SNP (Single Nucleotide Polymorphism) site for screening acute altitude stress and application of SNP site

Abstract

The invention provides a single nucleotide polymorphism (SNP) site for predicting plateau adaptability and a diagnostic kit thereof. The SNP site is rs2526330, and a reagent for detecting the site can be applied to preparation of products for screening or auxiliary screening of acute altitude stress, products for predicting, diagnosing or identifying plateau susceptibility, products for detecting mononucleotide polymorphism related to plateau adaptability and the like. The detection kit prepared from the site adopts non-invasive operation, and is convenient and harmless to detect. Therefore, by means of the designed and constructed detection kit, rapid, efficient and economical screening and evaluation of the susceptibility and adaptability of the altitude sickness can be achieved.

Description

Technical Field

[0001] The invention belongs to the field of medical technology, and in particular relates to a single nucleotide polymorphism (SNP) site for screening acute altitude sickness and an application thereof. Background Art

[0002] The plateau environment is characterized by low pressure, low oxygen, and strong radiation. This unique environment can cause varying degrees of damage to the human body. Some people from the plains who enter the plateau environment, especially those who rush to the plateau, often suffer from acute altitude sickness due to their inability to adapt to the low-pressure and low-oxygen environment, such as headaches, nausea, chest tightness, insomnia, etc. Particularly serious individuals can develop high-altitude emphysema, cerebral edema, etc., and even death in severe cases. This poses a great challenge to the lives and health of the people. Therefore, how to screen and evaluate biomarkers for the severity of early altitude sickness and achieve early prevention and early intervention has become a scientific problem that needs to be solved urgently.

[0003] With the development of molecular biotechnology, more and more genes related to plateau adaptability have been screened and identified, and related research methods have become more mature. Among them, single nucleotide polymorphism (SNP) technology is easy to type and detect, and can be used for rapid and large-scale screening, making it very suitable for identifying high-risk groups.

[0004] The present invention identifies SNP sites related to plateau adaptability and provides a method for evaluating the degree of acute plateau reaction. Summary of the invention

[0005] In view of the shortcomings of the prior art, the object of the present invention is to provide a SNP site related to plateau adaptability and a diagnostic kit thereof.

[0006] To achieve this object, the present invention adopts the following technical solutions:

[0007] In a first aspect, a reagent for detecting a SNP site is used in at least one of the following a1 to a3, wherein the SNP site is rs2526330:

[0008] a1. Application in the preparation of products for screening or assisting in screening of acute mountain sickness;

[0009] a2. Use in the preparation of products for predicting, diagnosing or identifying high altitude susceptibility;

[0010] a3, application in preparing products for detecting single nucleotide polymorphisms associated with plateau adaptability.

[0011] In the early stage of the present invention, oral buccal mucosa specimens were collected after high-altitude exposure to the population, and the population was grouped according to the differences in altitude sickness. DNA was then extracted from the buccal mucosa. At the same time, whole exome second-generation sequencing technology and bioinformatics analysis technology were combined. Based on the genome-wide association study (GWAS) method, after strict screening and classification, buccal mucosa samples that can effectively distinguish between people with strong altitude sickness and people with low altitude sickness were discovered and identified, and the association between people with different altitude sickness and the genetic characteristics of SNP sites was deeply analyzed.

[0012] The SNP sites related to plateau adaptability screened out by the present invention include rs2526330, which is located at position 34267866 of human chromosome 17, and contains significant genes LRRC37A8P, RDM1, LYZL6, CCL16, CCL14 and CCL15-CCL14.

[0013] As a preferred technical solution of the present invention, the reagent for detecting the SNP site includes: a primer and / or a probe for detecting the SNP site.

[0014] As a preferred technical solution of the present invention, the primers used to detect the SNP site include an upstream primer and a downstream primer. The upstream primer contains the nucleotide sequence shown in SEQ ID NO.1; the downstream primer contains the nucleotide sequence shown in SEQ ID NO.2.

[0015] Preferably, the upstream primer is:

[0016] CAAGTTTCATTCAGGTTGGAGCAT(SEQ ID NO.1);

[0017] Preferably, the downstream primer is:

[0018] CAGCCACTTTGGAAATCTGGTAGG (SEQ ID NO. 2).

[0019] As a preferred technical solution of the present invention, the probe for detecting the SNP site includes a wild-type probe and a mutant probe. The probe includes a wild-type probe and a mutant probe; the wild-type probe includes a nucleotide sequence as shown in SEQ ID NO.3; the mutant probe includes a nucleotide sequence as shown in SEQ ID NO.4.

[0020] Preferably, the wild-type probe is:

[0021] CCTTTCTATG G TTGAATAATATTTCATTGTATGAATAGACC(SEQ ID NO.3)

[0022] Preferably, the mutant probe is:

[0023] CCTTTCTATG A TTGAATAATATTTCATTGTATGAATAGACC(SEQ ID NO.4)

[0024] It should be noted that the primer and probe sequences shown in the present invention are not limited to the listed SEQ ID NOs. 1 to 4, and any base sequence that can amplify and detect the rs2526330 site can be used to prepare products for detecting the site.

[0025] As a preferred technical solution of the present invention, the method for using the product comprises the following steps:

[0026] Obtaining biological samples from subjects and extracting sample DNA from the biological samples;

[0027] Detect the genotype of the SNP site in the sample DNA.

[0028] In a second aspect, the present invention provides a gene detection kit, which comprises a detection reagent for detecting the rs2526330 site.

[0029] As a preferred technical solution of the present invention, the test sample of the gene detection kit is the body fluid, skin, oropharyngeal swab or subcutaneous tissue of the subject.

[0030] In a third aspect, the present invention further provides a gene detection device, which includes a device for detecting the rs2526330 site.

[0031] As a preferred technical solution of the present invention, the device includes a module, and the module includes software.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] (1) To fill the gap in the current analysis of plateau adaptability and provide biomarkers for clinical diagnosis and prevention of altitude sickness, and to explore the molecular mechanism of plateau adaptability. In addition, the present invention identifies single nucleotide polymorphism (SNP) sites related to plateau adaptability through high-throughput sequencing technology, which may be related to physiological reactions and disease susceptibility in hypoxic environments.

[0034] (2) The SNP sites related to plateau adaptability screened out by the present invention include rs2526330, which is located at position 34267866 of human chromosome 17, and contains significant genes LRRC37A8P, RDM1, LYZL6, CCL16, CCL14 and CCL15-CCL14, etc.; detecting this site can be used to screen people susceptible to altitude sickness, predict the risk of altitude sickness, or identify or assist in identifying altitude sickness, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 Draw Manhattan plots for GWAS analysis. DETAILED DESCRIPTION

[0036] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and through specific implementation methods. However, the following examples are only simple examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0037] In the following examples, unless otherwise specified, all reagents and consumables used were purchased from conventional reagent manufacturers in the field; unless otherwise specified, all experimental methods and technical means used were conventional methods and means in the field.

[0038] Example 1

[0039] 1. Sample population and exclusion criteria

[0040] In order to study the differences in altitude sickness among people, 312 healthy adults aged no more than 40 years old were enrolled in this example. Oral buccal mucosal specimens were uniformly collected within 48 hours of high altitude exposure, and all enrolled people were informed of the nature of the study.

[0041] II. Information and Biological Sample Collection

[0042] (1) Information Collection

[0043] The subjects completed the questionnaire survey in a normal state within 48 hours of entering the plateau, and the Lake Louise International Acute Mountain Sickness Scoring Standard was used to reflect the degree of mountain sickness. The specific Lake Louise International Acute Mountain Sickness Scoring Standard is shown in Table 1 below.

[0044] Table 1

[0045]

[0046] 1. When scoring each symptom as 0, 1, 2, or 3, it must be an integer;

[0047] 2. The minimum total score is 0 and the maximum is 15;

[0048] 3. Self-assessment is for builders with a high school education or above. This form will be distributed before entering the plateau and professionals will explain how to fill it out. After entering the plateau, the score will be self-scored; however, if the group is large or the individual has low education and does not have a deep understanding of this scoring system, it should be filled out by a doctor. The purpose of self-assessment is to treat oneself as soon as possible (such as when climbing) or to seek medical treatment as soon as possible, so as to achieve the purpose of early diagnosis and treatment.

[0049] 4. When conducting AMS observations on a large group, it is generally recommended to fill out the form and score within the first 2 to 3 hours after entering the plateau. In the first week, it is best to score twice a day, the first time one hour after waking up in the morning and the second time after work every day.

[0050] The final diagnosis is based on the comprehensive score: self-scoring + clinical scoring. AMS diagnosis: headache must be present, with a score of ≥ 3. AMS severity judgment: scores of 0-2 are absent; 3-4 are mild; ≥ 5 are severe.

[0051] Example 2

[0052] 1. Collection of biological samples

[0053] Within 48 hours of plateau exposure, buccal mucosal samples were collected from the subjects and placed in a DNA gene detection sampling tube. They were immediately placed in dry ice for temporary storage and frozen in a -80℃ refrigerator within 8 hours.

[0054] 2. DNA Extraction and Sequencing

[0055] (1) DNA sample testing

[0056] There are two main methods for testing DNA samples:

[0057] 1. Agarose gel electrophoresis was used to analyze the degree of DNA degradation and whether there was RNA or protein contamination.

[0058] 2. Qubit 3.0 accurately quantifies DNA concentration. DNA samples with a content of more than 0.5ug are used to build the library.

[0059] (2) Library construction and capture

[0060] Efficiently enrich the DNA of specific target regions of humans, and then perform high-throughput and high-depth sequencing on the Illumina platform. Basic experimental process:

[0061] The genomic DNA was randomly broken into fragments of 180-280 bp in length by Covaris fragmentation apparatus. After end repair and A-tailing, adapters were connected to both ends of the fragments to prepare DNA library.

[0062] After pooling, the library with specific index is hybridized with up to 500,000 biotin-labeled probes in liquid phase, and then the n exons of n genes are captured using magnetic beads with streptavidin. After PCR amplification, the library is quality-checked and sequencing can be performed if qualified.

[0063] (3) Inventory inspection

[0064] After the library construction is completed, Qubit 2.0 is used for preliminary quantification, and then NGS3K / Caliper is used to detect the insert size of the library. After the insert size meets expectations, the qPCR method is used to accurately quantify the effective concentration (3nM) of the library to ensure the quality of the library.

[0065] (4) Sequencing

[0066] If the library is qualified, the Illumina platform will be used for sequencing according to the effective concentration of the library and the data output requirements.

[0067] Example 3

[0068] 1. Analysis of Sequencing Results

[0069] After obtaining the original sequencing sequence (Sequenced Reads), in the case of a reference sequence or reference genome (GRCh38 / hg38), the information analysis process is carried out, including the following two parts:

[0070] (1) Sequencing data quality assessment

[0071] The main statistics are on sequencing error rate, data volume and comparison rate, to evaluate whether the library construction and sequencing have met the standards. If they meet the standards, subsequent analysis will be carried out, otherwise the library needs to be rebuilt or additional testing is required.

[0072] (2) Mutation Detection

[0073] Align high-quality sequences to the human reference genome and detect variation information in samples.

[0074] 2. Sequencing Statistics

[0075] The effective sequencing data were aligned to the reference genome (GRCh38) using BWA (Li H et al.) to obtain the initial alignment results in the BAM format.

[0076] Then, SAMtools (Li H et al.) was used to align and sort the results; GATK was used to mark duplicate reads.

[0077] Finally, the coverage, depth, etc. are counted using the alignment results after repeat marking.

[0078] Usually, the sequencing reads of human samples can achieve a matching rate of more than 95%; when the base coverage depth (read depth) of a site reaches more than 10X, the SNP detected at the site is more reliable.

[0079] 3. Comparison of results

[0080] Comparison of susceptibility genes between those with acute mountain sickness and those without acute mountain sickness after entering the plateau:

[0081] According to the AMS score, these cases were divided into two groups according to AMS ≥ 5 points or AMS < 5 points, namely:

[0082] Acute mountain sickness group (class: H);

[0083] No acute mountain sickness group (class: NH).

[0084] Table 2 shows the basic information of the subjects, including age, weight, and height. Comparison of the two groups showed that there was no significant difference in age, height, and weight between the subjects (P>0.05).

[0085] Table 2

[0086] Acute mountain sickness group Control group P-value Number of samples 156 156 - Age (years) 20.0(19.0；21.0) 20.0[19.0；21.0] 0.0072 weight 65(60.0；70.0) 64.7(60.0；70.0) 0.877 height 172(169；176) 171(169；175) 0.067

[0087] PLINK was used to implement an additive logistic regression model to test the association between AMS and healthy controls. The significance threshold for genome-wide association analysis was set at 1×10^(-4) and Info>0.4.

[0088] The Variant Effect Predictor (VEP) is accessible through the Ensembl genome browser to identify genes and regulatory regions affected by nucleotide sequence variations.

[0089] Figure 1 Manhattan plot for GWAS analysis. The chromosome is the horizontal axis and the statistical significance (negative log-transformed P value) is the vertical axis. Each point in the plot represents a single nucleotide polymorphism (SNP) site or candidate gene region. The position of the point indicates the strength of association between the site and the studied phenotype. Above the threshold line are SNP sites with significant specificity.

[0090] Table 3

[0091]

[0092]

[0093] As shown in Table 3, rs2526330 is located at position 34267866 of human chromosome 17, including significant genes LRRC37A8P, RDM1, LYZL6, CCL16, CCL14 and CCL15-CCL14.

[0094] Table 4 shows the results of SNP analysis in acute mountain sickness. The effect of carrying the relevant allele on acute mountain sickness was determined by calculating the odds ratio (OR) of the alleles.

[0095] Table 4

[0096] SNP OR SE P-value rs2526330 0.3683 0.2366 0.00002435

[0097] According to the data analysis results, the SNP site rs2526330 is closely related to the individual's plateau adaptability. Therefore, specific primer pairs and probes can be designed based on the rs2526330 site to detect the susceptibility of altitude sickness in the tested population.

[0098] Example 4

[0099] In this embodiment, a gene detection kit for detecting plateau adaptability is provided, and the gene detection kit comprises a specific primer pair and a probe for detecting the rs2526330 site.

[0100] In conjunction with Table 5, the nucleotide sequence of the forward primer in the reaction system is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2; the nucleotide sequence of the wild-type probe is shown in SEQ ID NO.3, and the nucleotide sequence of the mutant probe is shown in SEQ ID NO.4.

[0101] Table 5

[0102]

[0103]

[0104] Example 5

[0105] 1. PCR Amplification

[0106] Take the DNA extracted from the sample to be tested as a PCR template; provide the kit, take out an appropriate amount of PCR reaction solution, and mix the PCR reaction solution with an appropriate amount of the PCR template;

[0107] The specific PCR reaction system is shown in Table 6.

[0108] Table 6

[0109] Reagents Volume(uL) 10× PCR buffer 2.5 DNA (30ng / uL) 1 dNTP 2 Wild-type probe (10 nmol / mL) 0.5 Mutation probe (10nmol / mL) 0.5 Forward primer (10nmol / mL) 0.5 Reverse primer (10nmol / mL) 0.5 UNG enzyme (5U / uL) 0.25 Ultrapure water 17.25

[0110] 2. Genotyping

[0111] In this embodiment, the PCR amplification reaction conditions are: 95° C. pre-denaturation for 10 min; 95° C. denaturation for 10 s; 60° C. annealing for 60 s; a total of 45 cycles to obtain the amplification result.

[0112] If the wild-type probe fluorescence has a logarithmic increase in fluorescence in the real-time fluorescence PCR reaction system of the sample, and the Ct value is ≤30.0, then there is no mutation at the site;

[0113] If in the real-time fluorescence PCR reaction system of the sample, the fluorescence of the mutant probe increases logarithmically and the Ct value is ≤30.0, then the site has mutated.

[0114] 3. Correlation Analysis

[0115] Before the association analysis, the samples and SNP levels were quality controlled. Finally, principal component analysis (PCA) of the population was performed to test the matching degree between the acute mountain sickness group and the control group. After quality control, this study finally included 156 cases in the acute mountain sickness group and 156 cases in the control group.

[0116] Table 7

[0117]

[0118] Table 7 shows the allele frequencies (%) of SNPs in the case group and the control group. The calculation method is: the wild-type gene frequency is obtained by genotyping, and the mutant gene frequency is obtained by (1-wild-type gene frequency). The change is the difference between the wild-type and mutant gene frequencies of the two groups.

[0119] As can be seen from the results of Table 7, the frequency of the mutant gene of rs2526330 in the acute mountain sickness group is 12.07% lower than the frequency of the genotype in the control group, indicating that the risk genotype of rs2526330 is wild type. The above experiment proves that rs2526330 can be used to detect the susceptibility of mountain sickness in the tested population. If the test result shows that the genotype of rs2526330 of the tested subject is wild type, the risk of mountain sickness in this person is high.

[0120] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention.

Claims

1. Use of a reagent for detecting a SNP site in at least one of the following a1 to a3, wherein: The SNP site is rs2526330: a1. Application in the preparation of products for screening or assisting in screening of acute mountain sickness; a2. Use in the preparation of products for predicting, diagnosing or identifying high altitude susceptibility; a3, application in preparing products for detecting single nucleotide polymorphisms associated with plateau adaptability.

2. The use according to claim 1, characterized in that: The reagent for detecting the SNP site includes: a primer and / or a probe for detecting the SNP site.

3. The use according to claim 2, characterized in that: The primers used to detect the SNP site include an upstream primer and a downstream primer; The probes used to detect the SNP sites include wild-type probes and mutant-type probes.

4. The use according to claim 3, characterized in that: The upstream primer comprises the nucleotide sequence shown in SEQ ID NO.1; The downstream primer comprises the nucleotide sequence shown in SEQ ID NO.2; The wild-type probe comprises the nucleotide sequence shown in SEQ ID NO.3; The mutant probe comprises the nucleotide sequence shown in SEQ ID NO.

4.

5. The use according to claim 1, characterized in that: The method of using the product comprises the following steps: Obtaining biological samples from subjects and extracting sample DNA from the biological samples; The product is then used to detect the genotyping of the SNP site in the sample DNA.

6. A gene detection kit, characterized in that: The gene detection kit comprises a detection reagent for detecting the rs2526330 site.

7. The gene detection kit according to claim 6, characterized in that: The test sample of the gene detection kit is the body fluid, skin, oropharyngeal swab or subcutaneous tissue of the subject.

8. A gene detection device, characterized in that: The apparatus includes a device for detecting the rs2526330 site.

9. The gene detection device according to claim 8, characterized in that: The device comprises modules, and the modules comprise software.

Images