A monoclonal antibody against abrin toxin and its application
By developing anti-acacia cotoxin monoclonal antibodies with high identity amino acid sequence and mutant Fc region, the problems of poor prevention and treatment of acacia cotoxin poisoning and short antibody half-life in the prior art were solved, and efficient neutralization and long-term therapeutic effects were achieved.
Patent Information
- Application Number
- CN202411836005.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-13
- Publication Date
- 2025-06-13
- Estimated Expiration
- 2044-12-13
AI Technical Summary
The prior art is difficult to effectively prevent and treat acacia toxin poisoning, and the existing antibodies have short half-life and the therapeutic effect is not long-lasting enough.
A monoclonal antibody against acacia toxin was developed, with high identity of the amino acid sequences of the heavy and light chain variable regions, combining with the mutant Fc region, prolonging the retention time of the antibody in vivo.
It achieves efficient neutralization and long-term therapeutic effects on acacia toxin, significantly improves the half-life of the antibody in the body, and enhances the durability of the treatment.
Smart Images

Figure CN119320448B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biomedicine, and particularly relates to a monoclonal antibody against abrinus toxin and application thereof. Background Art
[0002] Abrin, also known as chicken pearl toxin, is a highly toxic substance found in the abrin plant. Abrin, also known as chicken pearl, has brightly colored seeds with a striking combination of red and black. It is about the same size as mung beans and looks like a chicken eye from a distance, hence the name "chicken pearl". Abrin is mainly found in the cotyledons of the seeds and is a toxic protein. This toxin can enter the body's cells, disrupt the production of protein by the cells, and eventually lead to cell death. After accidentally ingesting abrin protein, symptoms of poisoning may appear hours or even days after ingestion. The main manifestations are loss of appetite, nausea, vomiting, abdominal pain, diarrhea, difficulty breathing, cyanosis of the skin, circulatory system failure and oliguria, and finally hemolysis and hematuria, gradually presenting respiratory asphyxiation and death.
[0003] There are four isoabrins of abrin toxin, namely abrin-a, abrin-b, abrin-c, and abrin-d, with relative molecular masses ranging from 63ku to 67ku. They are encoded by different genes in the same gene family. Among them, abrin-b and abrin-c have only weak cytotoxic effects due to their low B-chain agglutination activity; while abrin-a and abrin-d are extremely cytotoxic, with an LD50 of 0.04μg / kg in mice and a lethal dose of 0.1μg / kg to 1.0μg / kg for adults. Summary of the invention
[0004] In order to solve the technical problems existing in the prior art, the present invention provides the following technical solutions.
[0005] The present invention provides a monoclonal antibody against Abrinus chinensis toxin, comprising heavy chain variable region complementary determining regions CDR1, CDR2, and CDR3 having at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the amino acid sequences shown in SEQ ID NOs: 1, 2, and 3, and light chain variable region complementary determining regions CDR1, CDR2, and CDR3 having at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the amino acid sequences shown in SEQ ID NOs: 9, 10, and 11.
[0006] Further, the amino acid sequences of the complementarity determining regions CDR1, CDR2, and CDR3 of the heavy chain variable region are shown as SEQ ID NO:1, 2, and 3 respectively, and the amino acid sequences of the complementarity determining regions CDR1, CDR2, and CDR3 of the light chain variable region are shown as SEQ ID NO:9, 10, and 11 respectively.
[0007] Further, the monoclonal antibody also includes heavy chain variable region framework regions FR1, FR2, FR3, and FR4 having at least 90%, at least 92%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity with the amino acid sequences shown as SEQ ID NO:4, 5, 6, and 7, and light chain variable region framework regions FR1, FR2, FR3, and FR4 having at least 90%, at least 92%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity with the amino acid sequences shown as SEQ ID NO:12, 13, 14, and 15.
[0008] Further, the amino acid sequences of the heavy chain variable region framework regions FR1, FR2, FR3, and FR4 are shown as SEQ ID NO:4, 5, 6, and 7 respectively,
[0009] and the amino acid sequences of the light chain variable region framework regions FR1, FR2, FR3, and FR4 are shown as SEQ ID NO:12, 13, 14, and 15 respectively.
[0010] Further, the heavy chain variable region of the monoclonal antibody has an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 93%, 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity with the amino acid sequence shown as SEQ ID NO:8,
[0011] and the light chain variable region has an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 93%, 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity with the amino acid sequence shown as SEQ ID NO:16.
[0012] Further, the heavy chain variable region of the monoclonal antibody has the amino acid sequence shown as SEQ ID NO:8, and the light chain variable region has the amino acid sequence shown as SEQ ID NO:16.
[0013] Further, the monoclonal antibody includes a heavy chain constant region having the amino acid sequences shown as SEQ ID NO:17, 18, and 19.
[0014] In some embodiments, a monoclonal antibody (monoclonal Ab, mAB, monoclonal antibody) or antibody refers to an antibody molecule with a single molecular composition, obtained from a group of substantially identical antibodies. An antibody comprises two heavy (H) chains and two light (L) chains. Mammalian heavy chains consist of a variable region (VH) and first, second, third, and optionally a fourth constant region (CH1, CH2, CH3, CH4, respectively); mammalian light chains consist of a variable region (VL) and a constant region. An antibody has a Y shape, where the stem of the Y is composed of the second and third constant regions of the two heavy chains joined together by disulfide bonds. Each arm of the Y includes the variable region and the first constant region of a single heavy chain that binds to the variable region and the constant region of a single light chain. The variable regions of the light and heavy chains are responsible for antigen binding. The variable regions in both chains generally contain three highly variable loops, called complementarity determining regions (CDR); the light chain CDR includes LCDR1, LCDR2, and LCDR3, and the heavy chain CDR includes HCDR1, HCDR2, and HCDR3. The variable regions of the light and heavy chains also include framework regions (FR); the light chain FR includes LFR1, LFR2, LFR3, and LFR4, and the heavy chain FR includes HFR1, HFR2, HFR3, and HFR4. The constant regions of the heavy and light chains do not participate in antigen binding but exhibit various effector functions. Antibodies are classified based on the amino acid sequence of the constant region of the antibody heavy chain.
[0015] In some embodiments, the monoclonal antibodies described in the present invention are non-fucosylated. In some embodiments, fucosylation refers to the presence of fucose residues within the oligosaccharides attached to the peptide backbone of the antibody. Specifically, fucosylated antibodies contain α(1,6)-linked fucose at the innermost N-acetylglucosamine (GlcNAc) residue of one or both of the N-linked oligosaccharides attached to the Fc region of the antibody, such as at position Asn 297 (EU numbering of Fc region residues) of the human IgG1 Fc domain. Due to minor sequence variations in immunoglobulins, Asn 297 can also be located approximately +3 amino acids upstream or downstream of position 297, i.e., between positions 294 and 300. Non-fucosylated or fucose-deficient antibodies include glycosylated antibody variants of the following Fc regions, where the carbohydrate structure attached to the Fc region has reduced fucose or lacks fucose.
[0016] In some embodiments, the monoclonal antibody further comprises immunoglobulins and immunoglobulin fragments, whether natural or produced in part or in whole synthetically (e.g., recombinantly), and any fragment that retains the binding specificity of the full-length immunoglobulin and at least comprises a partial variable region of the immunoglobulin molecule. Thus, an antibody includes any protein having a binding domain that is homologous or substantially homologous to the immunoglobulin antigen-binding domain (antibody-binding site).
[0017] The present invention provides a method for detecting abrin in a sample, the method comprising contacting the aforementioned monoclonal antibody with the sample to be tested and detecting the level or presence or absence of abrin in the sample to be tested.
[0018] Furthermore, the method is for non-diagnostic purposes.
[0019] The present invention provides the use of the aforementioned monoclonal antibody in detecting abrin.
[0020] Furthermore, the use is for non-diagnostic purposes.
[0021] The present invention provides the use of the aforementioned monoclonal antibody in the preparation of a product for detecting abrin.
[0022] Furthermore, the product includes a probe, test strip, kit, chip.
[0023] The present invention provides the use of the aforementioned monoclonal antibody in neutralizing abrin.
[0024] Furthermore, the use is for non-therapeutic and non-diagnostic purposes.
[0025] The present invention provides the use of the aforementioned monoclonal antibody in the preparation of a pharmaceutical composition for neutralizing abrin.
[0026] The present invention provides the use of the aforementioned monoclonal antibody in the preparation of a pharmaceutical composition for the long-term treatment of abrin.
[0027] In some embodiments, the antibody of the present invention using a mutant Fc region has an improved half-life, a longer residence time in the body or cells, and has a more long-lasting therapeutic effect.
[0028] The present invention provides a substance according to any of the following.
[0029] The present invention provides a nucleic acid encoding the aforementioned monoclonal antibody.
[0030] Furthermore, the nucleotides encoding the constant region of the heavy chain of the monoclonal antibody are as shown in SEQ ID NO:20 and 21.
[0031] The present invention provides a vector, which comprises the nucleic acid described above.
[0032] Furthermore, the vector further comprises a transcriptional promoter, an enhancer, or a stabilizing sequence.
[0033] Furthermore, the vector further comprises a tag sequence for localization or purification.
[0034] In the present invention, a transcriptional promoter, an enhancer, or a stabilizing sequence allows the selection and maintenance of transformed cells. In some cases, an origin of replication can be used to amplify the copy number of the vector in the cells. The vector may also comprise additional nucleotide sequences, which are operably linked to the linked nucleic acid molecule.
[0035] In some embodiments, the vector includes common plasmid vectors or viral vectors. In more specific embodiments, viral vectors include retroviruses, adenoviruses, parvoviruses (such as adeno-associated viruses), coronaviruses, negative-strand RNA viruses (such as orthomyxoviruses (such as influenza viruses), rhabdoviruses (such as rabies and vesicular stomatitis viruses), paramyxoviruses (such as measles and Sendai viruses)), positive-strand RNA viruses (such as picornaviruses and alphaviruses), and double-stranded DNA viruses, including adenoviruses, herpesviruses (such as herpes simplex virus types 1 and 2, Epstein-Barr virus, and cytomegalovirus), and poxviruses (such as vaccinia, fowlpox, and canarypox). Other viruses include, but are not limited to, Norwalk virus, togavirus, flavivirus, reovirus, papillomavirus, hepatitis virus, and hepadnavirus. Examples of retroviruses include avian leukosis-sarcoma, mammalian type C, type B viruses, type D viruses, HTLV-BLV group, lentiviruses, or foamy viruses. As non-limiting examples, vectors that can be used in the present invention include, but are not limited to, pQE-12, pUC-series, pBluescript (Stratagene), pET-series expression vectors (Novagen), or pCRTOPO (Invitrogen), λgt11, pJOE, pBBR1-MCS series, pJB861, pBSMuL, pBC2, pUCPKS, pTACT1, pTRE, pCAL-n-EK, pESP-1, pOP13CAT, E-027pCAGKosak-Cherry (L45a) vector system, pREP (Invitrogen), pCEP4 (Invitrogen), pMC1neo (Stratagene), pXT1 (Stratagene), pSG5 (Stratagene), EBO-pSV2neo, pBPV-1, pdBPVMMTneo, pRSVgpt, pRSVneo, pSV2-dhfr, pIZD35, Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pRc / CMV, pcDNA1, pcDNA3 (Invitrogen), pcDNA3.1, pSPORT1 (GIBCO BRL), pGEMHE (Promega), pLXIN, pSIR (Clontech), pIRES-EGFP (Clontech), pEAK-10 (EdgeBiosystems), pTriEx-Hygro (Novagen), and pCINeo (Promega).
[0036] The present invention provides cells, which include the nucleic acids and / or the vectors described above.
[0037] Further, the cell is a host cell, including animal cells, plant cells, fungal cells, and prokaryotic cells.
[0038] Further, the animal cells include mammalian cells.
[0039] Further, the mammals include humans or non-human mammals.
[0040] Further, the non-human mammals include mice, rats, guinea pigs, dogs, monkeys, pigs, rabbits, cats, horses, cows, sheep, donkeys, and camels.
[0041] The host cells that can be used in the present invention include eukaryotic or prokaryotic cells such as mammalian cells (e.g., human, monkey, rabbit, rat, hamster, or mouse cells), plant cells, yeast cells, insect cells, and bacterial cells (such as Escherichia coli (E. coli)) that can replicate and / or express polynucleotides. Preferably, the vector for transforming the host cell includes at least one selectable marker operably linked to a suitable promoter so that the polynucleotide can be expressed in the host cell.
[0042] In some embodiments, the cells are suitable for receiving, retaining, replicating, and amplifying vectors. For example, Escherichia coli suitable for plasmids includes, but is not limited to, DH5α, BL21DE3, BL21DE3pLysS, JM109, TOP10. The cells can actually be any cells in which an expression vector can be used. Including prokaryotic cells, eukaryotic cells, the prokaryotic cells include, but are not limited to, eubacteria, such as Gram-negative or Gram-positive organisms, for example, Enterobacteriaceae, such as Escherichia, for example, Escherichia coli (DH5α, BL21DE3, BL21DE3pLysS, JM109, TOP10, HB101, SCS110, E. coli JM110); Enterobacter; Erwinia; Klebsiella; Proteus; Salmonella, such as Salmonella typhimurium; Serratia, such as Serratia marcescens; and Shigella, as well as Bacilli, such as Bacillus subtilis and Bacillus licheniformis; Pseudomonas, such as Pseudomonas aeruginosa; and Streptomyces.
[0043] The present invention provides derivatives, which include the aforementioned monoclonal antibody or a detectable reagent conjugated thereto.
[0044] Furthermore, the detectable reagent includes fluorescent dyes, radioactive labels, metal ions, enzymes, magnetic beads, and colorimetric labels.
[0045] In some embodiments, the detectable reagent can be any substance having detectable physical or chemical properties. Such detectable reagents have been well developed in the field of immunoassays, and generally, most of the labels useful in such methods can be applied to the provided methods. Thus, the label can be any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical, or chemical means. Detectable reagents include, but are not limited to, fluorescent dyes (e.g., fluorescein isothiocyanate, Texas Red, rhodamine, etc.), radioactive labels (e.g., 3H, 125I, 35S, 14C, or 32P), particularly, radioactive labels (e.g., 157Gd, 55Mn, 162Dy, 52Cr, and 56Fe), metal ions (e.g., 111In, 97Ru, 67Ga, 68Ga, 72As, 89Zr, and 201Tl), enzymes (e.g., horseradish peroxidase, alkaline phosphatase, and other enzymes commonly used in ELISAs), electron transfer agents (e.g., including metal-binding proteins and compounds), luminescent and chemiluminescent labels (e.g., luciferin and 2,3-dihydrophtahlazinediones, e.g., luminol), magnetic beads (e.g., DYNABEADSTM), and colorimetric labels, such as colloidal gold or colored glass or plastic beads (e.g., polystyrene, polypropylene, latex).
[0046] The present invention provides a product, which includes the aforementioned monoclonal antibody.
[0047] Furthermore, the product includes a probe, a test strip, a kit, and a chip.
[0048] Furthermore, the kit includes a buffer, a blocking reagent, a washing reagent, an enzyme substrate, and / or a solid support.
[0049] The present invention uses the term "probe" to refer to a structure including a polynucleotide that contains a nucleic acid sequence complementary to the nucleic acid sequence present in a target nucleic acid analyte (e.g., a nucleic acid amplification product). The polynucleotide region of the probe can be composed of DNA and / or RNA and / or synthetic nucleotide analogs. The length of the probe is usually compatible with all or part of the target sequence for specifically detecting the target nucleic acid.
[0050] The present invention uses the term "chip", also known as "array", to refer to a solid support containing linked nucleic acid or peptide probes. An array typically contains a variety of different nucleic acid or peptide probes attached to the surface of a substrate at different known positions. These arrays, also known as "microarrays", can generally be produced using mechanical synthesis methods or light-directed synthesis methods, which combine a combination of photolithography methods and solid-phase synthesis methods. The array can comprise a flat surface, or can be nucleic acid or peptide on beads, gels, polymer surfaces, fibers such as optical fibers, glass, or any other suitable substrate. The array can be packaged in a manner that allows for the diagnosis or other manipulation of a fully functional device.
[0051] The present invention provides a pharmaceutical composition comprising the monoclonal antibody described above, the nucleic acid described above, the vector described above, the cell described above, and the derivative described above.
[0052] Furthermore, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.
[0053] In some embodiments, the excipients include, but are not limited to, water, buffers, saline solutions, phosphate buffered saline solutions, various types of wetting agents, sterile solutions, alcohols, gum arabic, vegetable oils, benzyl alcohol, gelatin, glycerol, carbohydrates (such as lactose, sucrose, amylose or starch), magnesium stearate, talc, silicic acid, viscous paraffin, aromatic oils, fatty acid monoglycerides and diglycerides, pentaerythritol fatty acid esters, hydroxyethyl cellulose, powders, and the like.
[0054] In some embodiments, the pharmaceutical composition may contain other additives, including, for example, antioxidants, preservatives, antimicrobial agents, analgesics, binders, disintegrants, colorants, diluents, excipients, extenders, glidants, solubilizers, stabilizers, tonicity agents, vehicles, thickeners, flavoring agents, emulsions (such as oil / water emulsions), emulsifying and suspending agents (such as gum arabic, agar, alginic acid, sodium alginate, bentonite, carbomer, carrageenan, carboxymethyl cellulose, cellulose, cholesterol, gelatin, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, methyl cellulose, octoxynol 9, oleyl alcohol, polyvinylpyrrolidone, propylene glycol monostearate, sodium lauryl sulfate, sorbitan esters, stearyl alcohol, tragacanth, xanthan gum and their derivatives), solvents, and various components such as crystalline cellulose, microcrystalline cellulose, citric acid, dextrin, glucose, liquid glucose, lactic acid, lactose, magnesium chloride, potassium metaphosphate, starch.
[0055] In some embodiments, the pharmaceutical composition uses components that do not significantly disrupt the biological properties of the antibody or its antigen-binding fragment, such as binding to its specific epitope, and each component is pharmaceutically and physiologically acceptable in the sense that it is compatible with other ingredients and does not harm the patient.
[0056] In some embodiments, the dosage forms of the pharmaceutical composition include, but are not limited to, tablets, pills, powders, liquid solutions or suspensions (e.g., including injectable, absorbable, and topical preparations (e.g., eye drops, gels, or ointments), aerosols (e.g., nasal sprays), liposomes, suppositories, injectable and perfusable solutions, and sustained-release forms.
[0057] The present invention provides a method for preparing the monoclonal antibody described above, the method comprising the steps of culturing the cell described above and recovering the monoclonal antibody.
[0058] As used herein, "treatment / therapy" (and its grammatical variants) refers to a clinical intervention that attempts to alter the natural course of the individual being treated, which can be for prophylaxis or during the course of a clinical pathology. Desired effects of treatment include, but are not limited to, preventing the occurrence or recurrence of a disease, alleviating symptoms, attenuating any direct or indirect pathological consequences of the disease, preventing metastasis, slowing the rate of disease progression, improving or alleviating the disease state, and obviating or improving the prognosis. Description of the Drawings
[0059] Figure 1 It is the SDS-PAGE electrophoresis diagram of Ab, Ab-5, and Ab-6. Lane 1: Marker; Lane 2: Reducing electrophoresis band of Ab; Lane 3: Reducing electrophoresis band of Ab-5; Lane 4: Reducing electrophoresis band of Ab-6; Lane 5: Non-reducing electrophoresis band of Ab; Lane 6: Non-reducing electrophoresis band of Ab-5; Lane 7: Non-reducing electrophoresis band of Ab-6.
[0060] Figure 2 It is the diagram of the binding ability of Ab, Ab-5, and Ab-6 to the antigen detected by ELISA.
[0061] Figure 3 It is the diagram of the neutralization effect results of Ab, Ab-5, and Ab-6 antibodies at the cellular level.
[0062] Figure 4 It is the diagram of the neutralization effect results of Ab, Ab-5, and Ab-6 antibodies in a mouse model, wherein, A: Survival curve of mice challenged with toxin; B - C: Protective survival curves of the three antibodies in the LD100 of mice challenged with toxin. The antibody doses are 10 μg / kg (B) and 1 μg / kg (C) (n = 5).
[0063] Figure 5It is a graph showing the pharmacokinetic (A) and pharmacodynamic (B) results of antibody HM in human FcRn transgenic mice. Among them, A: The curve of antibody concentration changing with time in transgenic mice, with an initial injection of 500 μg / mouse (n = 5). B: On the 55th day after antibody injection, a lethal dose of toxin (13 μg / kg) was injected into hFCRN mice, and the survival curves of each group of mice in the three antibody groups (N = 5) were different. Detailed implementation mode
[0064] Example 1
[0065] 1. Experimental method
[0066] In the early stage of the experiment, the Fc region was modified by computer-aided design, and the gene sequences of two improved Fc region mutants, Fc5 and Fc6, were obtained. Two enzyme cleavage sites, NotI and PmeI, were introduced at both ends of the target gene. These genes were synthesized by Azenta Life Science, and then the unmutated and mutated Fc regions were respectively synthesized with the heavy chain variable region and light chain variable region genes to obtain the Ab antibody with unmutated Fc, as well as the Ab-5 antibody and Ab-6 antibody with mutated Fc. Then they were cloned into the antibody expression vector. The specific sequences are shown in Table 1.
[0067] Table 1
[0068]
[0069]
[0070] The nucleotide sequence of the Fc region mutant Fc5 is shown as follows:
[0071] GAACCTAAATCCTCCGACAAAACTCACACATGCCCACCGTGCCCAGCACCT
[0072] GAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGA
[0073] CACCCTCTACATCACCCGGGAGCCCGAGGTCACATGCGTGGTGGTGGACGT
[0074] GAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGG
[0075] AGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCAC
[0076] GTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGG
[0077] CAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCG
[0078] AGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTAC
[0079] ACCCTGCCCCCATCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGAC
[0080] CTGCCTGGTCAAAGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAGA
[0081] GCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGAC
[0082] TCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGGACAAGAGCAG
[0083] GTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAATGA(SEQ ID NO:20)。
[0084] The nucleotide sequence of the Fc region mutant Fc6 is shown as follows:
[0085] GAACCTAAATCCTCCGATAAGACCCACACCTGTCCCCCCTGCCCTGCTCCT
[0086] GAATTGTTGGGAGGCCCCTCCGTGTTCCTGTTTCCCCCTAAGCCCAAGGAC
[0087] ACCCTGATGATTTCCCGGACCCCCGAGGTGACCTGCGTTGTTGTTGATGTC
[0088] TCCCACGAGGACCCCGAAGTGAAGTTTAACTGGTACGTTGACGGCGTTGA
[0089] AGTCCACAACGCCAAAACCAAACCCCGGGAGGAACAGTACAATTCTACCT
[0090] ACAGGGTGGTGTCCGTGCTGACCGTGCTGCATCAGGACTGGCTGAACGGC
[0091] AAGGAGTATAAGTGTAAGGTGTCCAACAAGGCCCTGCCAGCCCCTATTGAG
[0092] AAGACCATCTCCAAAGCCAAGGGTCAGCCCAGGGAACCACAGGTTTACAC
[0093] CCTGCCCCCCTCCAGAGACGAACTGACAAAGAACCAGGTGAGCCTGACCT
[0094] GCCTCGTGAAGGGATTTTACCCCTCCGACATCGCCGTGGAATGGGAGTCAA
[0095] ATGGCCAGCCCGAGAACAACTACAAGACCACACCCCCCGTCCTCGACTCC
[0096] GATGGAAGTTTCTTCCTCTATAGTAAGCTGACCGTGGACAAGTCCAGGTGG
[0097] CAGCAGGGTAACGTCTTCAGCTGCTCCGTGCTGCACGAGGCTCTGCATTCTCACTATACCCAGAAGAGCCTGTCCTTGTCCCCCGGAAAATGA(SEQ ID NO:21).
[0098] Thaw ExpiCHO-S TM cells into a 125 mL shake flask containing ExpiCHO 2 expression medium pre-warmed in a 37 °C, 8% CO TM incubator until the cell density reaches 4×10 6 -6×10 6 mL -1 . Dilute the cells to 0.2×10 6~0.3×10 6 mL -1 , continue the incubation.
[0099] One day before transfection, adjust the cell density to 3×10 6 , and on the day of transfection, adjust it to 6×10 6 mL -1 . Plasmid DNA (100 μg in 100 -1 mL -1 ) and ExpiFectamine TM CHO transfection reagent (320 μL) are diluted in cold OptiPRO TM SFM medium. After mixing and incubating at room temperature for 5 minutes, the complex is slowly added to the cell suspension and gently mixed. 18 - 22 hours after transfection, add ExpiFectamine TM CHO Enhancer (600 μL) and ExpiCHO TM Feed (24 mL).
[0100] After culturing for 8 days, harvest the antibody protein from the culture supernatant. Initially, purify it using a HiTrap MabSelet protein A column, elute it with 150 nM acetic acid on an Akta purification system, and store it in PBS. The antibody concentration is determined by the BSA concentration assay method, and the preliminary identification of the antibody is completed by SDS electrophoresis.
[0101] ELISA for detecting the antibody expression level: Select an ELISA plate with good adsorption performance, low blank value, and high bottom transparency of the wells. Dilute the antigen to an appropriate concentration (such as 2 μg / ml) using a coating buffer (such as pH 7.2 - 7.4 phosphate buffer), add a certain volume (such as 0.1 ml) to each well, and coat it overnight at 4℃ or for 2 hours at 37℃. After coating, block the non - specific binding sites with a blocking solution (such as 5% BSA) to reduce background noise, add a certain volume (such as 0.25 ml) to each well, and block it at 37℃ for 1 - 2 hours. Add the diluted test sample or standard product, a certain volume (such as 0.1 ml) to each well, and incubate it at 37℃ for 1 hour. Wash 3 times with a washing buffer (such as PBST), 3 minutes each time, to remove the unbound sample. Add the enzyme - labeled secondary antibody, a certain volume (such as 0.1 ml) to each well, and incubate it at 37℃ for 30 - 60 minutes. Wash again 3 times with the washing buffer, 3 minutes each time, to remove the unbound enzyme - labeled antibody. Add the enzyme substrate (such as TMB), a certain volume (such as 0.1 ml) to each well, and incubate it at 37℃ for 10 - 30 minutes. Add the stop solution (such as 2M sulfuric acid), a certain volume (such as 0.05 ml) to each well, to terminate the enzyme reaction. Use an enzyme - linked immunosorbent assay reader to measure the absorbance (OD value) of each well at a wavelength of 450 nm, and calculate the concentration of the antibody in the sample according to the standard curve.
[0102] 2. Experimental Results
[0103] The SDS-PAGE results are as Figure 1 shown, indicating that the antibody has excellent purity.
[0104] Under the conditions of an initial concentration of 20 μg / mL and a 3-fold dilution, the affinity of antibody Abs for solid-coated antigen was determined by indirect ELISA. As Figure 2 shown, antibody Abs can specifically recognize the antigen, this binding is dose-dependent, and the mutant antibody also has good binding activity.
[0105] Example 2 Verification of the Therapeutic Functions of Ab Antibody, Ab-5 Antibody, and Ab-6 Antibody
[0106] 1. Antibody Neutralization Experiment at the Cellular Level
[0107] Jurkat cells were selected as the cell model for identifying the in vitro neutralization and protection experiment of the antibody. The toxin challenge concentration was set at 1 ng / mL, and the antibody to be tested was serially diluted with 1640 medium (starting from 50 μg / mL, 5-fold dilution); the diluted antibody samples and the toxin were added to the cell wells simultaneously, 25 μL / well each; a cell positive control without toxin and a blank medium control without cells were set. After co-incubating in a constant temperature incubator for 48 h, the cell viability was detected using a CCK-8 kit.
[0108] The addition of the antibody can effectively inhibit the killing effect of the toxin on the cells, and the mutant antibody has the same effect of neutralizing the toxin and thus inhibiting its eukaryotic cell killing function. The results are as Figure 3 shown.
[0109] 2. Mouse Toxin Neutralization Experiment
[0110] To further verify the neutralizing effect of the antibody on the toxin, 16-18 g human mice (8 weeks old) were selected for the toxin challenge dose test. The toxin stored in the laboratory was diluted to a series of concentrations, and each mouse was intraperitoneally injected with 100 μL of the toxin. Then, the survival status and mortality of the mice were observed. The survival curve of the mice is as Figure 4 A: shown, and a dose of 20 μg / kg can be set as the lethal dose (LD100) of the toxin in the mouse model.
[0111] The neutralizing activity of the antibody was verified in mice through the toxin challenge test. Different concentrations of the antibody (10 μg / kg -1 , 1 μg / kg) were intraperitoneally injected into mice together with 100 μL of the toxin LD100. The PBS + toxin group was used as the control group, and the survival of the poisoned mice was observed. As Figure 4As shown in B-C, all mice in the high-concentration 10 μg / kg group survived, while only about 50% of the mice in the low-concentration 1 μg / kg antibody group were protected, reflecting the dose-dependent protective effect of the antibody in vivo.
[0112] 3. Pharmacokinetics and pharmacodynamics detection of mice
[0113] In human FcRn transgenic mice, 500 μg of antibody was injected into the mice on the first day, and the antibody concentration in the serum was measured at different time points by sandwich ELISA. As Figure 5 shown in A, the half-lives of Ab-5 and Ab-6 were longer than that of the parental antibody. On the 55th day after injection, a lethal dose of toxin was intraperitoneally injected into the mice. As Figure 5 shown in B, both Ab-5 and Ab-6 could effectively protect the mice from death, while all mice in the Ab group died within 72 hours, and all the control mice without antibody inoculation died within 48 hours. The results showed that Ab-5 and Ab-6 could effectively prolong the residence time in vivo under the same initial conditions, thus shortening the dosing interval.
Claims
1. A monoclonal antibody against Abrinus scabra toxin, comprising amino acid sequences of heavy chain variable region complementary determining regions CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 1, 2, and 3, respectively, and amino acid sequences of light chain variable region complementary determining regions CDR1, CDR2, and CDR3 as shown in SEQ ID NOs: 9, 10, and 11, respectively.
2. The monoclonal antibody according to claim 1, further comprising a heavy chain variable region framework region FR1, FR2, FR3, FR4 having at least 90%, at least 92%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 4, 5, 6, 7, And light chain variable region framework regions FR1, FR2, FR3, and FR4 having at least 90%, at least 92%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the amino acid sequences shown in SEQ ID NOs: 12, 13, 14, and 15.
3. The monoclonal antibody according to claim 2, wherein the amino acid sequences of the heavy chain variable region framework regions FR1, FR2, FR3, and FR4 are as shown in SEQ ID NOs: 4, 5, 6, and 7, respectively. The amino acid sequences of the light chain variable region framework regions FR1, FR2, FR3, and FR4 are shown in SEQ ID NOs: 12, 13, 14, and 15, respectively.
4. The monoclonal antibody according to claim 1, wherein the heavy chain variable region of the monoclonal antibody has an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 93%, 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to the amino acid sequence shown in SEQ ID NO: 8, The light chain variable region has an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 93%, 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence shown in SEQ ID NO:
16. 5 . The monoclonal antibody according to claim 1 , wherein the heavy chain variable region of the monoclonal antibody has the amino acid sequence shown in SEQ ID NO: 8, and the light chain variable region of the monoclonal antibody has the amino acid sequence shown in SEQ ID NO:
16. 6 . The monoclonal antibody according to claim 1 , comprising a heavy chain constant region having an amino acid sequence as shown in any one of SEQ ID NOs: 17, 18, and 19.
7. A method for detecting abrin in a sample, the method comprising contacting the monoclonal antibody according to any one of claims 1 to 6 with the sample to be tested, and detecting the level or presence of abrin in the sample to be tested; the method is a method for non-diagnostic purposes.
8. Use of the monoclonal antibody according to any one of claims 1 to 6 in detecting Abrinus sibiricum toxin; the use is for non-diagnostic purposes.
9. Use of the monoclonal antibody according to any one of claims 1 to 6 in the preparation of a product for detecting abrin toxin.
10. The use according to claim 9, wherein the product comprises a probe, a test paper, a test kit, or a chip.
11. Use of the monoclonal antibody according to any one of claims 1 to 6 in neutralizing Abrinus sibiricum toxin; the use is for non-therapeutic and non-diagnostic purposes.
12. Use of the monoclonal antibody according to any one of claims 1 to 6 in the preparation of a pharmaceutical composition for neutralizing Abrinus sibiricum toxin.
13. Use of the monoclonal antibody according to any one of claims 1 to 6 in the preparation of a pharmaceutical composition for long-term treatment of abrin poisoning.
14. A nucleic acid encoding the monoclonal antibody according to any one of claims 1 to 6. 15 . The nucleic acid according to claim 14 , wherein the nucleotide encoding the heavy chain constant region of the monoclonal antibody is shown as SEQ ID NO: 20 or SEQ ID NO:
21.
16. A vector comprising the nucleic acid of claim 14 or 15.
17. The vector according to claim 16, further comprising a transcription promoter, an enhancer, or a stabilizing sequence. The vector according to claim 16 , further comprising a tag sequence for localization or purification.
19. A cell comprising the nucleic acid of claim 14 or 15 or the vector of any one of claims 16 to 18.
20. The cell according to claim 19, which is an animal cell.
21. The cell of claim 20, wherein the animal cell comprises a mammalian cell.
22. The cell of claim 21, wherein the mammal comprises a human or a non-human mammal.
23. The cell according to claim 22, wherein the non-human mammal comprises mouse, rat, guinea pig, dog, monkey, pig, rabbit, cat, horse, cow, sheep, donkey.
24. A derivative consisting of the monoclonal antibody according to any one of claims 1 to 6 and a detectable agent linked thereto.
25. The derivative according to claim 24, wherein the detectable agent comprises a fluorescent dye, a radioactive label, a metal ion, an enzyme, a magnetic bead, or a colorimetric label.
26. A product, comprising the monoclonal antibody according to any one of claims 1 to 6; the product is selected from the group consisting of a probe, a test paper, a test kit, and a chip.
27. The product of claim 26, wherein the kit comprises a buffer, a blocking reagent, a washing reagent, an enzyme substrate, and / or a solid support.
28. A pharmaceutical composition comprising the monoclonal antibody according to any one of claims 1 to 6 or the derivative according to claim 24 or 25.
29. A method for preparing the monoclonal antibody according to any one of claims 1 to 6, the method comprising the steps of culturing the cell according to any one of claims 19 to 23 and recovering the monoclonal antibody.
Citation Information
Patent Citations
Colloidal gold detection test paper for abrin, preparation method thereof and application thereof
CN101561438A
Immunochromatographic test paper for testing abrin and preparation method thereof
CN101738482A