, intron 4 is located at NC_000080.7 positions 20887954 to 20888580, exon 5 is located at NC_000080.7 positions 20888581 to 20888755, intron 5 is located at NC_000080.7 positions 20888756 to 20889163, exon 6 is located at NC_000080.7 positions 20887847 to 20887957. 000080.7 positions 20889164 to 20889255, intron 6 is located at positions 20889256 to 20889399 of NC_000080.7, exon 7 is located at positions 20889400 to 20889622 of NC_000080.7, intron 7 is located at positions 20889623 to 20889842 of NC_000080.7, exon 8 is located at positions 20889843 to 20889991 of NC_000080.7, intron 8 is located at positions 20889992 to 20890565 of NC_000080.7, exon 9 is located at positions 20890 The PLAU locus is located at positions 20890566 to 20890706, intron 9 is located at positions 20890707 to 20891013 of NC_000080.7, exon 10 is located at positions 20891014 to 20891162 of NC_000080.7, intron 10 is located at positions 20891163 to 20892341 of NC_000080.7, exon 11 is located at positions 20892342 to 208934534 of NC_000080.7, and the 3' UTR is located at positions 20892519 to 20893453 of NC_000080.7. All relevant information about the mouse PLAU locus can be retrieved from NCBI (Gene ID: 18792), the entire contents of which are incorporated herein by reference.

[0124] Figure 19 shows the amino acid sequence of human PLAU (NP_002649.2; SEQ ID NO: 2) and mouse PLAU (NP_032899.1; SEQ ID NO: 1). Therefore, the corresponding amino acid residues or regions between human and mouse PLAU can be found in Figure 19.

[0125] The genes, proteins, and locations of PLAU from other species are also known in the art. For example, the PLAU gene from Rattus norvegicus (rat) is identified as Gene ID: 25619, the PLAU gene from Macaca mulatta (rhesus monkey) is identified as Gene ID: 705853, the PLAU gene from Canis lupus familiaris (dog) is identified as Gene ID: 403426, and the PLAU gene from Sus scrofa (pig) is identified as Gene ID: 396985. Relevant information (e.g., intron sequences, exon sequences, and amino acid sequences) for these genes can be found in NCBI and is referenced in full.

[0126] Figure 20 shows the human PLAU amino acid sequence (NP_002649.2; SEQ ID NO: 2) and the rat PLAU amino acid sequence (NP_037217.3; SEQ ID NO: 54). Thus, in Figure 20, homologous regions of the human and rat PLAU amino acid sequences can be found.

[0127] The present invention provides a human or chimeric (e.g., humanized) PLAU nucleotide sequence and / or amino acid sequence. In some embodiments, the nucleotide sequence of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and exon 11 of the mouse PLAU gene is replaced in whole or in part by the corresponding nucleotide sequence or amino acid sequence of the human PLAU gene. In some embodiments, a "region" or "portion" of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or exon 11 of the mouse PLAU gene is replaced by the corresponding nucleotide or amino acid sequence of the human PLAU gene. The term "region" or "portion" refers to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 410, 420, 430 or 431 consecutive amino acid sequences. In some embodiments, the "region" or "portion" is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or at least 100% identical to the amino acid sequence encoded by exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10 and / or exon 11.In some embodiments, a “region,” “part,” or “entire” sequence of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or exon 11 (e.g., a portion of exon 2, all of exons 3-10, and a portion of exon 11) of a mouse PLAU gene is replaced by a “region,” “part,” or “entire” sequence of the corresponding exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or exon 11 (e.g., a portion of exon 2, all of exons 3-10, and a portion of exon 11) of a human PLAU gene.

[0128] In some embodiments, a "region" or "portion" of endogenous exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or exon 11 is deleted.

[0129] In some embodiments, the present invention provides a genetically modified non-human animal, wherein the genome of the non-human animal comprises a human, chimeric, or humanized PLAU nucleotide sequence. In some embodiments, the protein encoded by the human, chimeric, or humanized PLAU nucleotide sequence is at least 70%, 80%, 85%, 90%, 95%, or 100% identical to the amino acid sequence of SEQ ID NO: 2. In some embodiments, the genome of the non-human animal comprises a nucleotide sequence that is at least 70%, 80%, 85%, 90%, 95%, or 100% identical to the nucleotide sequence of SEQ ID NO: 3, 4, 5, 6, 7, or 8.

[0130] In some embodiments, the genetically modified non-human animals described herein comprise a nucleotide sequence encoding a human or humanized PLAU protein. In some embodiments, the human or humanized PLAU protein comprises all or part of a human PLAU protein.

[0131] In some embodiments, the genetically modified non-human animals described herein comprise a human or humanized PLAU gene. In some embodiments, the humanized PLAU gene comprises 11 exons. In some embodiments, the humanized PLAU gene comprises humanized exon 2, human exon 3, human exon 4, human exon 5, human exon 6, human exon 7, human exon 8, human exon 9, human exon 10, and / or humanized exon 11. In some implementations, the humanized PLAU gene comprises human intron 2, human intron 3, human intron 4, human intron 5, human intron 6, human intron 7, human intron 8, human intron 9, and / or human intron 10. In some embodiments, the humanized PLAU gene comprises a human or humanized 5'UTR. In some implementations, the humanized PLAU gene comprises a human or humanized 3'UTR. In some embodiments, the humanized PLAU gene comprises an endogenous 5'UTR. In some embodiments, the humanized PLAU gene comprises an endogenous 3'UTR.

[0132] In some embodiments, the genetically modified non-human animal may express human PLAU and / or chimeric (e.g., humanized)

[0133] PLAU protein, wherein the endogenous PLAU gene is replaced by a human PLAU gene and / or nucleotide sequence, and further, the human PLAU gene and / or nucleotide sequence encodes an amino acid sequence of human PLAU that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 100% identical to the amino acid sequence of human PLAU. In various embodiments, the endogenous non-human animal PLAU gene is replaced with all or part of the nucleotide sequence encoding the mature PLAU protein.

[0134] In some embodiments, the genetically modified non-human animal expresses human PLAU and / or chimeric PLAU protein (e.g., humanized PLAU) under a mouse endogenous promoter and / or regulatory elements. Replacement of the mouse endogenous locus provides a non-human animal that can express human or chimeric PLAU protein (e.g., humanized PLAU) in the same cell type. The genetically modified mice do not develop potential diseases observed in certain other transgenic mice known in the art. The human PLAU or chimeric PLAU protein expressed in the non-human animal can maintain the function of one or more wild-type or human PLAU proteins, for example, the expressed PLAU protein can bind to human or non-human PLAU proteins. Furthermore, in some embodiments, the genetically modified non-human animal does not express endogenous PLAU protein. In some embodiments, the genetically modified non-human animal has reduced expression of endogenous PLAU protein. As used herein, "endogenous PLAU protein" refers to a PLAU protein encoded by an endogenous PLAU nucleotide sequence of a non-human animal (e.g., mouse) prior to genetic modification.

[0135] The non-human animal genome comprises a nucleotide sequence encoding an amino acid that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of human PLAU protein (NP_002649.2; SEQ ID NO: 2). In some embodiments, the genome comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or at least 100% identical to the nucleotide sequences of SEQ ID NO: 7 and SEQ ID NO: 8.

[0136] The nucleotide sequence encoding the endogenous PLAU region in the non-human animal genome is replaced by the nucleotide sequence encoding the corresponding region of human PLAU. In some embodiments, the nucleotide sequence encoding the endogenous PLAU region is any sequence of the endogenous PLAU locus, such as exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, 5'UTR, 3'UTR, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, or any combination thereof. In some embodiments, the nucleotide sequence encoding the endogenous PLAU region is located within the endogenous PLAU regulatory region. In some embodiments, the nucleotide sequence encoding the endogenous PLAU region is exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 8, exon 9, exon 10 and / or exon 11, or a portion thereof, or the entire endogenous PLAU locus.

[0137] The genetically modified non-human animal has one or more cells expressing a human or chimeric PLAU protein (e.g., a humanized PLAU protein). In some embodiments, the human or chimeric PLAU protein comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 410, 420, 430, or 431 consecutive amino acids of the amino acid sequence of SEQ ID NO: 2.

[0138] In some embodiments, the genetically modified non-human animal genome comprises all or part of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or exon 11 of the human PLAU gene, or all or part of the nucleotide sequence shown in SEQ ID NO:7.

[0139] In some embodiments, the genetically modified non-human animal genome comprises a portion of exon 2, all of exons 3-10, and a portion of exon 11 of the human PLAU gene. In some embodiments, the portion of exon 2 comprises at least 5, 10, 20, 30, 40, 50, 55, 57, 60, 65, 70, 75, 80, 83, 85, 87, or 88 bp of contiguous nucleotide sequence of human PLAU gene exon 2. In some embodiments, the portion of exon 2 comprises 57 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 11 comprises at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 150, 170, 172, 173, 174, 175, 176, 177, 179, 180, 200, 500, 600, 800, 1000, 1100, or 1106 bp of contiguous nucleotide sequence of human PLAU gene exon 11. In some implementations, the portion of exon 11 comprises 177 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 11 comprises at least 50 bp or at least 100 bp of nucleotides. The portion of exon 2, all of exons 3-10, and the portion of exon 11 of the human PLAU gene comprise at least 100-500 bp, or 500-1000 bp of contiguous nucleotide sequence. In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU is located at nucleotide sequence 119-1414 of the human PLAU gene transcript NM_002658.6.

[0140] Furthermore, the genetically modified non-human animal's PLAU gene is heterozygous or homozygous for the endogenous modified locus.

[0141] In some embodiments, the humanized PLAU genome lacks the 5'UTR of the human PLAU gene. In some embodiments, the humanized PLAU genome comprises an endogenous (e.g., mouse) 5'UTR. In some embodiments, the humanized PLAU genome comprises an endogenous (e.g., mouse) 3'UTR. Where appropriate, based on the similarity of the 5' flanking sequences, it is reasonable to infer that the mouse and human PLAU genes are similarly regulated. As described herein, humanized PLAU mice comprise a replacement of an endogenous mouse locus that retains mouse endogenous regulatory elements but includes a humanized PLAU coding sequence. PLAU expression is completely normal in genetically modified heterozygous or homozygous mice.

[0142] In another aspect, the present invention provides a genetically modified non-human animal, the genome of which comprises a deletion of an endogenous PLAU gene, wherein the deletion of the endogenous PLAU gene comprises exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10 and / or exon 11, or a portion of the endogenous PLAU locus.

[0143] In some embodiments, the deletion of the endogenous PLAU gene comprises one or more exons or portions of exons selected from exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10 and / or a portion of exon 11.

[0144] In some embodiments, the endogenous PLAU gene deletion further comprises one or more or introns or portions of introns selected from the group consisting of partial deletions of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, and / or intron 10 of the PLAU gene.

[0145] In some embodiments, the deletion comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 700, 900, 1000, 1100, 1200, 1250, 1290, 1291, 2192, 1293, 1294, 1295, 1296, 1297, 1298, 1299, 1300, 1500, 1700, 1800, 2000, 2200, 2300, 2320, 2340, 2341, 2342, 2343 bp of continuous nucleotide sequence or more.

[0146] In some embodiments, the deletion of the endogenous PLAU gene comprises at least 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1301 or 1302 bp of contiguous nucleotide sequence or more of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10 and / or exon 11 (e.g., deletion of at least 20 bp of contiguous nucleotide sequence of exon 2, all of exons 3-10, at least 100 bp of contiguous nucleotide sequence of exon 11).

[0147] The present invention provides a humanized mouse PLAU genomic DNA sequence, a construct expressing a humanized PLAU protein amino acid sequence, a cell comprising the construct, and a tissue comprising the cell.

[0148] Therefore, in some embodiments, the present invention provides a chimeric (e.g., humanized) PLAU nucleotide sequence and / or amino acid sequence, wherein in some embodiments, the chimeric nucleotide sequence is fused to mouse endogenous PLAU mRNA (e.g., NM_008873.3), mouse PLAU amino acid sequence (e.g., NP_032899.1, SEQ ID NO: 1) or a portion thereof (e.g., 5' UTR, all of exon 1, a portion of exon 2, a portion of exon 11, and 3' UTR) is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence shown in FIG. In some embodiments, the chimeric nucleotide sequence is conjugated to a human PLAU mRNA (e.g., NM_002658.6), a human PLAU amino acid sequence (e.g., NP_002649.2, SEQ ID NO: 2), or a portion thereof (e.g., a portion of exon 2, exons 3-10, and a portion of exon 11).

[0149] In some embodiments, the chimeric nucleic acid sequence described above is operably linked to a promoter or regulatory element, for example, an endogenous mouse PLAU promoter, an inducible promoter, an enhancer, and / or mouse or human regulatory elements.

[0150] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a contiguous or non-contiguous nucleotide sequence) of the chimeric nucleic acid sequence described above differs from all or a portion of a mouse PLAU nucleotide sequence (e.g., a portion of exon 2, exons 3-10, and a portion of exon 11 of the mouse PLAUR gene transcript NM_008873.3).

[0151] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a contiguous or non-contiguous nucleotide sequence) of the chimeric nucleic acid sequence is identical to all or part of a mouse PLAU nucleotide sequence (e.g., exon 1, a portion of exon 2, and a portion of exon 11 of mouse PLAU gene transcript NM_008873.3).

[0152] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a contiguous or non-contiguous nucleotide sequence) of the chimeric nucleic acid sequence described above is different from all or part of a human PLAU nucleotide sequence (e.g., a portion of exon 1, exon 2, and a portion of exon 11 of the human PLAUR gene transcript NM_002658.6).

[0153] In some embodiments, at least a portion of the chimeric nucleic acid sequence (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a continuous or non-contiguous nucleotide sequence) is identical in whole or in part to a human PLAU nucleotide sequence (e.g., a portion of exon 2, exons 3-10, and a portion of exon 11 of the human PLAU gene transcript NM_002658.6).

[0154] In some embodiments, the chimeric nucleic acid sequence encodes at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) of the amino acid sequence of a mouse PLAU protein (e.g., amino acids 1-433 of mouse PLAU protein sequence NP_032899.1 (SEQ ID NO: 1)).

[0155] In some embodiments, at least a portion of the amino acid sequence (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) differs from all or a portion of the amino acid sequence of a human PLAU protein (e.g., amino acids 1-431 of human PLAU protein sequence NP_002649.2 (SEQ ID NO: 2)).

[0156] The present invention also provides a humanized PLAU mouse amino acid sequence, wherein the amino acid sequence comprises any one of the following groups:

[0157] A) amino acid sequence shown in SEQ ID NO: 2;

[0158] B) is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identical to the amino acid sequence of SEQ ID NO: 2;

[0159] C) differs from the amino acid sequence of SEQ ID NO: 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid; or

[0160] D) an amino acid sequence as shown in SEQ ID NO: 2, including substitution, deletion and / or insertion of one or more amino acid residues.

[0161] The present invention also provides a humanized PLAU nucleotide (eg, DNA or RNA) sequence, wherein the nucleotide sequence comprises any one of the following groups:

[0162] A) nucleic acid sequences as shown in SEQ ID NOs: 7 and 8 or nucleic acid sequences encoding humanized mouse PLAUR homologous amino acid sequences;

[0163] B) a nucleic acid sequence capable of hybridizing to the nucleotide sequences shown in SEQ ID NOs: 7 and 8 under low stringency conditions or stringent conditions;

[0164] C) a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or at least 90% homology to the nucleotide sequence of SEQ ID NOs: 7 and 8, which is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical;

[0165] D) the amino acid sequence it encodes is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identical to the amino acid sequence set forth in SEQ ID NO: 2;

[0166] E) the encoded amino acid sequence differs from the amino acid sequence of SEQ ID NO: 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid; or

[0167] F) The encoded amino acid sequence is the same as that shown in SEQ ID NO: 2, including the amino acid sequence in which one or more amino acid residues are substituted, deleted and / or inserted.

[0168] The present invention further provides a humanized mouse PLAU genomic DNA sequence, which is obtained by reverse transcription of mRNA transcribed from the DNA sequence and is identical to or complementary to a DNA sequence homologous to the sequence shown in SEQ ID NO: 7 or 8.

[0169] Genetically modified non-human animals

[0170] The “genetically modified non-human animal” described in the present invention refers to a non-human animal in which at least one chromosome in the animal genome has exogenous DNA. In some embodiments, at least one or more cells, for example, at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50% of the cells in the genetically modified non-human animal have exogenous DNA. The cells with exogenous DNA can be various cells, for example, endogenous cells, somatic cells, immune cells, T cells, B cells, NK cells, antigen presenting cells, macrophages, dendritic cells, germ cells, blastocysts or endogenous tumor cells. In some embodiments, a genetically modified non-human animal is provided, which comprises endogenous PLAU and / or PLAUR loci and exogenous PLAU and / or PLAUR loci (e.g., human sequences), for example, replacing one or more non-human sequences with one or more human sequences, or inserting one or more human and / or non-human sequences. Animals are generally able to pass the modification to offspring through germline transmission.

[0171] The "chimeric gene" or "chimeric nucleic acid" of the present invention refers to a gene or nucleic acid, wherein two or more parts of the gene or nucleic acid are from different species, or at least one sequence of the gene or nucleic acid is different from the wild-type nucleic acid in the animal. In some embodiments, the chimeric gene or chimeric nucleic acid has at least a portion of the sequence having two or more different species origins, for example, sequences encoding different proteins or sequences encoding the same (or homologous) proteins of two or more different species. In some embodiments, the chimeric gene or chimeric nucleic acid refers to a humanized gene or humanized nucleic acid.

[0172] As used herein, a "chimeric protein" or "chimeric polypeptide" refers to a protein or polypeptide in which two or more portions of the polypeptide or protein are derived from different species, or at least one sequence of the protein or polypeptide differs from the wild-type amino acid sequence in an animal. In some embodiments, at least a portion of the sequence of a chimeric protein or chimeric polypeptide is derived from two or more different species, for example, the same (or homologous) proteins from different species. In some embodiments, a chimeric protein or chimeric polypeptide is a humanized protein or polypeptide.

[0173] The "humanized protein" or "humanized polypeptide" of the present invention refers to a protein or polypeptide, wherein at least a portion of the protein or polypeptide is derived from a human protein or polypeptide. In some embodiments, the humanized protein or humanized protein refers to a human protein or polypeptide.

[0174] As used herein, a "humanized nucleic acid" refers to a nucleic acid wherein at least a portion of the nucleic acid is derived from human nucleic acid. In some embodiments, the nucleic acid in the humanized nucleic acid is entirely human in origin. In some embodiments, the humanized nucleic acid refers to humanized exons, which can be human exons or chimeric exons.

[0175] In some embodiments, the chimeric gene or chimeric nucleic acid is a humanized PLAU gene or humanized PLAU nucleic acid. In some embodiments, at least a portion of the gene or nucleic acid is derived from a human PLAU gene, or at least a portion of the gene or nucleic acid is derived from a non-human PLAU gene. In some embodiments, the gene or nucleic acid comprises a sequence encoding a PLAU protein. The encoded PLAU protein exhibits at least one activity of a human PLAU or non-human PLAU protein function, such as interacting with a PLAUR receptor to induce downstream signaling pathways.

[0176] In some embodiments, the chimeric gene or chimeric nucleic acid is a humanized PLAUR gene or humanized PLAUR nucleic acid. In some embodiments, at least a portion of the gene or nucleic acid is derived from a human PLAUR gene, or at least a portion of the gene or nucleic acid is derived from a non-human PLAUR gene. In some embodiments, the gene or nucleic acid comprises a sequence encoding a PLAUR protein. The encoded PLAUR protein has at least one activity of a human PLAUR or non-human PLAUR protein function. For example, it interacts with a PLAU ligand to induce a downstream signaling pathway.

[0177] In some embodiments, the chimeric protein or polypeptide is a humanized PLAU protein or humanized PLAU polypeptide. In some embodiments, at least a portion of the amino acid sequence of the polypeptide or protein is derived from a human PLAU protein, or at least a portion of the amino acid sequence of the protein or polypeptide is derived from a non-human PLAU protein. The humanized PLAU protein or humanized PLAU polypeptide has at least one activity of a human PLAU protein or a non-human PLAU protein function, such as interacting with a PLAU receptor to induce a downstream signaling pathway.

[0178] In some embodiments, the chimeric protein or chimeric polypeptide is a humanized PLAUR protein or humanized PLAUR polypeptide. In some embodiments, at least a portion of the amino acid sequence of the protein or polypeptide is derived from a human PLAUR protein, or at least a portion of the amino acid sequence of the protein or polypeptide is derived from a non-human PLAUR protein. The humanized PLAUR protein or humanized PLAUR polypeptide has at least one activity of a human PLAUR protein or non-human PLAUR protein function. For example, it interacts with a PLAUR ligand to induce a downstream signaling pathway.

[0179] The non-human animal of genetic modification can be various animals, for example, mouse, rat, rabbit, pig, cattle (for example, cattle, bull, buffalo), deer, sheep, goat, chicken, cat, dog, ferret, primate (for example, marmoset, rhesus monkey).For the non-human animal of suitable genetically modified embryonic stem cell (ES) that is not easy to obtain, adopt alternative methods to construct the non-human animal comprising genetic modification.Such method includes, for example, modifying non-ES cell genome (for example, fibroblast or induced pluripotent stem cell) and adopting nuclear transplantation to transfer the modified genome to suitable cell, for example oocyte, and incubating the modified cell (for example, modified oocyte) to form embryo in non-human animal under appropriate conditions.Above-mentioned construction method is known in the art, and is described in " A.Nagy, et al., " Manipulating the Mouse Embryo:A Laboratory Manual (Third Edition), " Cold Spring Harbor Laboratory Press, 2003 ", its entire contents are incorporated herein by reference.

[0180] In one aspect, the animal is a mammal. In some embodiments, the genetically modified non-human animal is a rodent. The rodent can be selected from a mouse, a rat, and a hamster. In one embodiment, the rodent is selected from the family Muridae. In one embodiment, the genetically modified animal is from a family selected from the family Cricetidae (e.g., mouse-like hamsters), Cricetidae (e.g., hamsters, New World rats and mice, voles), Muroidea (true mice and rats, gerbils, spiny mice, crested rats), Malinomys (climbing mice, rock mice, tailed rats, Madagascar rats, and mice), Spiny Mouse (e.g., spiny dormouse), and Muridae (e.g., mole rats, bamboo rats, and zokors). In a specific embodiment, the genetically modified rodent is selected from a true mouse or rat (Muroidea), gerbils, spiny mice, and crested rats. In one embodiment, the genetically modified mouse is from a member of the Muridae family. In one embodiment, the animal is a rodent. In a specific embodiment, the rodent is selected from mice and rats. In one embodiment, the non-human animal is a mouse.

[0181] In a specific embodiment, the non-human animal is a mouse selected from the group consisting of BALB / c, A, A / He, A / J, A / WySN, AKR, AKR / A, AKR / J, AKR / N, TA1, TA2, RF, SWR, C3H, C57BR, SJL, C57L, DBA / 2, KM, NIH, ICR, CFW, FACA, C57BL / A, C57BL / An, C57BL / GrFa, C 57BL / KaLwN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr and C57BL / Ola of C57BL, C58, CBA / Br, CBA / Ca, CBA / J, CBA / st, CBA / H strains and NOD, NOD / SCID, NOD-Prkdc scid IL-2rg null Background of mice.

[0182] Genetically modified non-human animals include modifications of endogenous non-human PLAU and / or PLAUR gene loci. In some embodiments, the modifications comprise a nucleotide sequence encoding at least a portion of a mature PLAU or PLAUR protein (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identity to a mature PLAU or PLAUR protein amino acid sequence). Although cells (e.g., ES cells, somatic cells) that may comprise the genetic modifications described herein are provided herein, in many embodiments, the genetically modified non-human animals include modifications of endogenous PLAU and / or PLAUR gene loci in the animal.

[0183] The present invention further provides a non-human mammal constructed using the above method. In some embodiments, the non-human mammal comprises a human genome. In some embodiments, the non-human mammal is a rodent. Further preferably, the rodent is a mouse. In some embodiments, the non-human mammal expresses a protein encoded by a humanized PLAU and / or PLAUR gene.

[0184] In addition, the present invention also provides a non-human mammal carrying a tumor, characterized in that the non-human mammal model is obtained by the method described herein. In some embodiments, the non-human mammal is a rodent (eg, mouse).

[0185] The present invention also provides a cell or cell line, or a primary cell culture, which is derived from a non-human mammal or its offspring, or a non-human mammal carrying a tumor, a tissue, an organ or a culture thereof derived from a non-human mammal or its offspring, or a non-human mammal carrying a tumor, and a tumor tissue derived from a non-human mammal or its offspring when it carries a tumor, or a tumor carrying a non-human mammal.

[0186] The present invention provides a non-human mammal produced by any of the methods described herein. In some embodiments, a non-human mammal, a genetically modified non-human animal, wherein the genome of the genetically modified non-human animal comprises human or humanized PLAU and / or PLAUR DNA.

[0187] In some embodiments, a non-human mammal comprises a genetic construct described herein (e.g., a genetic construct as shown in Figures 2, 3, 4, 5, 9, 10, 11, and 12). In some embodiments, a non-human mammal expressing a human or humanized PLAU and / or PLAUR protein is provided. In some embodiments, tissue-specific expression of a human or humanized PLAU and / or PLAUR protein is provided.

[0188] In some embodiments, the expression of non-human animal or humanized PLAU and / or PLAUR proteins is controllable. For example, by adding a specific inducer or repressor. In some embodiments, the specific inducer is selected from the tetracycline system (Tet-Off System / Tet-On System) or the tamoxifen system (Tamoxifen System).

[0189] The non-human mammal can be any non-human animal known in the art that can be used in the methods described herein. Preferred non-human mammals are mammals (e.g., rodents). In some embodiments, the non-human mammal is a mouse.

[0190] The non-human mammal described above is subjected to genetic, molecular and behavioral analysis. The present invention provides offspring produced by mating with a non-human mammal of the same genotype or another genotype.

[0191] The present invention provides a cell line or primary cell culture derived from a non-human mammal or its progeny. For example, a cell culture-based model can be prepared by the following methods. The cell culture can be obtained by isolation from the non-human mammal, or cells can be obtained by using the same construct and establishing a cell culture using standard cell transfection techniques. Integration of a genetic construct comprising a DNA sequence encoding a human PLAU and / or PLAUR protein can be detected by a variety of methods.

[0192] There are many analytical methods that can be used to detect exogenous DNA, including nucleic acid level methods (including the use of reverse transcription-polymerase chain reaction (RT-PCR) or Southern Blot and in situ hybridization) and protein level methods (including histochemical analysis, immunoblotting analysis and in vitro binding studies). In addition, the expression level of the target gene can be quantified by the ELSA method well known to those skilled in the art. Many standard analytical methods can be used to perform quantitative detection. For example, RT-PCR and hybridization methods can be used to detect transcription levels, including RNase protection assays, Southern Blots, and RNA dot hybridization analysis (RNAdot). Immunohistochemical staining, flow cytometry, and Western blots can also be used to detect the presence of human or humanized PLAU and / or PLAUR proteins.

[0193] In some embodiments, the genetically modified non-human animals described herein have two or more humanized genes, wherein the humanized genes can be selected from human or humanized genes of PLAU and / or PLAUR.

[0194] carrier

[0195] The present invention provides a targeting vector targeting the PLAU gene, comprising: a) a DNA fragment homologous to the 5' end of the switch region to be changed, which is selected from the genomic DNA of the PLAU gene of a non-human animal and has a length of 100-10,000 nucleotides; b) a DNA sequence encoding a donor region; c) a DNA fragment homologous to the 3' end of the switch region to be changed, which is selected from the genomic DNA of the PLAU gene of a non-human animal and has a length of 100-10,000 nucleotides.

[0196] In some embodiments, a) the DNA fragment homologous to the 5' end of the switch region to be altered is selected from a nucleotide sequence having at least 90% homology to NCBI Accession No. NC_000080.7; c) the DNA fragment homologous to the 3' end of the switch region to be altered is selected from a nucleotide sequence having at least 90% homology to NCBI Accession No. NC_000080.7;

[0197] In some embodiments, a) a DNA fragment homologous to the 5' end of the switch region to be altered is selected from nucleotides 20883305 to 20887146 of NCBI Accession No. NC_000080.7; c) a DNA fragment homologous to the 3' end of the switch region to be altered is selected from nucleotides 20893778 to 20896948 of NCBI Accession No. NC_000080.7;

[0198] In some embodiments, a) a DNA fragment homologous to the 5' end of the switch region to be altered is selected from nucleotides 20885866 to 20887146 of NCBI Accession No. NC_000080.7; c) a DNA fragment homologous to the 3' end of the switch region to be altered is selected from nucleotides 20892519 to 20893251 of NCBI Accession No. NC_000080.7;

[0199] In some embodiments, the length of the genomic nucleotide sequence selected for the targeting vector can exceed about 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 5.5 kb, 6 kb, 6.5 kb, 7 kb, 7.5 kb, 8 kb, 8.5 kb, 9 kb, 9.5 kb or 10 kb.

[0200] In some embodiments, the switch region to be altered is located on exons 1 to 11 of the PLAU gene of a non-human animal.

[0201] In some embodiments, the switch region to be altered is located on exons 2 to 11 of the PLAU gene of a non-human animal (eg, positions 104-1405 of NM_008873.3).

[0202] In some embodiments, the targeting vector further comprises one or more marker genes. For example, a positive screening marker gene or a negative screening marker gene. In some embodiments, the resistance gene for positive clone screening is a neomycin phosphotransferase coding sequence Neo. In some embodiments, the coding gene for the negative screening marker is a gene encoding the diphtheria toxin A subunit (DTA).

[0203] In some embodiments, the 5' arm sequence is the nucleotide sequence shown in SEQ ID NO: 3, and the 3' arm sequence is the nucleotide sequence shown in SEQ ID NO: 4. In some embodiments, the 5' arm sequence is the nucleotide sequence shown in SEQ ID NO: 5, and the 3' arm sequence is the nucleotide sequence shown in SEQ ID NO: 6.

[0204] In some embodiments, the 5' arm comprises a nucleotide sequence that is at least 90% homologous to NCBI Accession No. NC_000080.7, and more preferably, the 5' arm sequence comprises the nucleotide sequence set forth in SEQ ID NO: 3 or 5. In some embodiments, the 3' arm comprises a nucleotide sequence that is at least 90% homologous to NCBI Accession No. NC_000080.7, and more preferably, the 3' arm sequence comprises the nucleotide sequence set forth in SEQ ID NO: 4 or 6.

[0205] In some embodiments, the targeting vector comprises a human sequence (e.g., NM_002658.6119-1414). For example, the targeting region in the targeting vector includes: a partial or complete nucleotide sequence of the human PLAU gene, preferably exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or exon 11 of the human PLAU gene. In some embodiments, the nucleotide sequence of the humanized PLAU gene encodes all or part of the nucleotide sequence of the human PLAU protein, and the NCBI protein number is NP_002649.2 (SEQ ID NO: 2).

[0206] The present invention provides a targeting vector targeting the PLAUR gene, comprising: a) a DNA fragment homologous to the 5' end of the switch region to be changed, which is selected from the genomic DNA of the PLAUR gene of a non-human animal and has a length of 100-10,000 nucleotides; b) a DNA sequence encoding a donor region; c) a DNA fragment homologous to the 3' end of the switch region to be changed, which is selected from the genomic DNA of the PLAUR gene of a non-human animal and has a length of 100-10,000 nucleotides.

[0207] In some embodiments, a) the DNA fragment homologous to the 5' end of the switch region to be altered is selected from a nucleotide sequence having at least 90% homology to NCBI Accession No. NC_000073.7; c) the DNA fragment homologous to the 3' end of the switch region to be altered is selected from a nucleotide sequence having at least 90% homology to NCBI Accession No. NC_000073.7;

[0208] In some embodiments, a) a DNA fragment homologous to the 5' end of the switch region to be altered is selected from nucleotides 24159210 to 24164569 of NCBI Accession No. NC_000073.7; c) a DNA fragment homologous to the 3' end of the switch region to be altered is selected from nucleotides 24174897 to 24178233 of NCBI Accession No. NC_000073.7;

[0209] In some embodiments, the length of the genomic nucleotide sequence selected for the targeting vector can exceed about 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 5.5 kb, 6 kb, 6.5 kb, 7 kb, 7.5 kb, 8 kb, 8.5 kb, 9 kb, 9.5 kb, or 10 kb.

[0210] In some embodiments, the switch region to be altered is located on exons 1 to 7 of the PLAUR gene of a non-human animal.

[0211] In some embodiments, the switch region to be altered is located on exons 2 to 7 of the PLAUR gene of a non-human animal (eg, positions 100-1011 of NM_011113.4).

[0212] In some embodiments, the targeting vector further comprises one or more marker genes. For example, a positive screening marker gene or a negative screening marker gene. In some embodiments, the resistance gene for positive clone screening is a neomycin phosphotransferase coding sequence Neo. In some embodiments, the coding gene for the negative screening marker is a gene encoding the diphtheria toxin A subunit (DTA).

[0213] In some embodiments, the 5' arm sequence is the nucleotide sequence shown in SEQ ID NO: 11; and the 3' arm sequence is the nucleotide sequence shown in SEQ ID NO: 12.

[0214] In some embodiments, the 5' arm comprises nucleotides that are at least 90% homologous to NCBI Accession No. NC_000073.7, and more preferably, the 5' arm sequence comprises the nucleotide sequence set forth in SEQ ID NO: 11. In some embodiments, the 3' arm comprises nucleotides that are at least 90% homologous to NCBI Accession No. NC_000073.7, and more preferably, the 3' arm sequence comprises the nucleotide sequence set forth in SEQ ID NO: 12.

[0215] In some embodiments, the targeting vector comprises a human sequence (e.g., positions 119-1057 of NM_002659.4). For example, the targeting region in the targeting vector comprises a portion or all of the nucleotide sequence of a human PLAUR gene, preferably a portion of exon 2, all of exons 3-6, and / or a portion of exon 7 of a human PLAUR gene. In some embodiments, the human sequence is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequences shown in SEQ ID NOs: 7 and 8; in some embodiments, the nucleotide sequence of the humanized PLAUR gene encodes all or part of the nucleotide sequence of the human PLAUR protein, and the NCBI protein number is NP_002650.1 (SEQ ID NO: 10).

[0216] The present disclosure also relates to cells comprising the targeting vector described above.

[0217] In addition, the present invention also provides a non-human mammalian cell having any one of the above-mentioned targeting vectors and one or more in vitro transcripts of the constructs described herein. In some embodiments, the cell comprises Cas9 mRNA or its in vitro transcript.

[0218] In some embodiments, the cell is heterozygous for the gene. In some embodiments, the cell is homozygous for the gene.

[0219] In some embodiments, the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell. In some embodiments, the cell is an embryonic stem cell.

[0220] Method for constructing genetically modified non-human animals

[0221] Genetically modified non-human animals can be prepared by several techniques known in the art, including gene targeting technology using embryonic stem cells, CRISPR / Cas9 technology, zinc finger nuclease technology, transcription activator-like effector nuclease technology, homing endonuclease or other molecular biology techniques. In some embodiments, homologous recombination technology is preferably used. In some embodiments, CRISPR / Cas9 gene editing technology can construct genetically modified non-human animals. In some embodiments, CRISPR-Cas9 genome editing is used to produce genetically modified non-human animals. Many of these genome editing technologies are known in the art and are described in “Delivery technologies for genome editing,” Nature Reviews Drug Discovery 16.6 (2017): 387-399, by Yin et al., which are all incorporated by reference. The present invention also provides many other methods for genome editing, for example, microinjecting transgenic cells into enucleated oocytes and fusing the enucleated oocytes with another transgenic cell.

[0222] In some embodiments, the nucleotide sequence encoding the endogenous PLAU region in the endogenous genome of at least one cell of the non-human animal is replaced with a nucleotide sequence encoding the corresponding region of human PLAU. In some embodiments, the non-human animal's endogenous PLAU protein is expressed at a reduced level or is absent compared to wild-type PLAU. In some embodiments, the replacement occurs in a germ cell, somatic cell, blastocyst, or fibroblast. The nucleus of a somatic cell or fibroblast can be inserted into an enucleated oocyte.

[0223] Figures 3 and 5 illustrate a humanized targeting strategy for the mouse PLAU locus. The targeting vector comprises a 5' homology arm, a human or humanized PLAU gene fragment, and a 3' homology arm. This process involves replacing the endogenous PLAU sequence with the human or humanized sequence using homologous recombination. In some embodiments, cleavage upstream and downstream of the target site (e.g., by zinc finger nucleases, TALENs, or CRISPR) results in DNA double-strand breaks, which allow homologous recombination to replace the mouse endogenous PLAU sequence with the human or humanized PLAU sequence.

[0224] In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU comprises all or part of the nucleotide sequence encoding the human PLAU protein, preferably, comprises the entire nucleotide sequence encoding the human PLAU protein.

[0225] In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU comprises a nucleotide sequence encoding at least 50 to at least 431, preferably 50, 100, 150, 200, 250, 300, 350, 400, 410, 420, 425, 428, 429, 430 or 431 consecutive amino acids of human PLAU protein; further comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2; or, comprises a nucleotide sequence encoding a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identical to the amino acid sequence of SEQ ID NO: 2; or, comprises a nucleotide sequence encoding a nucleotide sequence that differs from the amino acid sequence of SEQ ID NO: 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or, comprises a nucleotide sequence encoding a nucleotide sequence that is identical to the amino acid sequence of SEQ ID NO: 2. The nucleotide sequence shown in the amino acid sequence shown in NO:2 includes substitution, deletion and / or insertion of one or more amino acids.

[0226] In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU comprises all or part of exon 1 to exon 11 of the human PLAU gene, further preferably comprises all or part of one, two or more, or a combination of two or more consecutive exons of exon 1 to exon 11 of the human PLAU gene, more preferably comprises all or part of exon 2 to exon 11 of the human PLAU gene, further preferably comprises part of exon 2, all of exons 3-10, and part of exon 11 of the human PLAU gene, preferably further comprises intron 2 and / or intron 10, wherein the portion of exon 2 of the human PLAU gene comprises at least 20 bp to at least 88 bp of exon 2 of the human PLAU gene, preferably 20, 30, 40, 50, 55, 56, or more. , 57, 58, 59, 60, 70, 80 or 88 bp continuous nucleotide sequence, or, the portion of human PLAU gene exon 2 includes the nucleotide sequence of the coding region, the portion of human PLAU gene exon 11 includes at least 50 bp to at least 1106 bp of human PLAU gene exon 11, preferably 50, 100, 150, 170, 175, 176, 177, 178, 179, 180, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100 or 1106 bp continuous nucleotide sequence, or, the portion of human PLAU gene exon 11 includes the nucleotide sequence of the coding region.

[0227] In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU comprises the nucleotide sequence set forth in SEQ ID NO: 7; or, comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identical to the nucleotide sequence set forth in SEQ ID NO: 7; or, comprises a nucleotide sequence that differs from the nucleotide sequence set forth in SEQ ID NO: 7 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 nucleotide; or, comprises a nucleotide sequence having a nucleotide sequence set forth in SEQ ID NO: 7, including substitutions, deletions and / or insertions of one or more nucleotides.

[0228] In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAU is operably linked to an endogenous regulatory element of an endogenous PLAU gene in at least one chromosome.

[0229] In some embodiments, the replaced endogenous PLAU nucleotide sequence in a non-human animal includes all or part of exon 1 to exon 11 of the mouse PLAU gene, preferably all or part of exon 2 to exon 11 of the non-human animal PLAU gene. More preferably, part of exon 2, all of exons 3-10, and part of exon 11 of the non-human animal PLAU gene are replaced. In some embodiments, the replaced endogenous PLAU nucleotide sequence encodes the amino acid sequence set forth in SEQ ID NO: 1.

[0230] In some embodiments, the human or humanized PLAU gene is regulated in a non-human animal by a regulatory element, including but not limited to an endogenous promoter. For example, the regulatory element can be endogenous or exogenous. In one embodiment of the present invention, the endogenous regulatory element is derived from a non-human animal PLAU gene, while the exogenous regulatory element is derived from a human PLAU gene.

[0231] In a specific embodiment of the present invention, the construction method comprises replacing all or part of exons 1 to exon 11 of a non-human animal PLAU gene with all or part of exons 1 to exon 11 of a human PLAU gene, preferably replacing all or part of exons 2 to exon 11 of a non-human animal PLAU gene with all or part of exons 2 to exon 11 of a human PLAU gene.

[0232] In a specific embodiment of the present invention, the construction method comprises replacing all or part of exons 2 to exon 11 of a non-human animal PLAU gene with a portion of exon 2, all of exons 3-10, and a portion of exon 11 of a human PLAU gene, preferably also comprising intron 2 and / or intron 9.

[0233] In a specific embodiment of the present invention, the construction method comprises replacing the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 1 in the genome of a non-human animal with a nucleotide sequence encoding a human or humanized PLAU protein, or a nucleotide sequence of a human or humanized PLAU gene.

[0234] In a specific embodiment of the present invention, the construction method comprises replacing the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 1 in the genome of a non-human animal with a genomic DNA sequence, cDNA sequence or CDS sequence comprising the human PLAU gene.

[0235] In a specific embodiment of the present invention, the construction method comprises replacing the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 1 in the genome of a non-human animal with a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 2.

[0236] In a specific embodiment of the present invention, the construction method comprises replacing the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 1 in the genome of a non-human animal with the nucleotide sequence shown in SEQ ID NO: 7.

[0237] In some embodiments, the nucleotide sequence encoding the endogenous PLAUR region in the genome of at least one cell of the non-human animal is replaced with a nucleotide sequence encoding the corresponding region of human PLAUR. In some embodiments, expression of the endogenous PLAUR protein in the non-human animal is reduced or absent. In some embodiments, the replacement occurs in a germ cell, a somatic cell, a blastocyst, or a fibroblast. The nucleus of a somatic cell or fibroblast can be inserted into an enucleated oocyte.

[0238] Figure 11 shows a humanized targeting strategy for mouse PLAUR. The targeting vector includes a 5' homology arm, a human or humanized PLAUR gene fragment, and a 3' homology arm. The process involves using homologous recombination to replace the endogenous corresponding PLAUR sequence with the human or humanized sequence. In some embodiments, cleavage upstream and downstream of the target site (e.g., by zinc finger nucleases, TALENs, or CRISPR) can result in DNA double-strand breaks, and homologous recombination is used to replace the mouse endogenous PLAUR sequence with the human or humanized PLAUR sequence.

[0239] In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAUR comprises all or part of the nucleotide sequence encoding human PLAU protein, preferably comprises the nucleotide sequence encoding human PLAUR protein DI, DII and DIII.

[0240] In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAUR comprises a nucleotide sequence encoding all or part of a human PLAUR protein, further preferably, comprising a nucleotide sequence encoding at least 50 to at least 335, preferably 50, 100, 150, 200, 250, 300, 310, 311, 312, 313, 314, 320, 330 or 335 consecutive amino acids of a human PLAUR protein, and even more preferably, comprising a nucleotide sequence encoding the amino acid sequence as shown at positions 24-335 of SEQ ID NO: 10; or, comprising a nucleotide sequence encoding an amino acid sequence at positions 24-335 of SEQ ID NO: 10 that is at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identical to the amino acid sequence as shown at positions 24-335 of SEQ ID NO: 10; or, comprising a nucleotide sequence encoding an amino acid sequence at positions 24-335 of SEQ ID NO: 10 that is at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identical to the amino acid sequence as shown at positions 24-335 of SEQ ID NO: 10; A nucleotide sequence that differs from the amino acid sequence shown at positions 24-335 of NO: 10 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or, a nucleotide sequence that encodes the amino acid sequence shown at positions 24-335 of SEQ ID NO: 10, including substitutions, deletions and / or insertions of one or more amino acids.

[0241] In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAUR comprises all or part of exon 1 to exon 7 of the human PLAUR gene, preferably comprises all or part of one, two or more, or a combination of two or more consecutive exons of exon 1 to exon 7 of the human PLAUR gene, further preferably comprises all or part of exon 1 to exon 7 of the human PLAUR gene, more preferably comprises part of exon 2 of the human PLAUR gene, all of exons 3-6 and part of exon 7, preferably further comprises introns 2-3 and / or introns 6-7, wherein the portion of exon 2 of the human PLAUR gene comprises exon 2 of the human PLAUR gene. At least 20 bp to at least 111 bp, preferably 20, 30, 40, 50, 60, 70, 80, 90, 95, 96, 97, 98, 99, 100, 110 or 111 bp continuous nucleotide sequence, the portion of human PLAUR gene exon 7 comprises a human PLAUR gene exon 7 of at least 50 bp to at least 565 bp, preferably 50, 100, 150, 200, 250, 252, 253, 254, 255, 256, 300, 350, 400, 450, 500, 550, 560 or 565 bp continuous nucleotide sequence, or the portion of human PLAUR gene exon 7 comprises the nucleotide sequence of the coding region.

[0242] In a specific embodiment of the present invention, the nucleotide sequence encoding the corresponding region of human PLAUR comprises the nucleotide sequence shown in SEQ ID NO: 13; or, comprises a nucleotide sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identical to the nucleotide sequence shown in SEQ ID NO: 13; or, comprises a nucleotide sequence that differs from the nucleotide sequence shown in SEQ ID NO: 13 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 nucleotides; or, comprises a nucleotide sequence shown in the nucleotide sequence shown in SEQ ID NO: 13, including substitutions, deletions and / or insertions of one or more nucleotides.

[0243] In some embodiments, the nucleotide sequence encoding the corresponding region of human PLAUR is operably linked to an endogenous regulatory element of an endogenous PLAUR gene in at least one chromosome.

[0244] In some embodiments, the replaced endogenous PLAUR nucleotide sequence in a non-human animal includes all or part of exon 1 to exon 7 of the mouse PLAUR gene, preferably all or part of exon 2 to exon 7 of the non-human animal PLAU gene. More preferably, part of exon 2, all of exons 3 to 6, and part of exon 7 of the non-human animal PLAU gene are replaced. In some embodiments, the replaced endogenous PLAUR nucleotide sequence encodes the nucleotide sequence of the amino acid sequence shown at positions 25-327 of SEQ ID NO: 9.

[0245] In some embodiments, the human or humanized PLAUR gene is regulated in a non-human animal by a regulatory element, including but not limited to an endogenous promoter. For example, the regulatory element can be endogenous or exogenous. In one embodiment of the present invention, the endogenous regulatory element is derived from a non-human animal PLAUR gene. The exogenous regulatory element is derived from a human PLAUR gene.

[0246] In a specific embodiment of the present invention, the construction method comprises replacing all or part of exons 1 to exon 7 of a non-human animal PLAUR gene with all or part of exons 1 to exon 7 of a human PLAUR gene, preferably replacing all or part of exons 2 to exon 7 of a non-human animal PLAUR gene with all or part of exons 2 to exon 7 of a human PLAUR gene.

[0247] In a specific embodiment of the present invention, the construction method comprises replacing all or part of exons 2 to exon 7 of a non-human animal PLAUR gene with a portion of exon 2, all of exons 3-6, and a portion of exon 7 of a human PLAUR gene, preferably also comprising introns 2-3 and / or introns 6-7.

[0248] In a specific embodiment of the present invention, the construction method comprises replacing the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 9 in the genome of a non-human animal with a nucleotide sequence encoding a human or humanized PLAUR protein, or a nucleotide sequence of a human or humanized PLAUR gene.

[0249] In a specific embodiment of the present invention, the construction method comprises replacing the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 9 in the genome of a non-human animal with a genomic DNA sequence, cDNA sequence or CDS sequence comprising a human PLAUR gene.

[0250] In a specific embodiment of the present invention, the construction method comprises replacing the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 9 in the genome of a non-human animal with a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 10.

[0251] In a specific embodiment of the present invention, the construction method comprises replacing the nucleotide sequence encoding the amino acid sequence shown at positions 25-327 of SEQ ID NO: 9 in the genome of a non-human animal with a nucleotide sequence encoding the amino acid sequence shown at positions 24-335 of SEQ ID NO: 10.

[0252] In a specific embodiment of the present invention, the construction method comprises replacing the nucleotide sequence encoding the amino acid sequence shown at positions 25-327 of SEQ ID NO: 9 in the genome of a non-human animal with the nucleotide sequence shown in SEQ ID NO: 13.

[0253] In some embodiments, the method for constructing a non-human animal comprises modifying the coding frame of the non-human animal PLAU and / or PLAUR gene, and inserting the nucleotide sequence encoding the human or humanized PLAU and / or PLAUR protein or the nucleotide sequence of the humanized PLAU and / or PLAUR gene after the endogenous regulatory elements of the non-human animal PLAU and / or PLAUR gene, wherein the coding frame of the modified non-human animal PLAU and / or PLAUR gene can be used to knock out the functional region of the non-human animal PLAU and / or PLAUR gene or to insert a sequence so that the non-human animal PLAU and / or PLAUR protein is not expressed or the expression is reduced or the expressed protein is non-functional. In some embodiments, the coding frame of the modified non-human animal PLAU gene can knock out all or part of the nucleotide sequence of exons 2-11 of the non-human animal PLAU gene. In some embodiments, the modified non-human animal PLAUR gene coding frame can knock out all or part of the nucleotide sequence of exons 2-7 of the non-human animal PLAUR gene.

[0254] In some embodiments, the method for constructing a genetically modified non-human animal comprises inserting a nucleotide sequence and / or an auxiliary sequence encoding a human or humanized PLAU and / or PLAUR protein after the endogenous regulatory elements of the non-human animal PLAU and / or PLAUR gene. In some embodiments, the auxiliary sequence can be a stop codon, so that the PLAU and / or PLAUR gene humanized animal model expresses human PLAU and / or PLAUR protein in vivo and does not express non-human animal PLAU and / or PLAUR protein. Furthermore, the auxiliary sequence is WPRE, STOP and / or PolyA.

[0255] In some embodiments, the construction method includes constructing a non-human animal using the above-mentioned targeting vector for the PLAU and / or PLAUR gene and / or the sgRNA targeting the PLAU and / or PLAUR gene.

[0256] In a specific embodiment of the present invention, the construction method includes introducing the above-mentioned targeting vector into non-human animal cells (preferably embryonic stem cells), screening the correct positive clone cells and introducing them into the isolated blastocysts, culturing the blastocysts, and then transplanting the cultured blastocysts into the fallopian tubes of female non-human animals, allowing them to develop, and identifying and screening to obtain non-human animals modified with the PLAU and / or PLAUR genes.

[0257] In some embodiments, to improve the recombination efficiency, sgRNA targeting the PLAUR gene can also be used together with the above-mentioned PLAUR gene targeting vector to construct non-human animals.

[0258] In a specific embodiment of the present invention, the construction method comprises introducing the targeting vector of the PLAU and / or PLAUR gene, the sgRNA targeting the PLAU and / or PLAUR gene, and Cas9 into non-human animal cells, culturing the cells (preferably fertilized eggs), and then transplanting the cultured cells into the fallopian tubes of female non-human animals, allowing them to develop, and identifying and screening to obtain non-human animals modified with the PLAU and / or PLAUR genes.

[0259] In some embodiments, the non-human animal can be selected from rodents, pigs, rabbits, monkeys, and any other non-human animals that can be gene-edited to produce humanized genes.

[0260] Preferably, the non-human animal is a non-human mammal. Further preferably, the non-human mammal is a rodent. Even more preferably, the rodent is a rat or a mouse.

[0261] Preferably, the non-human animal is an immunodeficient non-human mammal. Further preferably, the immunodeficient non-human mammal is an immunodeficient rodent, an immunodeficient pig, an immunodeficient rabbit, or an immunodeficient monkey. Even more preferably, the immunodeficient rodent is an immunodeficient mouse or rat. Still further preferably, the immunodeficient mouse is a NOD-Prkdc scid IL-2rγ null Mouse, NOD-Rag 1 - / - -IL2rg - / - Mouse, Rag 2 - / - -IL2rg - / - mice, NOD / SCID mice, or nude mice.

[0262] Use of genetically modified non-human animals

[0263] The present invention also provides a non-human animal genetically modified with the PLAU and / or PLAUR, or a use of a non-human animal obtained by any of the above construction methods.

[0264] In some embodiments, the application comprises:

[0265] A) Applications in the development of products involving human cells in immunological processes associated with PLAU and / or PLAUR;

[0266] B) Application as a model system for pharmacological, immunological, microbiological and medical research related to PLAU and / or PLAUR;

[0267] C) applications involving the production and use of animal experimental disease models for the study of the etiology of PLAU and / or PLAUR and / or for the development of diagnostic strategies and / or for the development of therapeutic strategies;

[0268] D) in vivo studies on the screening, efficacy testing, efficacy assessment, validation or evaluation of human PLAU and / or PLAUR signaling pathway modulators; or

[0269] E) Study the gene function of PLAU and / or PLAUR, study the drugs and drug efficacy targeting human PLAU and / or PLAUR target sites, and study the application of PLAU and / or PLAUR-related drugs in inflammation, immune-related diseases and anti-tumor drugs.

[0270] The present invention provides a non-human animal expressing human or humanized PLAU and / or PLAUR protein, which can be used for screening of human PLAU and / or PLAUR specific modulators. In some embodiments, the non-human animal is an animal model of human disease. For example, the disease is genetically induced (knock-in or knock-out). In various embodiments, the genetically modified non-human animal further comprises an impaired immune system, such as a genetically modified human tissue xenograft, including a human solid tumor (e.g., breast cancer) or a blood cell tumor (e.g., lymphocyte tumor, B or T cell tumor).

[0271] In some embodiments, anti-PLAU and / or PLAUR antibodies block or inhibit PLAU / PLAUR-mediated signaling pathways. In some embodiments, the anti-PLAU antibodies described herein can block the interaction between PLAU and the PLAUR complex, thereby inhibiting the PLAU / PLAUR signaling pathway. In some embodiments, the PLAUR antibodies described herein can block the interaction between PLAU and the PLAUR complex, thereby inhibiting the PLAU / PLAUR signaling pathway.

[0272] In some embodiments, genetically modified non-human animals can be used to determine the effectiveness of therapeutic agents (e.g., anti-PLAU antibodies and / or anti-PLAUR antibodies) in treating various immune diseases. In some embodiments, the immune diseases include, but are not limited to, GVHD (graft versus host disease), psoriasis, allergies, asthma, myocarditis, nephritis, hepatitis (preferably non-alcoholic steatohepatitis), systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, ulcerative colitis, autoimmune liver disease, diabetes, pain, or neurological disorders.

[0273] In some embodiments, genetically modified non-human animals can be used to determine the effectiveness of therapeutic agents (e.g., anti-PLAU antibodies and / or anti-PLAUR antibodies) in treating various inflammatory infections. In some embodiments, the inflammation includes both acute and chronic inflammation. Specifically, it includes, but is not limited to, degenerative inflammation, exudative inflammation (serous inflammation, fibrinous inflammation, suppurative inflammation, hemorrhagic inflammation, necrotizing inflammation, catarrhal inflammation), proliferative inflammation, and specific inflammation (tuberculosis, syphilis, leprosy, lymphogranuloma, etc.).

[0274] In some embodiments, genetically modified non-human animals can be used to determine the effectiveness of therapeutic agents (e.g., anti-PLAU antibodies and / or anti-PLAUR antibodies) for treating cancer. In some embodiments, a therapeutic agent (e.g., anti-PLAU antibodies and / or anti-PLAUR antibodies) is administered to a non-human animal, wherein the non-human animal has cancer or a tumor, and the inhibitory effect of the therapeutic agent on the cancer or tumor is detected. In some embodiments, the detection includes determining the size and / or proliferation rate of tumor cells. In some embodiments, the detection method includes vernier caliper measurement, flow cytometry, and / or animal in vivo imaging detection. In some embodiments, the detection includes assessing individual body weight, fat mass, activation pathways, neuroprotective activity, or metabolic changes, including changes in food consumption or water consumption.

[0275] In some embodiments, the tumor cells include one or more cancer cells injected into an animal (e.g., cancer cells derived from a human or non-human animal). In some embodiments, the therapeutic agent inhibits the PLAU / PLAUR signaling pathway. In some embodiments, the therapeutic agent does not inhibit the PLAU / PLAUR signaling pathway.

[0276] In some embodiments, genetically modified non-human animals can be used to detect whether anti-PLAU or anti-PLAUR antibodies are agonists or antagonists. In some embodiments, the methods described herein can be used to detect the function of therapeutic agents (e.g., anti-PLAU antibodies or anti-PLAUR antibodies), for example, whether the therapeutic agent can upregulate the immune response or downregulate the immune response, and / or whether the therapeutic agent can induce complement-mediated cytotoxicity (CMC) or antibody-dependent cellular cytotoxicity (ADCC). In some embodiments, genetically modified non-human animals can be used to determine the effective dose of a therapeutic agent for treating a disease (e.g., an immune disease) in a subject. The inhibitory effect on tumors can also be determined by methods known in the art, for example, by measuring the tumor volume in the animal, and / or determining the tumor (volume) inhibition rate (TGI). TV ). The tumor growth inhibition rate can be calculated using the formula TGI TV , (%) = (1-TVt / TVc) x 100, where TVt and TVc are the average tumor volumes (or weights) of the treatment and control groups.

[0277] In some embodiments, therapeutic agents (e.g., anti-PLAU antibodies or anti-PLAUR antibodies) can be used to treat various cancers. As used herein, "cancer" refers to cells with autonomous growth ability, i.e., an abnormal state or condition characterized by rapid cell growth and proliferation. The term is intended to include all types of cancerous growth or carcinogenic processes, metastatic tissues, or malignantly transformed cells, tissues, or organs, regardless of the histopathological type or invasive stage. As used herein, "tumors" include, but are not limited to, lymphomas, non-small cell lung cancer, cervical cancer, leukemia, ovarian cancer, nasopharyngeal cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, gastric cancer, bladder cancer, gliomas, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome, and sarcoma. wherein the leukemia is selected from acute lymphocytic (lymphoblastic) leukemia, acute myeloid leukemia, myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia, and chronic myeloid leukemia; the lymphoma is selected from Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B-cell lymphoma, T-cell lymphoma, and Waldenstrom's macroglobulinemia; the sarcoma is selected from osteosarcoma, Ewing's sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, and chondrosarcoma. In a specific embodiment of the present invention, the tumor is breast cancer, pancreatic cancer, endocrine cancer, head and neck cancer, gastrointestinal cancer, colorectal cancer, bladder cancer, non-small cell lung cancer, glioblastoma, prostate cancer, neuroendocrine tumor, mesothelial tumor, oropharyngeal tumor, female reproductive system cancer or meningioma.

[0278] The present invention also provides a method for determining the toxicity of a therapeutic agent (e.g., an anti-PLAU antibody or an anti-PLAUR antibody). The method comprises administering an antibody to the non-human animal described above and assessing the animal's weight change, red blood cell count, hematocrit, and / or hemoglobin. In some embodiments, the antibody can reduce red blood cells (RBCs), hematocrit, or hemoglobin by 20%, 30%, 40%, or more than 50%. In some embodiments, the animal's weight is at least 5%, 10%, 20%, 30%, or 40% less than a control group (e.g., the average weight of an animal not treated with the antibody).

[0279] The present invention also provides an animal model constructed by the method described herein for use in developing products related to human cellular immune processes, producing human antibodies, or as a model system for pharmacology, immunology, microbiology, and medical research.

[0280] In some embodiments, an animal model generated by the methods described herein is provided for producing and utilizing human cell-based immune processes in animal experimental disease models, studying pathogens, or developing new diagnostic and / or therapeutic strategies.

[0281] The present invention also provides animal models generated by the methods described herein to screen, validate, evaluate or study PLAU and / or PLAUR gene functions, human PLAU and / or PLAUR antibodies, drugs or effectiveness of human PLAU and / or PLAUR target sites, drugs for immune-related diseases and anti-tumor drugs.

[0282] Non-human animal models with two or more human or chimeric genes

[0283] The present invention also provides a non-human animal with two or more human or chimeric genes, wherein the animal model comprises human or chimeric PLAU and / or PLAUR genes and nucleic acid sequences encoding other human or chimeric proteins. In some embodiments, the other genes are non-human animals modified with at least one gene selected from IL1B, IL6, IL15, PD-1, PD-L1, TIGIT, LAG3, CD226, CTLA4, and TNF-α. In some embodiments, the non-human animal further expresses at least one of human or humanized IL1B, IL6, IL15, PD-1, PD-L1, TIGIT, LAG3, CD226, CTLA4, and TNF-α proteins.

[0284] The present invention also provides a method for constructing a non-human animal with two or more human or chimeric genes, the method comprising:

[0285] (1) Providing the above-mentioned construction method to obtain a non-human animal;

[0286] (2) mating, in vitro fertilization, or direct gene editing of the non-human animal provided in step (1) with other genetically modified non-human animals, and screening to obtain multi-gene modified non-human animals.

[0287] In some embodiments, the other genetically modified non-human animals include non-human animals humanized with one or a combination of two or more of the genes IL1B, IL6, IL15, PD-1, PD-L1, TIGIT, LAG3, CD226, CTLA4 and TNF-α.

[0288] In some embodiments, PLAU and / or PLAUR humanization is performed directly on non-human animals with human or chimeric IL1B, IL6, IL15, PD-1, PD-L1, TIGIT, LAG3, CD226, CTLA4 and / or TNF-α gene modifications.

[0289] Since these proteins may involve different mechanisms, a combination therapy targeting two or more of these proteins may be a more effective treatment method. In fact, many related clinical trials are underway and have shown good results. Multigene modified non-human animal models can be used to determine the effectiveness of combination therapies targeting two or more proteins, for example, anti-PLAU antibodies or anti-PLAUR antibodies, and additional therapeutic agents for treating cancer or immune diseases (e.g., asthma or atopic dermatitis). The method includes administering anti-PLAU antibodies and / or anti-PLAU antibodies and additional therapeutic agents to an animal, wherein the animal has a tumor or immune disease, and determining the effect of the combination therapy on the immune tumor or immune disease. In some embodiments, the additional therapeutic agent is an antibody that specifically binds to IL1B, IL6, IL15, PD-1, PD-L1, TIGIT, LAG3, CD226, CTLA4 and / or TNF-α. In some embodiments, the additional therapeutic agent is an anti-CTLA4 antibody (e.g., ipilimumab), an anti-PD-1 antibody (e.g., nivolumab) or an anti-PD-L1 antibody. In some embodiments, the non-human animal further comprises a sequence encoding human or humanized PD-1, a sequence encoding human or humanized PD-L1, or a sequence encoding human or humanized CTLA-4. In some embodiments, the additional therapeutic agent is an anti-PD-1 antibody (e.g., nivolumab, pembrolizumab), an anti-PD-L1 antibody, or an anti-CTLA-4 antibody. In some embodiments, the tumor comprises one or more tumor cells expressing PD-L1 and / or PD-L2.

[0290] In some embodiments, the combination therapy can also be used to treat various cancers described herein, such as breast cancer, pancreatic cancer, endocrine cancer, head and neck cancer, gastrointestinal cancer, colorectal cancer, bladder cancer, non-small cell lung cancer, glioblastoma, prostate cancer, neuroendocrine tumors, mesothelial tumors, oropharyngeal tumors, female reproductive system cancers, or meningioma.

[0291] In some embodiments, the methods of treatment described above can be used in combination with conventional cancer chemotherapy drugs. In some embodiments, the methods of treating cancer can be used alone or in combination with the methods described herein, including treating the subject with chemotherapy, such as camphor, doxorubicin, cisplatin, carboplatin, procarbazine, methylchloroethylamine, cyclophosphamide, doxorubicin, ifosfamide, melphalan, chlorambucil, endosulfan, nitrosulfamethoxazole, dactinomycin, daunorubicin, bleomycin, prinomycin, mitomycin, etoposide, verapir, podophyllotoxin, tamoxifen, paclitaxel, transplatin, 5-fluorouracil, vincristine, vinblastine and / or methotrexate. The methods may include performing surgery on the subject to remove at least a portion of the cancer, such as removing part or all of a tumor from the patient. DETAILED DESCRIPTION

[0292] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solutions of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, and such modifications and replacements fall within the scope of protection of the present invention.

[0293] In each of the following examples, equipment and materials were obtained from the following companies:

[0294] C57BL / 6 mice were purchased from the National Rodent Laboratory Animal Center, China Food and Drug Administration;

[0295] BbsI, EcoRI, BamHI, BclI, and AvrII enzymes were purchased from NEB with catalog numbers R0539L, R0101L, R0136L, R0160L, and R0174L, respectively;

[0296] Anti-Urokinase antibody [EPR6273], purchased from Abcam, catalog number ab133563;

[0297] The Trizol kit was purchased from TakaRa, catalog number 6110A.

[0298] Example 1: Humanized PLAU mice

[0299] A schematic diagram of the comparison of the mouse PLAU gene (NCBI Gene ID: 18792, Primary source: MGI: 97611, UniProt ID: P06869, located at positions 20886730 to 20893456 of chromosome 14 NC_000080.7, based on transcript NM_008873.3 and its encoded protein NP_032899.1 (SEQ ID NO: 1)) and the human PLAU gene (NCBI Gene ID: 5328, Primary source: HGNC: 9052, UniProt ID: P00749, located at positions 73909182 to 73917497 of chromosome 10 NC_000010.11, based on transcript NM_002658.6 and its encoded protein NP_002649.2 (SEQ ID NO: 2)) is shown in Figure 1.

[0300] To achieve the objectives of the present invention, a nucleotide sequence encoding human PLAU protein can be introduced into the mouse endogenous PLAU gene locus, allowing the mouse to express human or humanized PLAU protein. Specifically, using gene editing technology, under the control of mouse PLAU gene regulatory elements, a portion of the mouse exon 2 to exon 11 sequence (approximately 5.3 kb) is replaced with a portion of the mouse exon 2 to exon 11 sequence (approximately 5.0 kb). The resulting humanized PLAU gene locus is schematically shown in Figure 2, achieving humanization of the mouse PLAU gene.

[0301] A targeting strategy was designed as shown in Figure 3. The figure shows the targeting vector containing upstream and downstream homology arm sequences for the mouse PLAU gene and segment A containing a human PLAU DNA fragment. The upstream 5' homology arm sequence (SEQ ID NO: 3) is identical to nucleotides 20883305 to 20887146 of NCBI Accession No. NC_000080.7, and the downstream 3' homology arm sequence (SEQ ID NO: 4) is identical to nucleotides 20893778 to 20896948 of NCBI Accession No. NC_000080.7. The nucleotide sequence of the human PLAU DNA fragment in segment A (SEQ ID NO: 7) is identical to nucleotides 73911556 to 73916565 of NCBI Accession No. NC_000010.11.

[0302] The targeting vector also contains a resistance gene for positive clone screening, namely the neomycin phosphotransferase coding sequence Neo, and two site-specific recombination system FRT recombination sites arranged in the same direction are installed on both sides of the resistance gene to form a Neo cassette. The connection between the 5' end of the Neo cassette and the mouse gene is designed as: 5'-AAGAAAAGAAAAAAATCTGATTCAAACAAAGC GATATCGAATTCCGAAGTTCCTATTCTCTAGAAAGT-3' (SEQ ID NO: 16), wherein the sequence The last "C" in the sequence "GATA" is the last nucleotide of the mouse, and the "G" in the sequence "GATA" is the first nucleotide of the Neo box; the connection between the 3' end of the Neo box and the mouse gene is designed to be: 5'-AGTATAGGAACTTCATCAGTCAGGTACATAATGGTGG GAGTCGGTGCTGTCGACGGGGTCAGGTAATGAAGTA-3' (SEQ ID NO: 17), wherein the sequence The last "C" in the sequence "GAGT" corresponds to the last nucleotide of the Neo cassette, and the first "G" in the sequence "GAGT" corresponds to the first nucleotide of the mouse. Furthermore, a gene encoding a negative selection marker (the gene encoding the diphtheria toxin A subunit (DTA)) was constructed downstream of the 3' homology arm of the targeting vector. The mRNA sequence of the engineered humanized mouse PLAU is shown in SEQ ID NO:8, and the expressed protein sequence is shown in SEQ ID NO:2.

[0303] The targeting vector construction can be carried out by conventional methods, such as enzyme digestion and connection. After the constructed targeting vector is preliminarily verified by enzyme digestion, it is sent to a sequencing company for sequencing verification. The targeting vector electroporation transfection correct for sequencing verification is introduced into the embryonic stem cells of C57BL / 6 mice, and the cells obtained are screened using positive clone screening marker genes, and PCR and Southern Blot techniques are utilized to detect the integration of the foreign gene, and correct positive clone cells are screened out. After PCR identification (primers are shown in Table 5), it is confirmed that the clones that are positive carry out Southern Blot detection again without random insertion, and further sequencing verification correct clones are carried out next step experiment.

[0304] Table 5 PCR primer names and specific sequences

[0305] Correctly selected positive clones (black mice) are introduced into isolated blastocysts (white mice) according to techniques known in the art. The resulting chimeric blastocysts are transferred to culture medium for a short period of time and then transplanted into the oviducts of recipient female mice (white mice), producing F0 generation chimeric mice (black and white). F0 generation chimeric mice are backcrossed with wild-type mice to produce F1 generation mice. F1 generation heterozygous mice are then mated with each other to produce F2 generation homozygous mice. Positive mice can also be mated with Flp-expressing mice to remove the positive clone selection marker gene (see Figure 4 for a schematic diagram of this process). Humanized mice homozygous for the PLAU gene can then be obtained by mating with each other.

[0306] In addition, the CRISPR / Cas9 system can be introduced for gene editing, and a targeting strategy can be designed as shown in Figure 5. The figure shows the upstream and downstream homology arm sequences of the mouse PLAU gene and the sequence of the human PLAU DNA fragment on the targeting vector. The upstream homology arm sequence (5' homology arm, SEQ ID NO: 5) is identical to the nucleotide sequence of positions 20885866 to 20887146 of NCBI Accession No. NC_000080.7, the downstream homology arm sequence (3' homology arm, SEQ ID NO: 6) is identical to the nucleotide sequence of positions 20892519 to 20893251 of NCBI Accession No. NC_000080.7, and the nucleotide sequence of the human PLAU DNA fragment (SEQ ID NO: 7) is identical to the nucleotide sequence of positions 73911556 to 73916565 of NCBI Accession No. NC_000010.11. The mRNA sequence of the modified humanized mouse PLAU is shown in SEQ ID NO: 8, and the expressed protein sequence is shown in SEQ ID NO: 2.

[0307] Targeting vector construction can be performed using conventional methods, such as enzyme digestion, ligation, and direct synthesis. After initial verification of the constructed targeting vector through enzyme digestion, it is sent to a sequencing company for sequencing verification. Targeting vectors that have been verified to be correct by sequencing are used in subsequent experiments.

[0308] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cut the target gene. Therefore, efficient and specific target sequence selection and design are prerequisites for constructing sgRNA expression vectors. Design and synthesize the sgRNA sequence that recognizes the target site. The target sequence of an exemplary sgRNA on the PLAU gene is as follows:

[0309] sgRNA1 target site (SEQ ID NO: 20): 5′-GAGGGCTTGTGCACCCAAAGAGG-3′;

[0310] sgRNA2 target site (SEQ ID NO: 21): 5′-TGAGACCCTCGTGTAGACACCGG-3′;

[0311] The activity of sgRNA was detected using a UCA kit. After confirming that it could mediate efficient cleavage, enzyme cleavage sites were added to its 5' end and complementary chain to obtain forward oligonucleotide and reverse oligonucleotide sequences (see Table 6). After annealing, the annealed products were ligated to the pT7-sgRNA plasmid (the plasmid was first linearized with BbsI) to obtain expression vectors pT7-PLAU-1 and pT7-PLAU-2.

[0312] Table 6 Sequence list of sgRNA1 and sgRNA2

[0313] The pT7-sgRNA vector is synthesized by a plasmid synthesis company. The DNA fragment containing the T7 promoter and sgRNA scaffold (SEQ ID NO: 30) is then ligated to a backbone vector (source: Takara, Cat. No. 3299) using enzyme digestion (EcoRI and BamHI). Sequencing verification by a professional sequencing company indicates that the target plasmid has been obtained. Pronuclear fertilized eggs of mice, such as C57BL / 6 mice, are taken. In vitro transcription products of the pT7-PLAU-1 and pT7-PLAU-2 plasmids (transcribed using the Ambion in vitro transcription kit according to the instructions), the targeting vector, and Cas9 mRNA are premixed and injected into the cytoplasm or nucleus of the mouse fertilized eggs using a microinjector. Microinjection of fertilized eggs was performed according to the methods in the "Mouse Embryo Manipulation Experiment Manual (3rd Edition)" (Andras Nagy, Chemical Industry Press, 2006). The injected fertilized eggs were transferred to culture medium for a short period of culture and then transplanted into the oviduct of the recipient mother mouse for development. The resulting mice (F0 generation) were then hybridized and self-pollinated to expand the population and establish a stable humanized mouse strain carrying the PLAU gene.

[0314] The genotype of somatic cells of F1 generation mice can be identified by PCR (primers are shown in Table 1). The exemplary identification results of F1 generation mice are shown in Figure 6, where the nine mice numbered F1-01 to F1-09 are all positive heterozygous mice.

[0315] Southern blot analysis was performed on F1 generation mice that tested positive by PCR to confirm the presence of random insertions. Genomic DNA was extracted from the tails of the mice, digested with either BclI or AvrII, transferred to a membrane, and hybridized. Specific probe and target fragment lengths are shown in Table 7. Example F1 generation test results are shown in Figure 7: F1-01 to F1-09 were all positive heterozygous mice. This demonstrates that this method successfully generated humanized PLAU mice that can be stably propagated and are free of random insertions.

[0316] Table 7 Specific probe and target fragment lengths

[0317] The probe synthesis primers are as follows:

[0318] 5'Probe-F (SEQ ID NO: 31): 5'-TTACACTCCCTGACGACAAACTTCA-3',

[0319] 5'Probe-R (SEQ ID NO: 32): 5'-TAACGCAGTCTGTCTGGATCGAGCG-3';

[0320] 3'Probe-F (SEQ ID NO: 33): 5'-GCTCCAGTCTCCTGAATAGTAGCGC-3',

[0321] 3'Probe-R (SEQ ID NO: 34): 5'-CTGATGTTTGATTCAAATTATGTGGT-3';

[0322] The expression of humanized PLAU mRNA in the positive mice was confirmed by conventional detection methods, such as RT-PCR. Specifically, one C57BL / 6 wild-type mouse and one PLAU gene heterozygous mouse prepared in this example were euthanized by cervical dislocation, and kidney tissue was obtained. Cellular RNA was extracted according to the Trizol kit instructions, reverse transcribed into cDNA, and then subjected to RT-PCR analysis (primers are shown in Table 8). The test results are shown in Figure 8: only mouse PLAU mRNA was detected in C57BL / 6 wild-type mice (+ / +), and no human PLAU mRNA was detected; human PLAU mRNA was only detected in mice heterozygous for the humanized PLAU gene (H / +).

[0323] Table 8 RT-PCR primer names and specific sequences

[0324] Furthermore, Western blot analysis was performed to examine the expression of PLAU protein in the humanized PLAU mice prepared in this example. Specifically, one 8-week-old C57BL / 6 wild-type mouse (+ / +) and one homozygous PLAU mouse (H / H) prepared in this example were taken and euthanized by cervical dislocation. Liver and kidney tissues were obtained and Western blot analysis was performed using an anti-Urokinase antibody. The results are shown in Figure 15 . PLAU protein was detected in both C57BL / 6 wild-type mice and homozygous PLAU humanized mice. Since the anti-Urokinase antibody has cross-binding activity between human and mouse PLAU, the RT-PCR results in Figure 8 indicate that mouse PLAU protein was detected in the C57BL / 6 wild-type mice, while human PLAU protein was detected in the homozygous PLAU humanized mice. These results demonstrate that the humanized PLAU mice constructed in this example can successfully express human PLAU protein.

[0325] Example 2: PLAUR gene humanized mice

[0326] A schematic diagram of the comparison of the mouse PLAUR gene (NCBI Gene ID: 18793, Primary source: MGI: 97612, UniProt ID: P35456, located at positions 24161857 to 24175393 of chromosome 7 NC_000073.7, based on transcript NM_011113.4 and its encoded protein NP_035243.1 (SEQ ID NO: 9)) and the human PLAUR gene (NCBI Gene ID: 5329, Primary source: HGNC: 9053, UniProt ID: Q03405, located at positions 43646095 to 43670197 of chromosome 19 NC_000019.10, based on transcript NM_002659.4 and its encoded protein NP_002650.1 (SEQ ID NO: 10)) is shown in Figure 9.

[0327] To achieve the purpose of the present invention, a nucleotide sequence encoding a human PLAUR protein can be introduced into the mouse endogenous PLAUR locus so that the mouse expresses human or humanized PLAUR protein. Specifically, using gene editing technology, under the control of the mouse PLAUR gene regulatory element, the partial sequence of exon 2 to exon 7 of the human PLAUR gene, approximately 18.8 kb, is replaced with a partial sequence of approximately 10.3 kb from mouse exon 2 to exon 7, to obtain a humanized PLAUR locus schematic diagram as shown in Figure 10, thereby achieving humanization of the mouse PLAUR gene.

[0328] A targeting strategy was designed as shown in Figure 11, which shows the targeting vector containing upstream and downstream homology arm sequences of the mouse PLAUR gene and the A1 segment containing the human PLAUR DNA fragment. The upstream 5' homology arm sequence (SEQ ID NO: 11) is identical to nucleotides 24159210 to 24164569 of NCBI Accession No. NC_000073.7, and the downstream 3' homology arm sequence (SEQ ID NO: 12) is identical to nucleotides 24174897 to 24178233 of NCBI Accession No. NC_000073.7. The nucleotide sequence of the human PLAUR DNA fragment in the A1 segment (SEQ ID NO: 13) is identical to nucleotides 43648890 to 43667677 of NCBI Accession No. NC_000019.10.

[0329] The targeting vector also contains a resistance gene for positive clone screening, namely the neomycin phosphotransferase coding sequence Neo, and two site-specific recombination system Frt recombination sites arranged in the same direction are installed on both sides of the resistance gene to form a Neo cassette. The connection between the 5' end of the Neo cassette and the human sequence is designed to be 5'-ATTGTACACTTATGAGAGTGAAAAAG ATCATCTGGCGAATCGGACCCACAAGAGCACTGAGGTCGGAAGTTCCTA TTC-3' (SEQ ID NO: 41), wherein the sequence The "T" in the sequence "ATCA" is the last nucleotide of the human sequence, and the first "A" in the sequence "ATCA" is the first nucleotide of the Neo box; the connection between the 3' end of the Neo box and the human sequence is designed to be: 5'-AAGTATAGGAACTTCATCAGTCCAGGATACATAGATTACCACAACTCCG GTGAAATCACAGATCTCCTGAAAGGGTCTCTGGG-3' (SEQ ID NO: 42), wherein the sequence The last "C" in the sequence "GTGA" is the last nucleotide of the Neo cassette, and the first "G" in the sequence "GTGA" is the first nucleotide of the human sequence. In addition, a gene encoding a negative selection marker (the gene encoding the diphtheria toxin A subunit (DTA)) was constructed downstream of the 3' homology arm of the recombinant vector. The mRNA sequence of the modified humanized mouse PLAUR is shown in SEQ ID NO: 14, and the expressed protein sequence is shown in SEQ ID NO: 15.

[0330] Given that human PLAUR has multiple isoforms or transcripts, the methods described herein can be applied to other isoforms or transcripts.

[0331] The targeting vector construction can be carried out by conventional methods, such as enzyme digestion and connection. After the targeting vector constructed is preliminarily verified by enzyme digestion, it is sent to a sequencing company for sequencing verification. The correct targeting vector electroporation transfection of sequencing verification is entered into the embryonic stem cell of C57BL / 6 mice, the cells obtained are screened by positive clone screening marker gene, and PCR and Southern Blot technology are utilized to detect the integration situation of the foreign gene, and correct positive clone cells are screened out. After PCR identification (primer is as shown in Table 9) is that positive clones carry out Southern Blot detection again to confirm that there is no random insertion, further sequencing verification correct clones are carried out next step experiment.

[0332] Table 9 PCR primer names and specific sequences

[0333] The correctly screened positive clone cells (black mice) are introduced into isolated blastocysts (white mice) according to techniques known in the art. The resulting chimeric blastocysts are transferred to culture medium for a short culture, then transplanted into the oviducts of recipient female mice (white mice), producing F0 generation chimeric mice (black and white). F0 generation chimeric mice are backcrossed with wild-type mice to obtain F1 generation mice, and F1 generation heterozygous mice are then mated with each other to obtain F2 generation homozygous mice. Positive mice can also be mated with Flp tool mice to remove the positive clone screening marker gene (see Figure 12 for a schematic diagram of this process), and then mated with each other to obtain PLAUR gene homozygous mice.

[0334] The genotype of somatic cells of F1 generation mice can be identified by PCR (primers are shown in Table 4). The identification results of exemplary F1 generation mice are shown in Figure 13, among which mice numbered F1-01, F1-02 and F1-03 are all positive heterozygous mice.

[0335] The expression of humanized PLAUR mRNA in positive mice was confirmed by conventional detection methods, such as RT-PCR. Specifically, one C57BL / 6 wild-type mouse and one PLAUR gene humanized heterozygous mouse prepared in this example were taken, euthanized by cervical dislocation, and lung tissue was obtained. Cellular RNA was extracted according to the instructions of the Trizol kit, and reverse transcribed into cDNA and then subjected to RT-PCR detection (primers are shown in Table 10). The test results are shown in Figure 14: only mouse PLAUR mRNA was detected in C57BL / 6 wild-type mice (+ / +), and no human PLAUR mRNA was detected; human PLAUR mRNA was only detected in the humanized PLAUR gene heterozygous mice (H / +).

[0336] Table 10 RT-PCR primer names and specific sequences

[0337] Flow cytometry was used to detect the expression of PLAUR protein in humanized PLAUR mice. One 7-week-old female wild-type C57BL / 6 mouse and one 10-week-old female homozygous PLAUR mouse were selected and stimulated with LPS (20 μg / 200 μl) intraperitoneally for 2 hours. The peritoneal lavage fluid was collected and the anti-mouse CD45 antibody Brilliant Violet 510 was used to detect the expression of PLAUR protein in humanized PLAUR mice. TManti-mouse CD45Antibody(mCD45), anti-mouse CD11b antibody V450Rat Anti-mouse CD11b Antibody(mCD11b), anti-mouse F4 / 80 antibody FITC anti-mouse F4 / 80 Antibody(mF4 / 80), anti-mouse PLAUR antibody CD87Antibody, anti-mouse, REAfinity TM (mPLAUR), anti-human PLAUR antibody CD87Antibody, anti-human, REAfinity TM (hPLAUR), Zombie NIR TM Fixable Viability Kit and Purified anti-mouse CD16 / 32 were used for staining, and the stained cells were subjected to flow cytometry. The characteristics of ascites macrophages were: CD45+CD11b+mF4 / 80+. Testing found that 99.7% of the macrophages in the ascites of wild-type mice were mPLAUR-positive cells (characterized by CD45+CD11b+mF4 / 80+mPLAUR+), and 2.24% of the hPLAUR-positive cells (characterized by CD45+CD11b+mF4 / 80+hPLAUR+). The macrophages in the ascites of PLAUR gene homozygous mice were 0.20% of the mPLAUR-positive cells (characterized by CD45+CD11b+mF4 / 80+mPLAUR+), and 99.6% of the hPLAUR-positive cells (characterized by CD45+CD11b+mF4 / 80+hPLAUR+). In summary, the PLAUR humanized mice constructed in this example can successfully express humanized PLAUR protein.

[0338] Example 3: Preparation of PLAU / PLAUR dual-gene humanized mice

[0339] The PLAU gene humanized mice prepared in Example 1 were mated with the PLAUR gene humanized mice prepared in Example 2, and positive offspring mice were screened to obtain PLAU / PLAUR bi-gene humanized mice. Conventional methods can be used to confirm the expression of human PLAU protein in positive mice, such as ELSA. Specifically, three 9-week-old male wild-type C57BL / 6 mice (+ / +) and three male PLAU / PLAUR bi-gene humanized homozygous mice (H / H) prepared in this example were selected, euthanized by cervical dislocation, and serum was collected. The serum was tested using a mouse uPA ELISA kit and a human uPA ELISA kit (URK). The results showed (Figure 16) that mouse PLAU protein was only detected in wild-type C57BL / 6 mice, and human PLAU protein was only detected in PLAU / PLAUR bi-gene humanized homozygous mice, indicating that human PLAU protein can be normally expressed in mice after humanization.

[0340] Flow cytometry can be used to detect the expression of hPLAUR protein in PLAU / PLAUR double-gene humanized homozygous mice. Specifically, 9-week-old male wild-type C57BL / 6 mice (+ / +) and 10-week-old male PLAU / PLAUR double-gene humanized homozygous mice (H / H) prepared in this example were selected, euthanized by cervical dislocation, and bone marrow tissue was obtained. The anti-mouse CD45 antibody Brilliant Violet 510 was used to detect the expression of hPLAUR protein in the mouse. TM anti-mouse CD45 (mCD45), anti-mouse Ly6G antibody Brilliant Violet 650 TM anti-mouse Ly-6G Antibody(mLy6G), anti-mouse CD11b antibody V450 Rat Anti-mouse CD11b Antibody(mCD11b), anti-mouse CD3 antibody Alexa 700 anti-mouse CD3 Antibody (mCD3), anti-mouse F4 / 80 antibody FITC anti-mouse F4 / 80 Antibody (mF4 / 80), anti-mouse CD11c antibody Invitrogen CD11c Monoclonal Antibody (N418), PE-Cyanine7, eBioscience (mCD11c), anti-mouse PLAUR antibody CD87 Antibody, anti-mouse, REAfinity TM (mPLAUR), anti-human PLAUR antibody CD87Antibody, anti-human, REAfinity TM(hPLAUR), Anti-Human IgG1 Antibody PE Human IgG1 Isotype Control Recombinant Antibody, Anti-Mouse IgG1 Antibody APC Human IgG1 Isotype Control Recombinant Antibody, Zombie NIR TM After staining with Fixable Viability Kit and Purified anti-mouse CD16 / 32, flow cytometry was performed to detect the expression of human or humanized PLAUR protein in monocytes, macrophages, granulocytes and dendritic cells. The test results are shown in Table 11.

[0341] Table 11 Flow cytometry detection results

[0342] As can be seen from Table 11, only mouse PLAUR protein can be detected in the mononuclear macrophages, granulocytes and dendritic cells of the bone marrow of wild-type C57BL / 6 mice, while human PLAUR protein can be detected in the bodies of PLAU / PLAUR dual-gene humanized homozygous mice, further indicating that human PLAU protein can be normally expressed in mice after humanization transformation.

[0343] Example 4: Efficacy Verification

[0344] First, flow cytometry was used to verify whether the PLAU / PLAUR double-gene humanized homozygous mouse prepared in this example could bind to the two anti-human PLAUR antibodies Ab1 and Ab2. An 8-week-old male PLAU / PLAUR double-gene humanized homozygous mouse was selected and stimulated with LPS (20ug / 200ul) intraperitoneally for 2 hours. The peritoneal lavage fluid was collected and the anti-mouse CD45 antibody Brilliant Violet 510 was used to detect the binding of the two anti-human PLAUR antibodies Ab1 and Ab2. TM anti-mouse CD45, anti-mouse Ly6G antibody Brilliant Violet 650 TManti-mouse Ly-6G Antibody, anti-mouse CD11b antibody V450Rat Anti-mouse CD11b Antibody, anti-mouse F4 / 80 antibody FITC anti-mouse F4 / 80 Antibody, anti-human PLAU antibody Ab1, anti-human PLAUR antibody Ab2, anti-human IgG1 antibody PE Human IgG1 Isotype Control Recombinant Antibody, anti-mouse IgG1 antibody APC Human IgG1 Isotype Control Recombinant Antibody, Zombie NIR TM After staining with the Fixable Viability Kit and Purified anti-mouse CD16 / 32, flow cytometry analysis revealed that 100% of the mononuclear macrophages in the peritoneal lavage fluid of PLAU / PLAUR dual-gene humanized homozygous mice were Ab1-positive and 98.3% were Ab2-positive. This indicates that the LAU / PLAUR dual-gene humanized homozygous mice constructed in this example can successfully bind to anti-human PLAUR antibodies and can subsequently be used to evaluate the efficacy of antibodies targeting human PLAUR.

[0345] For example, PLAU / PLAUR dual-gene humanized homozygous mice were subcutaneously inoculated with MC38 colon cancer cells expressing humanized PLAUR. When the tumor volume grew to about 100 mm 3 Afterwards, mice were divided into a control group or a treatment group based on tumor volume. The treatment group was injected with an antibody targeting human PLAUR, while the control group was injected with an equal volume of PBS. Tumor volume was measured and mice were weighed regularly. Comparing mouse weight and tumor volume effectively assessed the safety and efficacy of the antibody in humanized PLAU / PLAUR mice.

[0346] Specifically, 7-9 week old PLAU / PLAUR dual gene humanized homozygous mice were subcutaneously inoculated with MC38 colon cancer cells expressing humanized PLAUR (5×10 5 ), wait until the tumor volume grows to about 100 mm 3 Afterwards, the mice were divided into control group or treatment group (n=6 / group). Treatment groups G2 and G3 were injected with IgG1 antibody drugs Ab1 and Ab2 targeting human PLAUR, while the control group was injected with an equal volume of PBS. The administration frequency was twice a week for a total of 6 times. The tumor volume was measured twice a week and the mice were weighed until the end of the experiment on day 21 (day 21 after grouping). After inoculation, the tumor volume of a single mouse reached 3000mm 3The specific groups, dosing, dosage, and frequency are shown in Table 12. The tumor volume and body weight of mice during the experiment are shown in Figures 17 and 18, respectively.

[0347] Table 12 Specific groups, administration, dosage and frequency

[0348] The results showed that the animals in all groups were in good health during the experiment. At the end of the experiment (21 days after grouping), the weight of mice in all treatment and control groups increased, and there was no significant difference in the weight of mice throughout the experimental period (Figure 18); however, based on the tumor volume measurement results (Figure 17), the tumors in the control group mice continued to grow during the experimental period. Compared with the control group, the growth of tumor volume in G2 and G3 in the treatment groups showed varying degrees of inhibition and / or reduction.

[0349] Table 13 lists the main data and analysis results of the experiment, including the tumor volume at the time of grouping and on days 14 and 21 after grouping, mouse survival, and tumor (volume) inhibition rate (Tumor Growth Inhibition Value, TGI TV ) and the statistical difference (P value) in tumor volume between the treated and control groups.

[0350] Table 13 Statistical differences in tumor volume

[0351] As shown in Table 13, at the end of the experiment, the average tumor volume of the control group was 2237±341mm 3 The mean tumor volumes of the treatment groups at the Ab1 (10 mg / kg) and Ab2 (10 mg / kg) dose levels were 1926 ± 566 mm 3 , and 1726±250mm 3 The tumor volumes of mice in all treatment groups were smaller than those in the control group. TV The results were 14.5% and 23.8% respectively, indicating that different doses and different types of anti-human PLAUR antibodies had different inhibitory effects on tumors. In conclusion, PLAU / PLAUR dual-gene homozygous mice can be used for the screening and evaluation of candidate drugs.

[0352] Example 5: Preparation of PLAU and / or PLAUR multi-humanized mice

[0353] The humanized mice with PLAU and PLAUR genes produced by this method can also be used to prepare mouse models with double or multiple gene modifications. As in Example 1 above, the embryonic stem cells used for blastocyst microinjection can be selected from mice modified with other genes such as PLAUR, PD-1, PD-L1, CTLA4, OX40, LAG3, TIM3, CD73, etc. Alternatively, based on humanized PLAU mice, mouse ES embryonic stem cells can be isolated and gene recombination targeting technology can be used to obtain double or multiple gene modified mouse models with PLAU and other genes. PLAU mice homozygous or heterozygous mice obtained by this method can also be mated with homozygous or heterozygous mice modified with other genes, and their offspring can be screened. According to Mendelian inheritance laws, there is a certain probability of obtaining heterozygous mice with double or multiple gene modifications of PLAU genes and other genes, and then mating heterozygotes with each other can obtain homozygous mice modified with double or multiple genes. Using the PLAUR humanized mice obtained in Example 2, homozygous mice modified with the PLAUR gene and other genes can also be obtained using the above method. These dual-gene or multi-gene modified mice can be used to conduct in vivo efficacy testing of drugs targeting human PLAU, PLAUR, and other gene modulators.

[0354] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

[0355] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0356] In addition, the various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A genetically modified non-human animal, characterized in that The genome of the animal comprises at least one chromosome comprising a nucleotide sequence encoding a human or chimeric urokinase-type plasminogen activator receptor (PLAUR) protein.

2. The animal according to claim 1, characterized in that The nucleotide sequence encoding the human or chimeric PLAUR protein is operably linked to endogenous regulatory elements (eg, endogenous 5'UTR and / or 3'UTR) of an endogenous PLAUR locus on at least one chromosome.

3. The animal according to claim 1 or 2, characterized in that The nucleotide sequence encoding the human or chimeric PLAUR protein comprises three homologous domains encoding the human PLAUR protein.

4. The animal according to claim 1 or 2, characterized in that The amino acid sequence encoded by the nucleotide sequence encoding the human or chimeric PLAUR protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to human PLAUR (NP_002650.1, SEQ ID NO: 10).

5. The animal according to claim 1 or 2, characterized in that The amino acid sequence encoded by the nucleotide sequence encoding the human or chimeric PLAUR protein comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identity with the amino acid sequence shown in positions 24-335 of SEQ ID NO:

10.

6. The animal according to claim 1 or 2, characterized in that The nucleotide sequence encoding the human or chimeric PLAUR protein comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identity to the nucleotide sequence of SEQ ID NO:

15.

7. The animal according to any one of claims 1 to 6, characterized in that The animal is a mammal, such as a monkey, rodent, mouse or rat.

8. The animal according to any one of claims 1 to 7, characterized in that The animal is a mouse.

9. The animal according to any one of claims 1 to 8, characterized in that The endogenous PLAUR protein in the animal is not expressed or is expressed at a reduced level compared to PLAUR in wild-type animals.

10. The animal according to any one of claims 1 to 9, characterized in that One or more cells of the animal express human or chimeric PLAUR protein.

11. The animal according to any one of claims 1 to 10, characterized in that One or more cells of the animal express human or chimeric PLAUR protein, and endogenous PLAUR ligand (PLAU) can bind to the expressed human or chimeric PLAUR protein to activate downstream signaling pathways.

12. The animal according to any one of claims 1 to 10, characterized in that One or more cells of the animal express human or chimeric PLAUR protein, and human PLAUR ligand (PLAU) can bind to the expressed human or chimeric PLAUR protein to activate downstream signaling pathways.

13. A genetically modified non-human animal, characterized in that The genome of the animal comprises a nucleotide sequence encoding an endogenous PLAUR region at an endogenous PLAUR locus replaced by a nucleotide sequence of a corresponding region of human PLAUR.

14. The animal according to claim 13, characterized in that The nucleotide sequence encoding the corresponding region of human PLAUR is operably linked to an endogenous regulatory element of an endogenous PLAUR locus, and one or more cells of the animal express a human or humanized PLAUR protein.

15. The animal according to claim 13 or 14, characterized in that The animal's endogenous PLAUR protein is not expressed or is expressed at a reduced level compared to PLAUR in wild-type animals.

16. The animal according to any one of claims 13 to 15, characterized in that The nucleotide sequence encoding the corresponding region of human PLAUR includes a portion of exon 2, exon 3, exon 4, exon 5, exon 6, and / or a portion of exon 7 of the human PLAUR gene.

17. The animal according to any one of claims 13 to 16, characterized in that The nucleotide sequence encoding the corresponding region of human PLAUR is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence shown in SEQ ID NO:

13.

18. The animal according to any one of claims 13 to 17, characterized in that The nucleotide sequence encoding the endogenous PLAUR region includes a portion of exon 2, exon 3, exon 4, exon 5, exon 6, and / or a portion of exon 7 of the mouse PLAUR gene.

19. The animal according to any one of claims 13 to 18, characterized in that The modified gene in the genome of the animal is homozygous or heterozygous for the endogenous replaced locus.

20. A non-human animal, characterized in that The animal comprises at least one cell that encodes a nucleotide sequence of a human or humanized PLAUR protein, wherein the humanized PLAUR protein comprises at least 50, 100, 150, 200, 250, 300, 310, 311, 312, 320, 330, 331, 332, 333, 334 or 335 consecutive amino acids that are identical to the corresponding region of a human.

21. The animal according to claim 20, characterized in that The human or humanized PLAUR protein comprises three homologous domains of the human PLAUR protein.

22. The animal according to claim 20 or 21, characterized in that The amino acid sequence of the human or humanized PLAUR protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence shown in SEQ ID NO:

10.

23. The animal according to any one of claims 20 to 22, characterized in that The nucleotide sequence encoding the human or humanized PLAUR protein is operably linked to an endogenous PLAUR regulatory element.

24. The animal according to any one of claims 20 to 23, characterized in that The nucleotide sequence encoding the corresponding region of human PLAUR can be integrated into the endogenous PLAUR locus of the animal.

25. The animal according to any one of claims 20 to 24, characterized in that The human or humanized PLAUR protein has at least one mouse PLAUR activity and / or human PLAUR activity.

26. A method for constructing a genetically modified non-human animal, characterized in that: In at least one cell of the animal, at the animal's endogenous PLAUR locus, a nucleotide sequence encoding an endogenous PLAUR region is replaced by a nucleotide sequence encoding a corresponding region of human PLAUR.

27. The method according to claim 26, characterized in that: The animal's endogenous PLAUR protein is not expressed or is expressed at a reduced level compared to PLAUR in wild-type animals.

28. The method according to claim 26 or 27, characterized in that The nucleotide sequence encoding the corresponding region of human PLAUR contains three homologous domains encoding human PLAUR protein.

29. The method according to any one of claims 26 to 28, characterized in that: The nucleotide sequence encoding the corresponding region of human PLAUR includes a portion of exon 2, exon 3, exon 4, exon 5, exon 6, and / or a portion of exon 7 of the human PLAUR gene.

30. The method according to any one of claims 26 to 29, characterized in that: The amino acid sequence encoded by the nucleotide sequence encoding the corresponding region of human PLAUR comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 10, 24-335.

31. The method according to any one of claims 26 to 30, characterized in that: The nucleotide sequence encoding the corresponding region of human PLAUR is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence shown in SEQ ID NO:

13.

32. The method according to any one of claims 26 to 31, characterized in that: The nucleotide sequence encoding the endogenous PLAUR region includes a portion of exon 2, exon 3, exon 4, exon 5, exon 6, and / or a portion of exon 7 of the mouse PLAUR gene.

33. The method according to any one of claims 26 to 32, characterized in that: The nucleotide sequence encoding the corresponding region of human PLAUR can be operably linked to an endogenous PLAUR regulatory element, such as a promoter.

34. The method according to any one of claims 26 to 33, characterized in that: The animal is a mammal, such as a monkey, rodent, mouse or rat.

35. The method according to any one of claims 26 to 34, characterized in that: The animal is a mouse.

36. A method for constructing genetically modified non-human animal cells expressing human or chimeric PLAUR, the method comprising replacing the nucleotide sequence encoding the endogenous PLAUR region at the endogenous mouse PLAUR locus with the nucleotide sequence of the corresponding region of human PLAUR, thereby producing genetically modified non-human animal cells, wherein the animal cells express human or chimeric PLAUR protein.

37. The method according to claim 36, wherein The human or chimeric PLAUR protein comprises three homologous domains of the human PLAUR protein.

38. The method according to claim 36 or 37, characterized in that The nucleotide sequence encoding the corresponding region of human PLAUR includes a portion of exon 2, exon 3, exon 4, exon 5, exon 6, and / or a portion of exon 7 of the human PLAUR gene.

39. The method according to any one of claims 36 to 38, characterized in that: The amino acid sequence encoded by the nucleotide sequence encoding the corresponding region of human PLAUR comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 10, 24-335.

40. The method according to any one of claims 36 to 39, characterized in that: The nucleotide sequence encoding the corresponding region of human PLAUR is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence shown in SEQ ID NO:

13.

41. The method according to any one of claims 36 to 40, characterized in that: The nucleotide sequence of the endogenous PLAUR comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, and / or a portion of exon 7 of the mouse PLAUR gene.

42. The method according to any one of claims 36 to 41, characterized in that: The nucleotide sequence encoding the human or chimeric PLAUR protein is operably linked to an endogenous PLAUR regulatory element, such as a promoter.

43. The method according to any one of claims 36 to 42, characterized in that: The non-human animal is a mouse.

44. The method according to any one of claims 26 to 34, characterized in that: The non-human animal also includes nucleotide sequences of human or chimeric proteins encoded by other genes, and the human or chimeric proteins are selected from at least one of PLAUR ligand (PLAU), IL1B, IL6, IL15, PD-1, PD-L1, TIGIT, LAG3, CD226, CTLA4 and TNF-α.

45. The method according to claim 44, characterized in that The human or chimeric protein is a human or chimeric PLAU protein.

46. ​​The method according to claim 44 or 45, characterized in that The human or chimeric PLAU protein comprises the full-length protein encoded by the human PLAU gene.

47. The method according to any one of claims 44 to 46, characterized in that: The amino acid sequence of the human or chimeric PLAU protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO:

2.

48. The method according to any one of claims 36 to 43, wherein: The non-human animal also includes nucleotide sequences of human or chimeric proteins encoded by other genes, wherein the human or chimeric protein is selected from at least one of PLAUR ligand (PLAU), IL1B, IL6, IL15, PD-1, PD-L1, TIGIT, LAG3, CD226, CTLA4 and TNF-α.

49. The method according to claim 48, characterized in that The human or chimeric protein is a human or chimeric PLAU protein.

50. The method according to any one of claims 48 or 49, characterized in that The human or chimeric PLAU protein comprises the full-length protein encoded by the human PLAU gene.

51. The method according to any one of claims 48 to 50, characterized in that: The amino acid sequence of the human or chimeric PLAU protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO:

2.

52. A genetically modified non-human animal, characterized in that The animal genome comprises at least one chromosome comprising a nucleotide sequence encoding a human or chimeric urokinase-type plasminogen activator (PLAU) protein.

53. The animal according to claim 52, characterized in that The nucleotide sequence encoding the human or chimeric PLAU protein is operably linked to regulatory elements (eg, endogenous 5'UTR and / or 3'UTR) of the endogenous PLAU locus on at least one chromosome.

54. The animal according to claim 52 or 53, characterized in that The amino acid sequence encoded by the nucleotide sequence encoding the human or chimeric PLAU protein comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identity to the amino acid sequence shown in SEQ ID NO:

2.

55. The animal according to any one of claims 52 to 54, characterized in that The animal is a mammal, such as a monkey, rodent, mouse or rat.

56. The animal according to any one of claims 52 to 55, characterized in that The animal is a mouse.

57. The animal according to any one of claims 52 to 56, characterized in that The animal's endogenous PLAUR protein is not expressed or is expressed at a reduced level compared to PLAU in wild-type animals.

58. The animal according to any one of claims 52 to 57, characterized in that One or more cells of the animal express human or chimeric PLAU protein.

59. The animal according to any one of claims 52 to 58, characterized in that One or more cells of the animal express human or chimeric PLAU protein, and endogenous PLAU receptor (PLAUR) can bind to the expressed human or chimeric PLAU protein to activate downstream signaling pathways.

60. The animal according to any one of claims 52 to 59, characterized in that One or more cells of the animal express human or chimeric PLAU protein, and human PLAU receptor (PLAUR) can bind to the expressed human or chimeric PLAU protein to activate downstream signaling pathways.

61. A genetically modified non-human animal, characterized in that The genome of the animal comprises a nucleotide sequence encoding the endogenous PLAU region at the endogenous PLAU locus, which is replaced by a nucleotide sequence encoding the corresponding region of human PLAU.

62. The animal according to claim 61, characterized in that The nucleotide sequence encoding the corresponding region of human PLAU is operably linked to the regulatory elements of the endogenous PLAU locus, and one or more cells of the animal express human or humanized PLAU protein.

63. The animal according to claim 61 or 62, characterized in that The animal's endogenous PLAUR protein is not expressed or is expressed at a reduced level compared to PLAU in wild-type animals.

64. The animal according to any one of claims 62-63, characterized in that The nucleotide sequence encoding the corresponding region of human PLAU includes a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or a portion of exon 11 of the human PLAU gene.

65. The animal according to any one of claims 62 to 64, characterized in that The nucleotide sequence encoding the corresponding region of human PLAU includes the entire nucleotide sequence of the human PLAU coding region.

66. The animal according to any one of claims 62-65, characterized in that The nucleotide sequence encoding the corresponding region of human PLAU is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence shown in SEQ ID NO:

7.

67. The animal according to any one of claims 62 to 66, characterized in that The nucleotide sequence encoding the corresponding region of human PLAU is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence shown in SEQ ID NO:

8.

68. The animal according to any one of claims 62 to 67, characterized in that The nucleotide sequence encoding the endogenous PLAU region includes a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or a portion of exon 11 of the mouse PLAU gene.

69. The animal according to any one of claims 62 to 68, characterized in that The modified gene in the genome of the animal is homozygous or heterozygous for the endogenous replaced locus.

70. A non-human animal, characterized in that The animal comprises at least one cell that encodes a nucleotide sequence of a human or humanized PLAU protein, wherein the humanized PLAU protein comprises at least 50, 100, 150, 200, 250, 300, 350, 400, 410, 420, 430, or 431 consecutive amino acids that are identical to a contiguous amino acid sequence of a corresponding region in a human.

71. The animal according to claim 70, characterized in that The amino acid sequence of the humanized PLAU protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence shown in SEQ ID NO:

2.

72. The animal according to claim 70 or 71, characterized in that The nucleotide sequence encoding the human or humanized PLAU protein is operably linked to an endogenous PLAU regulatory element.

73. The animal according to any one of claims 70 to 72, characterized in that The nucleotide sequence encoding the human or humanized PLAU protein can be integrated into the endogenous PLAU gene locus of the animal.

74. The animal according to any one of claims 70 to 73, characterized in that The humanized PLAU protein has at least one of mouse PLAU activity and / or human PLAU activity.

75. A method for constructing a genetically modified non-human animal, characterized in that: In at least one cell of the animal, at the animal's endogenous PLAU locus, a nucleotide sequence encoding an endogenous PLAU region is replaced by a nucleotide sequence encoding a corresponding region of human PLAU.

76. The method according to claim 75, characterized in that The non-human animal does not express endogenous PLAU protein or expresses it at a reduced level compared to PLAU in wild-type animals.

77. The method according to claim 75 or 76, characterized in that The nucleotide sequence encoding the corresponding region of human PLAU includes the entire sequence encoding human PLAU protein.

78. The method according to any one of claims 75-77, characterized in that The nucleotide sequence encoding the corresponding region of human PLAU includes a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or a portion of exon 11 of the human PLAU gene.

79. The method according to any one of claims 75 to 78, characterized in that The nucleotide sequence encoding the corresponding region of human PLAU comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence shown in SEQ ID NO:

2.

80. The method according to any one of claims 75 to 79, characterized in that: The nucleotide sequence encoding the corresponding region of human PLAU is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence shown in SEQ ID NO:

7.

81. The method according to any one of claims 75 to 80, characterized in that The nucleotide sequence encoding the endogenous PLAU region includes a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or a portion of exon 11 of the mouse PLAU gene.

82. The method according to any one of claims 75 to 81, characterized in that: The nucleotide sequence encoding the corresponding region of human PLAU can be operably linked to the regulatory elements of endogenous PLAU, such as a promoter.

83. The method according to any one of claims 75 to 82, characterized in that: The animal is a mammal, such as a monkey, a rodent, a mouse or a rat.

84. The method according to any one of claims 75 to 83, wherein: The animal is a mouse.

85. A method for constructing cells of a genetically modified non-human animal that expresses human or chimeric PLAU protein, the method comprising replacing a nucleotide sequence encoding an endogenous PLAU region at an endogenous mouse PLAU locus with a nucleotide encoding a corresponding region of human PLAU, thereby producing genetically modified non-human animal cells, wherein the animal cells express human or chimeric PLAU protein.

86. The method according to claim 85, characterized in that The nucleotide sequence encoding the corresponding region of human PLAU includes the entire sequence of human PLAU protein.

87. The method according to claim 85 or 86, characterized in that The nucleotide sequence encoding the corresponding region of human PLAU includes a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or a portion of exon 11 of the human PLAU gene.

88. The method according to any one of claims 85-87, characterized in that The amino acid sequence encoded by the nucleotide sequence encoding the corresponding region of human PLAU comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO:

2.

89. The method according to any one of claims 85-88, characterized in that The nucleotide sequence encoding the corresponding region of human PLAU is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence shown in SEQ ID NO:

7.

90. The method according to any one of claims 85-89, characterized in that The nucleotide sequence encoding the endogenous PLAU region includes a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or a portion of exon 11 of the mouse PLAU gene.

91. The method according to any one of claims 85 to 90, characterized in that: The animal is a mouse.

92. The method according to any one of claims 86 to 91, wherein: The nucleotide sequence encoding the human or chimeric PLAU protein is operably linked to a regulatory element of endogenous PLAU, such as a promoter.

93. The method according to any one of claims 75-84, characterized in that The animal also includes nucleotide sequences of human or chimeric proteins encoded by other genes, wherein the human or chimeric protein is selected from at least one of PLAU receptor (PLAUR), IL1B, IL6, IL15, PD-1, PD-L1, TIGIT, LAG3, CD226, CTLA4 and TNF-α.

94. The method according to claim 93, wherein The human or chimeric protein is a human or chimeric PLAUR protein.

95. The method according to claim 93 or 94, characterized in that The amino acid sequence of the human or chimeric PLAUR protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO:

14.

96. The method according to any one of claims 85 to 92, wherein: The animal also includes nucleotide sequences of human or chimeric proteins encoded by other genes, wherein the human or chimeric protein is selected from at least one of PLAU receptor (PLAUR), IL1B, IL6, IL15, PD-1, PD-L1, TIGIT, LAG3, CD226, CTLA4 and TNF-α.

97. The method according to claim 96, characterized in that The human or chimeric protein is a human or chimeric PLAUR protein.

98. The method according to claims 96-97, characterized in that The amino acid sequence of the human or chimeric PLAUR protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO:

14.

99. A method for determining the effectiveness of anti-PLAU and / or PLAUR therapeutic agents in treating cancer, characterized in that The method comprises: 1) administering an anti-PLAU and / or PLAUR therapeutic agent to the animal of any one of claims 1-25 and 52-74, wherein the animal has a tumor; 2) Determine the inhibitory effect of anti-PLAU and / or PLAUR therapeutic agents on tumors.

100. The method according to claim 99, wherein The tumor comprises one or more tumor cells, wherein the tumor cells are injected into the animal.

101. The method according to claim 99 or 100, characterized in that The determination of the inhibitory effect of the anti-PLAU / PLAUR therapeutic agent on tumors comprises measuring the tumor volume in the animal.

102. The method according to any one of claims 99-101, characterized in that The tumors include breast cancer, pancreatic cancer, endocrine cancer, head and neck cancer, gastrointestinal cancer, colorectal cancer, bladder cancer, non-small cell lung cancer, glioblastoma, prostate cancer, neuroendocrine tumor, mesothelial tumor, oropharyngeal tumor, female reproductive system cancer or meningioma.

103. A method for determining the effectiveness of anti-PLAU and / or PLAUR therapeutic agents and other therapeutic agents in treating cancer, characterized in that The method comprises: 3) administering an anti-PLAU and / or PLAUR therapeutic to the animal of any one of claims 1-25 and 52-74, wherein the animal has a tumor; 4) Determine the inhibitory effect of anti-PLAU and / or PLAUR therapeutic agents on tumors.

104. The method according to claim 103, characterized in that The animal also includes sequences encoding human or chimeric PD-1, human or chimeric PD-L1 and / or human or chimeric CTLA4.

105. The method according to claim 103 or 104, characterized in that The other therapeutic agent is an anti-PD-1 antibody, an anti-PD-L1 antibody and / or an anti-CTLA4 antibody.

106. The method according to any one of claims 103-105, characterized in that: The tumor contains one or more cells that express the PD-L1 protein.

107. The method according to any one of claims 103-106, characterized in that: The tumor comprises one or more tumor cells, wherein the tumor cells are injected into the animal.

108. The method according to any one of claims 103-107, characterized in that: The determination of the inhibitory effect of the anti-PLAU / PLAUR therapeutic agent on tumors comprises measuring the tumor volume in the animal.

109. The method according to any one of claims 103-108, characterized in that: The tumor is breast cancer, pancreatic cancer, endocrine cancer, head and neck cancer, gastrointestinal cancer, colorectal cancer, bladder cancer, non-small cell lung cancer, glioblastoma, prostate cancer, neuroendocrine tumor, mesothelial tumor, oropharyngeal tumor, female reproductive system cancer or meningioma.

110. A method for determining the effectiveness of anti-PLAU and / or PLAUR therapeutic agents in treating immune diseases, characterized in that: The method comprises: 2) administering an anti-PLAU and / or PLAUR therapeutic agent to the non-human animal of any one of claims 1-25 and 52-74, wherein the non-human animal suffers from an immune disease; 3) Determine the effects of anti-PLAU and / or PLAUR therapeutics in treating immune diseases.

111. The method according to claim 110, characterized in that The immune diseases are skin ulcers, rheumatoid arthritis, and stroke.

112. A method for determining the effectiveness of an anti-PLAU and / or PLAUR therapeutic agent in treating inflammation, characterized in that: The method comprises: 1) administering an anti-PLAU and / or PLAUR therapeutic agent to the animal of any one of claims 1-25 and 52-74, wherein the animal has inflammation; 2) Determine the effectiveness of anti-PLAU and / or PLAUR therapeutics for treating inflammation.

113. The method according to claim 112, characterized in that The inflammation is sepsis or inflammatory disease.

114. A method for determining the toxicity of an anti-PLAU and / or PLAUR therapeutic agent, characterized in that The method comprises: 1) administering an anti-PLAU and / or PLAUR therapeutic agent to an animal according to any one of claims 1-25 and 52-74; 2) Determine the effects of anti-PLAU and / or PLAUR therapeutics on animals.

115. The method according to claim 114, characterized in that Determining the effect of an anti-PLAU and / or PLAUR therapeutic on an animal involves measuring the animal's body weight, red blood cell count, hematocrit, and / or hemoglobin.

116. A humanized PLAUR protein, characterized in that The humanized protein contains three homologous domains of human PLAUR protein.

117. The humanized PLAUR protein according to claim 116, characterized in that The amino acid sequence of the humanized PLAUR protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence shown in positions 24-335 of SEQ ID NO:

10.

118. The humanized PLAUR protein according to claim 116 or 117, wherein The amino acid sequence of the humanized PLAUR protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence shown in SEQ ID NO:

15.

119. A humanized PLAUR gene, characterized in that The humanized PLAUR gene encodes the humanized protein according to any one of claims 116-118.

120. The humanized PLAUR gene according to claim 119, characterized in that The humanized PLAUR gene comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, and / or a portion of exon 7 of the human PLAUR gene.

121. The humanized PLAUR gene according to claim 119 or 120, characterized in that The humanized PLAUR gene comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence shown in SEQ ID NO:

14.

122. A humanized PLAU protein, characterized in that The humanized PLAU protein comprises all or part of the human PALU protein.

123. The humanized PLAU protein according to claim 122, characterized in that The amino acid sequence of the humanized PLAU protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence shown in SEQ ID NO:

2.

124. A humanized PLAU gene, characterized in that The humanized PLAU gene encodes the humanized protein according to any one of claims 123-124.

125. The humanized PLAU gene according to claim 124, characterized in that The humanized PLAU gene comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and / or a portion of exon 11 of the human PLAU gene.

126. The humanized PLAU gene according to claim 125 or 126, characterized in that The humanized PLAU gene comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence shown in SEQ ID NO:

8.

127. A cell, characterized in that The cell contains the humanized PLAUR gene of any one of claims 119-121 and / or the humanized PLAU gene of any one of claims 124-126, and / or the cell expresses the humanized PLAUR protein of any one of claims 116-118 and / or the humanized PLAU protein of any one of claims 122-123.

128. An animal model, characterized in that The animal model comprises the humanized PLAUR gene of any one of claims 119-121 and / or the humanized PLAU gene of any one of claims 124-126, and / or the animal model expresses the humanized PLAUR protein of any one of claims 116-118 and / or the humanized PLAU protein of any one of claims 122-123.

Images