Nucleotide capable of degrading circUSP3 in targeting manner and application of nucleotide in preparation of medicine for treating lung cancer

Abstract

The invention discloses a nucleotide capable of degrading circUSP3 in a targeted manner and an application of the nucleotide in preparation of a medicine for treating lung cancer, the nucleotide is characterized in that the nucleotide achieves the effect of inhibiting lung cancer by degrading circUSP3 in a targeted manner, and the sequence of the nucleotide is CAAUGUGUGCGUCCAUCAAdTdT and a complementary sequence thereof UUGGACACCGGCACAACAUUGUGUGCGdTdT, or the sequence of the nucleotide is GGAUGUGUGUGCGdTdT and a complementary sequence thereof CGGCACAACAUGUGUGCGUCCdTdT. The oligonucleotide can degrade circUSP3 in a targeted manner so as to cause growth inhibition of lung cancer representative cells A549 and even cause apoptosis of the lung cancer representative cells A549, the mechanism is that circUSP3 RNA product expression is reduced, and the anti-tumor effect is improved through combined treatment with an anti-tumor drug inorganic arsenic.

Description

Technical Field

[0001] The application field of short nucleotides of the present invention specifically relates to a nucleotide for targeted degradation of circUSP3 and its application in the preparation of drugs for treating lung cancer. A nucleotide for targeted degradation of circUSP3, the fragment can effectively inhibit the circRNA produced by circUSP3, thereby inhibiting the expression of RNA, and plays an anti-tumor role with other anti-tumor drugs. Background Art

[0002] The occurrence of tumors involves abnormal activation of multiple signaling pathways in cells, including overactivation of growth signals, inactivation of inhibitory signals, disorder of cell cycle control, resistance to cell death, tissue invasion and metastasis, etc. The loss of control of the cell cycle is one of the key factors in tumorigenesis. The cell cycle consists of a series of steps, including cell growth, DNA replication and cell division. In each stage of the cell cycle, such as the G1 phase, S phase and G2 phase, there are checkpoints to ensure that cells correctly replicate DNA and distribute it to daughter cells. If these checkpoints are out of control, such as p53 gene mutations, cells may enter the next cell cycle with damaged DNA, increasing the risk of cancer. Abnormal signaling pathways can also promote the occurrence of tumors. For example, the P53 signaling pathway, NF-κB signaling and IKB-α pathway may play a role in the occurrence and development of tumors. Abnormal activation of these pathways can promote cell proliferation, inhibit cell apoptosis, and promote tumor angiogenesis and metastasis.

[0003] With the development of molecular biology, our understanding of tumors has expanded from the morphological level to the genetic level. Molecular biology research is revealing the deep mechanisms of tumor occurrence and development and giving rise to new treatment strategies.

[0004] Lung cancer is one of the most common malignant tumors worldwide and the leading cause of cancer death. According to the World Health Organization, the incidence and mortality of lung cancer rank first among all cancers. In 2022, it is estimated that there will be 19.974 million new cancer cases and 9.744 million cancer deaths worldwide, of which 2.481 million new cases of lung cancer will account for 12.4% of the world's new cancer cases, once again becoming the world's number one cancer.

[0005] In China, the situation of lung cancer is equally severe. In 2022, the number of new lung cancer patients in China reached 1.061 million, equivalent to 75.1 people per 100,000 people suffering from lung cancer. At the same time, lung cancer is also the most "deadly" cancer in China, with 51.9 people dying from lung cancer per 100,000 people.

[0006] Early diagnosis and treatment of lung cancer are crucial. Early lung cancer (stage I and II) has a high cure rate through surgical resection, but in stages III-IV, the 5-year survival rate is only 20%-30%. Therefore, regular lung cancer screening is recommended for high-risk groups, such as long-term smokers and people with a family history of lung cancer.

[0007] The etiology and pathogenesis of lung cancer are complex and are usually related to factors such as smoking, occupational and environmental exposure, air pollution, heredity and gene changes, etc. The combined effects of these factors lead to cell gene damage and may eventually develop into lung cancer.

[0008] The seriousness of lung cancer lies in its high morbidity and mortality, as well as the economic and psychological burden it brings to patients and their families. Lung cancer not only harms the patient's physical health, but also seriously affects the quality of life. The survival rate of patients with advanced lung cancer is low, so early detection and treatment are crucial.

[0009] Lung cancer includes two major categories: non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC), of which non-small cell lung cancer accounts for about 85%. They have significant differences in biological behavior, treatment response and prognosis, which brings complexity to treatment. Many patients are already in the advanced stage when diagnosed and have missed the best time for treatment. The early symptoms of lung cancer are not obvious, resulting in many patients being diagnosed only when the disease progresses to a later stage.

[0010] Although targeted therapy and immunotherapy have made significant progress in the treatment of lung cancer, tumors may develop drug resistance during treatment, resulting in treatment failure, especially for small cell lung cancer, where the problem of drug resistance is particularly serious. The 5-year survival rate of immunotherapy for patients with advanced NSCLC is only about 20%, indicating that nearly 80% of patients still do not respond well to immunotherapy. Chemotherapy and radiotherapy may have serious side effects, such as pulmonary fibrosis and cardiac toxicity, which requires strict monitoring and proper management during treatment. The treatment of lung cancer is expensive, especially new drugs and advanced radiotherapy techniques, which imposes a heavy financial burden on patients and their families. For some types of lung cancer, especially advanced or recurrent lung cancer, achieving "cure" remains a huge challenge, and existing treatments can often only prolong survival and improve quality of life.

[0011] Arsenic agents play a role in tumor treatment through a variety of mechanisms, including targeting specific proteins, affecting cell signaling pathways, inducing apoptosis and autophagy, etc. Arsenic has shown significant efficacy in the treatment of hematological malignancies and solid tumors. Arsenic can induce tumor cell differentiation, apoptosis and autophagy, eliminate leukemia-initiating cells, and directly act on target proteins. Studies have shown that arsenic can inhibit the invasion and migration of solid tumor cells such as lung cancer, gastric cancer, and liver cancer, and exert its effects by activating related signaling pathways. However, arsenic agents have serious side effects in the treatment of tumors, mainly including liver toxicity, cardiotoxicity, gastrointestinal reactions, dry skin, hair loss, neurotoxicity, bone marrow suppression, etc. Long-term or high-dose exposure to arsenic agents may increase the risk of secondary tumors in patients.

[0012] In the treatment of non-small cell lung cancer, the use of arsenic alone faces many problems, including acquired resistance and side effects. For example, NSCLC patients will develop resistance to cisplatin (DDP)-based chemotherapy, and the use of arsenic may increase patients' resistance to chemotherapy drugs. In addition, the cardiotoxicity of arsenic is also an important side effect, which may cause QT interval prolongation and increase the risk of arrhythmia. In addition, dose control, combination therapy, monitoring and preventive measures of arsenic in the treatment of tumors are also important means to reduce side effects.

[0013] Although arsenic has shown potential in treating certain types of tumors, its effect in treating solid tumors is not ideal and there are certain side effects. It is particularly important to further explore the mechanism of action of arsenic and new combination therapy regimens to improve its effectiveness and safety in tumor treatment.

[0014] Small interfering RNA (siRNA) is a type of double-stranded RNA molecule with a length of 19-25 base pairs, which plays a role in the RNA interference pathway. siRNA can achieve gene silencing by binding to complementary mRNA sequences, leading to post-transcriptional degradation of specific genes and preventing them from being translated into proteins. siRNA can reduce the number of lung cancer cells and increase the level of cell apoptosis by specifically inhibiting the expression of lung cancer-related genes. siRNA can also increase the sensitivity of lung cancer cells to chemotherapeutic drugs by inhibiting the expression of drug resistance-related genes.

[0015] circUSP3 (hsa_circ_0035649) is located on chromosome 15 of the human genome and is produced by reverse splicing of exon 1 to exon 6 of USP3. SiRNA can more accurately regulate the expression of targeted gene RNA while leaving normal genes undisturbed. Effective regulation of circRNAs and mRNA is a hot area in tumor treatment. Summary of the invention

[0016] The purpose of the present invention is to provide a nucleotide for inhibiting the expression of circUSP3 (hsa_circ_0035649) and use of the nucleotide in combination with inorganic arsenic in the preparation of anti-lung cancer drugs.

[0017] The object of the present invention is achieved by comprising a synthetic nucleotide sequence consisting of CAAUGUUGUGCCGGUCCAAdTdT (SEQ ID NO.3) and its complementary sequence UUGGACCGGCACAACAUUGdTdT (SEQ ID NO.4), GGAUAACAAUGUUGUGCCGdTdT (SEQ ID NO.5) and its complementary sequence CGGCACAACAUUGUUAUCCdTdT (SEQ ID NO.6). The nucleotide can be used in the preparation of anti-lung cancer drugs, and can also be used in combination with other anti-tumor therapeutic drugs, such as sodium arsenite in an alkaline solution of arsenic trioxide.

[0018] The present invention (advantages): The invented nucleotide acts on specific target sites by targeted degradation of circUSP3, and has a good tumor killing effect. Secondly, it acts on targeted degradation of circRNAs, resulting in a very strong tumor killing effect. It has a combined effect with the traditional therapeutic agent arsenic. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 In situ fluorescence staining of HO / PI for the detection of apoptosis in A549 cells by SiRNA DETAILED DESCRIPTION

[0020] The present invention is further described below, but the present invention is not limited in any way. Any changes or substitutions made based on the teachings of the present invention belong to the protection scope of the present invention.

[0021] Example 1 The primers and interference fragments used were all written from (5´-3´). The siRNA sequence was synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd., and the negative control siRNA (catalog number A06002) of the company was used as a control. The negative control was the NC group UUCUCCGAACGUGUCACGUdTdT (SEQ ID NO.1) and ACGUGACACGUUCGGAGAAdTdT (SEQ ID NO.2), siRNA#1: CAAUGUUGUGCCGGUCCAAdTdT (SEQ ID NO.3) and its complementary sequence UUGGACCGGCACAACAUUGdTdT (SEQ ID NO.4), siRNA#2: GGAUAACAAUGUUGUGCCGdTdT (SEQ IDNO.5) and its complementary sequence CGGCACAACAUUGUUAUCCdTdT (SEQ ID NO.6). Upstream of circUSP3 (hsa_circ_0035649): CCGCCGTGGAGTTAAGGAA (SEQ ID NO.7), downstream: GTTGGACCGGCACAACATTG (SEQ ID NO.8), β-actin primer sequences GCCGAGGACTTTGATTGCAC (SEQ ID NO.9) and TGGACTTGGGAGAGGACTGG (SEQ ID NO.10).

[0022] Example 2 1. Cell Culture The cells were cultured in a 37°C, 5% CO2 incubator in a 1640 medium supplemented with 10% fetal bovine serum and 1% antibody.

[0023] 2. Verification of siRNA silencing efficiency (1) Cell inoculation: After observing that the cells are in the logarithmic growth phase under a microscope, discard the T25 medium, add 1 mL of PBS and gently shake twice to remove suspended dead cells. Then add 1 mL of trypsin to rinse and discard, then add 0.5 ml of trypsin and place the T25 in the incubator for 2.5 minutes. Gently shake to see that the cells fall off in a large area. Add 5 mL of double-antibody-free culture medium to terminate cell digestion, and use a sterile Pasteur pipette to blow the cells to mix. Take 12 microliters and count them in a cell counting plate. Inoculate 1×105 cells per well in a 6-well plate, and ensure that the cells are evenly distributed in the wells. Then place the 6-well plate in a constant temperature incubator for culture.

[0024] (2) Transfection: Transfection was performed when the cell density reached 35-55% (18 hours). 100 μL of serum-free and double-antibody culture medium were used to dilute 30 pmol of siRNA, and 4 μL of RFect transfection reagent was added to every 100 μL of serum-free and double-antibody culture medium to prepare enough RFect working solution, gently mix, and incubate at room temperature for 5 minutes (siRNA sequence is the same as above). Each prepared siRNA was diluted with 100 μL of RFect working solution, gently blown to mix, and incubated at room temperature for 20 minutes. 800 μL of double-antibody-free culture medium was added to each tube of the mixture, and gently blown to mix. At this time, the volume of transfection working solution in each tube was 1 ml. Then take out the 6-well plate, discard the original culture medium in the 6-well plate, and add 1 ml of the prepared transfection working solution to each well.

[0025] (3) Change medium: 24 hours after transfection, change the medium of the 6-well plate. Discard the original transfection working solution, gently add 4 ml of complete medium to each well along the wall, and continue to culture in a constant temperature incubator.

[0026] (4) Total RNA extraction from cells: Total RNA extraction was performed 48 hours after the medium was replaced. The culture medium in the 6-well plate was discarded, PBS was added to wash twice and then discarded, and the remaining PBS was aspirated with a pipette. 1 ml Trizol was added to each well and then allowed to stand in a refrigerator at 4°C for 15 min to promote complete cell lysis; after blowing the cells, the cells were transferred to a new 1.5 ml EP tube, and 200 μl chloroform was added respectively. After vigorous shaking and extraction, the tube was allowed to stand at room temperature for 15 min, and centrifuged at 12,000 rpm for 15 min. 510 μl of the upper colorless aqueous phase (containing RNA) was aspirated into a new EP tube in 3 times (170 μl each time) and the same volume of isopropanol was added. After inversion to mix, the tube was allowed to stand at room temperature for 10-15 min, and centrifuged at 412,000 rpm for 10 min; the supernatant was discarded and 1 ml 75% ethanol was added to wash, and the tube was centrifuged at 4°C and 12,000 rpm for 8 min; the supernatant was discarded and dried for 20 min, 35 μl RNase-Free Water was added to dissolve the RNA, and the tube was allowed to stand at room temperature for 20 min to fully dissolve the RNA.

[0027] (5) Reverse transcription to synthesize cDNA: Reverse transcription reaction system: dNTP 4µL, Primei Mix 2µL, 5×Buffer 4µL, DTT 2µL, HiFIscript (200U / µL) 1µL RNA Template 7µL. Total volume 20µL.

[0028] Take 200 µL of nuclease-free eight-tube, prepare the reverse transcription system according to the table above, and set the PCR reaction program after centrifugation: preheat at 25℃ for 10 minutes, incubate at 42℃ for 60 minutes, and incubate at 80℃ for 10 minutes to inactivate the reverse transcriptase. The synthesized cDNA can be stored at -20℃ for later use.

[0029] (6) Q-PCR: 1) Q-PCR reaction system: SYBR Green master mix 7µL, PCR primer mix 0.5µL, cDNA template 1.5µL, RNase-Free water 6µL, total volume 15µL.

[0030] 2) Primers used for fluorescence quantification: hsa_circ_0035649 upstream: CCGCCGTGGAGTTAAGGAA, downstream: GTTGGACCGGCACAACATTG, internal reference gene is β-actin. Three replicate wells were set.

[0031] 3) Prepare the reaction system according to the table above, vortex and mix well, add to the 96-well plate, seal with sealing film and centrifuge. Then place the 96-well plate in the LightCycler96 real-time fluorescence quantitative PCR instrument and perform the reaction according to the following program: pre-denaturation at 95℃ for 520 seconds, denaturation at 95℃ for 10 seconds, annealing at 55℃ for 10 seconds, extension at 72℃ for 10 seconds, annealing and extension for 40 cycles.

[0032] 4) The fluorescence quantitative results are as follows (the results are expressed as 2^-ΔΔ, N=3): Control group: 1.006±0.127 siRNA#1: 0.053±0.037 siRNA#2: 0.035±0.013.

[0033] 3. Cell Viability Detection Experiment (1) Cell inoculation: After observing that the cells are in the logarithmic growth phase under a microscope, discard the T25 medium, add 1 mL of PBS and gently shake twice to remove suspended dead cells. Then add 1 mL of trypsin to rinse and discard, then add 0.5 ml of trypsin and place the T25 in the incubator for 2.5 minutes. Gently shake to see that the cells fall off in a large area. Add 5 mL of anti-antibody-free culture medium to terminate cell digestion, and use a sterile Pasteur pipette to blow the cells to mix. Take 12 microliters and count them in a cell counting plate. Inoculate 2,500 cells per well in a 96-well plate, and ensure that the cells are evenly distributed in the wells. Then place the 96-well plate in a constant temperature incubator for incubation.

[0034] (2) Transfection: Transfection was performed when the cell density reached 35-55% (18 hours). 100 μl of serum-free and double-antibody culture medium were used to dilute 30 pmol of siRNA, and 4 μl of RFect transfection reagent was added to every 100 μl of serum-free and double-antibody culture medium to prepare enough RFect working solution, gently mix, and incubate at room temperature for 5 minutes (siRNA sequence is the same as above). Each prepared siRNA was diluted with 100 μl of RFect working solution, gently blown to mix, and incubated at room temperature for 20 minutes. 800 μl of double-antibody-free culture medium was added to each tube of the mixture, and gently blown to mix. Then remove the 6-well plate, discard the original culture medium in the 96-well plate, and add 50 μl of the prepared transfection working solution to each well. To avoid evaporation affecting the experimental results, the outermost wells were not used for transfection experiments. Then the 96-well plate was placed in a constant temperature incubator for incubation.

[0035] (3) Adding arsenic and changing the medium: 24 hours after transfection, add arsenic and change the medium, and set up a control group. After taking out the original transfection working solution from the 96-well plate, add 200µL of 30µmol / L sodium arsenite to each well of the arsenic addition group, and after taking out the original transfection working solution from the remaining wells, add 200µL of complete culture medium. Then place the 96-well plate in a constant temperature incubator for culture.

[0036] (4) MTT experiment CCK-8 method: After adding arsenic and changing the solution for 48 hours, the MTT experiment CCK-8 method was performed. Take a 96-well plate. Due to evaporation, each well contains 180μL of liquid. After aspirating 80μL of liquid from each well, quickly add CCK-8 reagent, 15μL per well, place in a constant temperature incubator for incubation for 45 minutes, and then place in a microplate reader for detection at a wavelength of 450nm. CCK-8 experimental results (results are expressed in %, N=4): control group (untreated): 100±0.43, NC group without sodium arsenite: 89.95±0.57, NC group without sodium arsenite and silencing (siRNA#1): 87.17±0.57, NC group without sodium arsenite and silencing (siRNA#2): 83.17±1.55, NC group with sodium arsenite: 78.56±1.26, NC group with sodium arsenite and silencing (siRNA#1): 69.74±1.23, NC group with sodium arsenite and silencing (siRNA#2): 69.01±1.09 The results showed that the combination of sodium arsenite and siRNA can achieve a synergistic effect and enhance the cell apoptosis effect on the non-small cell lung cancer A549 cell line. Compared with the use of sodium arsenite alone, this combination therapy can more effectively inhibit tumor growth, and due to the precise targeting characteristics of siRNA, the dose of sodium arsenite can be reduced, thereby reducing its side effects on the human body.

[0037] 4. Cell apoptosis detection experiment (Hochest / PI apoptosis staining experiment) (1) Cell inoculation: After observing that the cells are in the logarithmic growth phase under a microscope, discard the T25 medium, add 1 mL of PBS and gently shake twice to remove suspended dead cells. Then add 1 mL of trypsin to rinse and discard, then add 0.5 ml of trypsin and place the T25 in the incubator for 2.5 minutes. Gently shake to see that a large area of ​​cells fall off. Add 5 mL of double-antibody-free culture medium to terminate cell digestion, and use a sterile Pasteur pipette to blow the cells to mix well. Take 12 microliters and count them in a cell counting plate, and calculate 0.3×10 per well. 5 The cells were seeded into a 12-well plate and the cells were ensured to be evenly distributed in the wells. The 96-well plate was then placed in a constant temperature incubator for culture.

[0038] (2) Transfection: Transfection was performed when the cell density reached 35-55% (18 hours). 100 μl of serum-free and double-antibody culture medium were used to dilute 30 pmol of siRNA, and 4 μl of RFect transfection reagent was added to every 100 μl of serum-free and double-antibody culture medium to prepare enough RFect working solution, gently mix, and incubate at room temperature for 5 minutes (siRNA sequence is the same as above). Each prepared siRNA was diluted with 100 μl of RFect working solution, gently blown to mix, and incubated at room temperature for 20 minutes. 800 μl of double-antibody-free culture medium was added to each tube of the mixture, and gently blown to mix. Then remove the 12-well plate, discard the original culture medium in the 12-well plate, and add 500 μl of the prepared transfection working solution to each well. Then place the 12-well plate in a constant temperature incubator for culture.

[0039] (3) Medium change: 24 hours after transfection, change the medium of the 12-well plate. Discard the original transfection working solution, gently add 2 ml of complete medium to each well along the wall, and continue to culture in a constant temperature incubator.

[0040] (4) Hochest / PI apoptosis staining experiment: 48 hours after the liquid change, the Hochest / PI apoptosis staining experiment was performed. After preheating the anti-dual antibody-free culture medium at 37°C, the Hochest / PI working solution was prepared. 5 μl of Hochest33342 staining solution (100×) and 5 μl of PI staining solution (100×) were added to every 100 ml of anti-dual antibody-free culture medium to form the working solution. Take a 12-well plate, discard the original culture medium, wash with an appropriate amount of PBS, then add 600 μl of working solution to each well, incubate at room temperature and away from light for 15 minutes, add an appropriate amount of PBS once, and then add 1 ml of PBS to each well to prevent the cells from drying up. Then use a research-grade inverted fluorescence microscope to take pictures to detect cell apoptosis.

[0041] The results of the Hochest / PI apoptosis staining experiment showed that compared with the NC control group, cell apoptosis was detected in A549 cells transfected with the circUSP3 silencing fragment (after Hochest staining, the cells appeared bright blue, which was an early apoptosis phenomenon - nuclear condensation; after PI staining, the cells appeared red, which was a late apoptosis phenomenon).

Claims

1. A nucleotide for targeted degradation of circUSP3, characterized in that Its sequence is CAAUGUUGUGCCGGUCCAAdTdT (SEQ ID NO. 3) and its complementary sequence UUGGACCGGCACAACAUUGdTdT (SEQ ID NO. 4), or GGAUAACAAUGUUGUGCCGdTdT (SEQ ID NO.5) and its complementary sequence CGGCACAACAAUUGUUAUCCdTdT (SEQ ID NO. 6).

2. The use of a nucleotide for targeted degradation of circUSP3 according to claim 1, characterized in that Application in the preparation of drugs for treating lung cancer.

3. Use of a pharmaceutical composition in the preparation of a drug for treating lung cancer, characterized in that Containing the claim 1 CAAUGUUGUGCCGGUCCAAdTdT (SEQ ID NO. 3) and its complementary sequence UUGGACCGGCACAACAUUGdTdT (SEQ ID NO. 4), or GGAUAACAAUGUUGUGCCGdTdT (SEQ ID NO.5) and its complementary sequence One of CGGCACAACAUUGUUAUCCdTdT (SEQ ID NO. 6) is used in combination with sodium arsenite.

4. The pharmaceutical composition according to claim 3, characterized in that The concentration of sodium arsenite in the composition is 30 uM.

Images