Wheat secretory carrier-associated membrane protein taSCAMP6 and application thereof

By overexpressing the TaSCAMP6 gene in wheat plants, genetic engineering technology was used to solve the problems of reproductive isolation and stripe rust virulence variation in traditional disease-resistant breeding, thus achieving broad-spectrum and sustained resistance improvement of wheat to stripe rust.

CN119331066BActive Publication Date: 2025-12-26NORTHWEST A & F UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411596569.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-11
Publication Date
2025-12-26
Estimated Expiration
2044-11-11

AI Technical Summary

Technical Problem

Traditional disease-resistant breeding methods suffer from reproductive isolation and incompatibility issues in distant hybridization, and the rapid mutation of stripe rust fungi makes it difficult to achieve long-term and effective control of wheat stripe rust.

Method used

Through gene function studies, we identified the wheat secretory carrier-associated membrane protein TaSCAMP6. Using Agrobacterium-mediated genetic transformation, we overexpressed the TaSCAMP6 gene in wheat plants to enhance their resistance to stripe rust.

Benefits of technology

Breaking through reproductive isolation between species in a relatively short period of time, achieving targeted improvement of target traits, providing broad-spectrum and continuous disease resistance protection, and enhancing wheat's resistance to stripe rust.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119331066B_ABST
    Figure CN119331066B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of bioengineering, and relates to a wheat secretory carrier-associated membrane protein TaSCAMP6 and application thereof. The amino acid sequence of the wheat secretory carrier-associated membrane protein TaSCAMP6 provided by the present application is shown as SEQ ID NO:2; the nucleotide sequence of the wheat secretory carrier-associated membrane protein TaSCAMP6 gene is shown as SEQ ID NO:1; the function of the TaSCAMP6 gene is studied by a genetic method in the present application, a transgene is carried out in a Fielder wild type material, a TaSCAMP6 overexpression plant is obtained, and it is found through verification that the TaSCAMP6 overexpression enhances the resistance to Puccinia striiformis, and it is determined that the gene plays a positive regulation role in the wheat resistance to the stripe rust, thereby providing a new gene resource for the wheat breeding against the stripe rust.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of bioengineering, and relates to a wheat secretory carrier membrane protein TaSCAMP6 and an application thereof. BACKGROUND

[0002] Wheat stripe rust caused by Puccinia striiformis f.sp.tritici has the characteristics of strong prevalence, wide damage range and great destructiveness, and has become one of the most important diseases threatening the yield of wheat. Puccinia striiformis mainly relies on repeated infection of wheat by uredospores to cause damage, and produces faded green spots on the leaves of wheat at the initial stage of the disease, then produces fresh yellow virtual line-shaped pustules (uredospore piles) at the disease site, hence the name stripe rust, and black pustules (winter spore piles) grow at the later stage. Due to the gradual “loss” of wheat varieties to stripe rust resistance and the continuous emergence of new pathogenic races of stripe rust, stripe rust frequently breaks out. Therefore, it is of great significance to mine wheat disease resistance gene resources and accelerate the creation and cultivation of new varieties resistant to stripe rust.

[0003] Secretory carrier membrane protein (SCAMP) is a complete membrane protein family that can bind to specific receptors on the cell membrane and transport a variety of substances. From the structure, all SCAMPs contain a highly conserved four-transmembrane transmembrane core, called the SCAMP domain, which is located in the central position and consists of four hydrophobic transmembrane domains (TMDs) and three transmembrane domain interlaced flanking sequences. SCAMP has multiple functions on the cell membrane, and its receptor binding site on the cell membrane can bind to a variety of ligands including hormones, neurotransmitters, growth factors, etc., triggering signal transduction pathways, thereby affecting a variety of physiological processes in cells, and having a significant stress regulation effect, playing an important role in plant immunity.

[0004] At present, the prevention and control method of wheat stripe rust is mainly chemical control, and the harm of using chemical pesticides to the environment and food safety has attracted widespread attention. Disease resistance breeding is one of the most economical and effective measures to prevent and control wheat stripe rust. However, the mining of disease resistance genes is a long cycle, the cultivation of disease-resistant varieties is difficult, and the virulence of stripe rust changes rapidly, which makes it difficult to achieve long-term control of the disease in prevention and control. Therefore, creating broad-spectrum and long-lasting disease-resistant materials is the fundamental way and key technology to prevent and control wheat stripe rust. SUMMARY

[0005] The present application aims to solve the problems of reproductive isolation and cross-incompatibility in traditional disease resistance breeding, and the difficulty in achieving directional improvement of target traits in a short breeding cycle. At the same time, the rapid virulence variation of stripe rust makes it difficult to achieve long-term prevention and control of wheat stripe rust under current technical conditions.

[0006] In order to achieve the above-mentioned purposes, the present application provides a wheat secretory carrier-associated membrane protein TaSCAMP6 and its application to solve the needs in the art. The present application aims to further explore the immune defense mechanism of wheat, to mine the disease resistance genes that play a positive regulatory role in the defense response of wheat to Puccinia striiformis Westend. f. sp. tritici, and to provide a new path for creating wheat disease-resistant materials to prevent and control wheat stripe rust by carrying out gene function research.

[0007] In order to completely and unambiguously understand the technical solutions of the present application, it needs to be supplemented that the wheat secretory carrier-associated membrane protein TaSCAMP6 coding gene is represented by the italicized "TaSCAMP6", and the wheat secretory carrier-associated membrane protein TaSCAMP6 is represented by the non-italicized "TaSCAMP6". Of course, the person skilled in the art can clearly and completely understand the meaning and expression of the related genes and their encoded proteins according to the description of the present application.

[0008] In one aspect, the present application relates to a wheat secretory carrier-associated membrane protein TaSCAMP6, and the amino acid sequence of the wheat secretory carrier-associated membrane protein TaSCAMP6 is shown in SEQ ID NO: 2. The sequence of SEQ ID NO: 2 is as follows:

[0009] MHHDPNPFDEGTAGDENPFSNGGGRGGKQQHGFRPTEPVGFGGGGSRGDATVDVPLGNMGDSNGKARELSSWESDLRRREADIKRREESLKNAGVPMEEKNWPPFFPIIHHDIANEIPANVQKLQYLAFASWLGIVLCLSWNFIAVIVCWIKEGDSKLFFLATIYALLGIPLSYLMWYRPLYRAMRTNSAFSFGWFFLCYLIHIGFCIIAAIAPPIVFQGKSLTGILAAIDTFSEHLIIGIFYFVGFALFCLETLLSIGVLQKVYMYFRGHK.

[0010] In another aspect, the present application relates to a wheat secretory carrier-associated membrane protein gene TaSCAMP6 encoding the wheat secretory carrier-associated membrane protein. The nucleotide sequence of the TaSCAMP6 is shown in SEQ ID NO: 1. The sequence of SEQ ID NO: 1 is as follows:

[0011] ATGCATCACGACCCCAACCCCTTCGACGAGGGCACCGCCGGCGACGAAAACCCCTTCTCCAATGGAGGAGGCCGCGGCGGGAAGCAGCAGCACGGCTTCCGGCCCACCGAGCCCGTCGGCTTCGGCGGCGGCGGCAGCAGGGGCGACGCCACCGTCGACGTGCCCCTCGGCAACATGGGCGACTCGAATGGCAAGGCGAGGGAGCTCTCGTCGTGGGAATCAGATCTGAGGCGTCGTGAGGCGGATATCAAAAGGAGGGAGGAATCGCTGAAGAATGCTGGAGTGCCCATGGAGGAGAAGAATTGGCCGCCTTTTTTCCCGATTATCCACCATGACATCGCCAATGAGATACCTGCAAACGTGCAGAAGTTACAGTATCTGGCGTTTGCAAGCTGGCTTGGAATTGTGCTCTGCCTCTCCTGGAACTTTATTGCTGTCATAGTCTGCTGGATCAAGGAGGGAGATTCAAAGCTGTTCTTCCTTGCTACAATCTATGCTTTGCTTGGAATTCCCCTTTCTTACTTGATGTGGTATCGACCCCTCTATCGTGCAATGAGGACTAACAGTGCATTCAGTTTTGGATGGTTTTTCCTGTGTTACCTGATCCACATTGGTTTTTGCATAATTGCTGCCATTGCTCCACCAATTGTATTCCAAGGGAAATCATTAACGGGCATATTGGCCGCGATCGACACTTTCTCTGAGCATTTGATAATTGGGATCTTTTACTTCGTGGGGTTTGCACTATTTTGCTTGGAGACACTGCTGAGCATCGGGGTTCTTCAGAAAGTATACATGTACTTCCGAGGGCATAAGTGA.

[0012] In another aspect, the present application relates to an application of a wheat secretory carrier-associated membrane protein TaSCAMP6 in breeding of a wheat stripe disease resistant variety.

[0013] Further, in the application, the nucleotide sequence of the wheat secretory carrier-associated membrane protein gene TaSCAMP6 is expressed by Agrobacterium-mediated genetic transformation, has a positive regulation effect in the interaction between wheat and Puccinia, and overexpression of the nucleotide sequence of the wheat secretory carrier-associated membrane protein gene TaSCAMP6 can enhance the resistance of wheat to Puccinia.

[0014] In addition, the application relates to a wheat stripe rust resistant variety cultivation method, and the nucleotide sequence of the wheat secretory carrier-associated membrane protein gene TaSCAMP6 is expressed in plants or introduced into the plants.

[0015] Further, the wheat stripe rust resistant variety cultivation method provided by the application comprises the following steps: transforming the nucleotide sequence of the wheat secretory carrier-associated membrane protein gene TaSCAMP6 into cells of the plants to obtain a plant variety with the transgenic wheat secretory carrier-associated membrane protein TaSCAMP6.

[0016] Further, the wheat stripe rust resistant variety cultivation method provided by the application comprises the following steps: constructing an expression vector containing the nucleotide sequence of the wheat secretory carrier-associated membrane protein gene TaSCAMP6; and transforming the young embryo of the plants by using an Agrobacterium-mediated genetic transformation method to obtain a plant variety with overexpression of the wheat secretory carrier-associated membrane protein TaSCAMP6.

[0017] Further, in the wheat stripe rust resistant variety cultivation method provided by the application, the plants are monocotyledonous plants, the monocotyledonous plants are cereal crops, and the cereal crops are wheat.

[0018] Compared with the prior art, the technical scheme provided by the application has at least the following beneficial effects or advantages:

[0019] (1) Compared with traditional disease-resistant breeding techniques, plant disease-resistant genetic engineering techniques can break through the reproductive isolation between species and the incompatibility of distant hybridization, realize the directional improvement of target traits in a short time, and provide more comprehensive, sustainable and broad-spectrum protection for crops. Through gene function research, it is found that the wheat secretory carrier-associated membrane protein TaSCAMP6 has a positive regulation effect in the defense reaction of wheat against Puccinia, that is, overexpression of the nucleotide sequence of the wheat secretory carrier-associated membrane protein gene TaSCAMP6 can improve the resistance of wheat to Puccinia. When the nucleotide sequence of the wheat secretory carrier-associated membrane protein gene TaSCAMP6 is overexpressed in a plant body, the plant can be endowed with certain disease resistance.

[0020] (2) The application provides a method for cultivating a wheat stripe disease resistant variety. The method is assisted by genetic engineering technology, overexpresses the wheat secretion carrier related membrane protein TaSCAMP6 in a wheat plant body, and enhances the resistance of the wheat to a stripe disease pathogen. It is verified that the overexpressed TaSCAMP6 wheat obtained by the method shows resistance to the main epidemic race of the stripe disease. The application provides a new technical idea for cultivating a wheat stripe disease resistant variety from the perspective of molecular biology, and effectively solves the technical problems. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 is an expression profile analysis schematic diagram of the TaSCAMP6 gene provided by the embodiment of the application. The stripe disease CYR31 (affinity) and CYR23 (non-affinity) races are inoculated. It is found that the expression amount of the TaSCAMP6 gene reaches the highest in the non-affinity system (inoculated with CYR23) for 24 h of infection, indicating that the TaSCAMP6 gene is induced and expressed by the wheat stripe disease, and the TaSCAMP6 gene may be involved in the resistance of the wheat to the stripe disease.

[0022] Figure 2 is a PCR detection result of the TaSCAMP6 gene overexpression plant provided by the embodiment of the application. L74 and L92 are the line Line74 and Line92 of the gene overexpression plant; M is a DNA marker; WT is a wild type; and H2O is a water control group.

[0023] Figure 3 is a TaSCAMP6 gene expression vector diagram provided by the embodiment of the application. Wherein LB and RB are homologous arms; ZmUbi is a promoter; TaSCAMP6 is a TaSCAMP6 gene; T-NOS is a termination element; and Bar is a herbicide screening marker gene.

[0024] Figure 4 is a phenotype result diagram of the TaSCAMP6 gene overexpression plant inoculated with the stripe disease CYR32 provided by the embodiment of the application. TaSCAMP-6-OE#L74 and TaSCAMP-6-OE#-L92 are TaSCAMP6 gene overexpression plants, CYR32 represents the stripe disease toxicity race CYR32, and Fielder is a wild type wheat variety. DETAILED DESCRIPTION

[0025] In the following, the technical solutions of the application are described in combination with the embodiments, but the application is not limited to the following embodiments.

[0026] In order for those skilled in the art to better understand the technical solutions of the application and implement the same, the application is further described in combination with specific embodiments and drawings, but the embodiments are not limiting to the application.

[0027] The experimental methods and detection methods described in the following examples are all conventional methods unless otherwise specified; the reagents and materials can be purchased on the market unless otherwise specified.

[0028] Example 1

[0029] This example provides the application of wheat secretory carrier-associated membrane protein gene TaSCAMP6 in the improvement of wheat resistance to rust.

[0030] First, qRT-PCR was used to determine the function of TaSCAMP6 in the interaction between wheat and stripe rust fungus.

[0031] Based on qRT-PCR, the expression amount of TaSCAMP6 gene at different time points of stripe rust fungus infection of wheat was determined by real-time quantitative PCR using specific primers of wheat secretory carrier-associated membrane protein TaSCAMP6 gene and taking elongation factor gene TaEF1-α as an internal reference. The induced expression of wild-type wheat Fielder inoculated with stripe rust fungus CYR23 (non-affinity) and stripe rust fungus CYR31 (affinity) at different time points (0 h, 24 h, 48 h, 72 h, 96 h, 120 h, 168 h, and 216 h of stripe rust fungus infection) was detected by qRT-PCR.

[0032] TaSCAMP6 quantitative primer:

[0033] Forward primer: TaSCAMP6-qRT-F: GCATCACGACCCCAACC;

[0034] Reverse primer: TaSCAMP6-qRT-R: GCCTCACGACGCCTCAG.

[0035] Internal reference TaEF1-α primer:

[0036] Forward primer: TaEF1α-F: TGGTGTCATCAAGCCTGGTATGGT;

[0037] Reverse primer: TaEF1α-R: ACTCATGGTGCATCTCAACGGACT.

[0038] The test results are shown in Figure 1 The results show that the expression amount of TaSCAMP6 gene reaches the highest at 24 h of infection in the non-affinity system (inoculated with CYR23), indicating that TaSCAMP6 gene is induced to express by wheat stripe rust fungus, and TaSCAMP6 gene may be involved in the resistance of wheat to stripe rust fungus.

[0039] The application further provides application of the wheat secretory carrier-associated membrane protein TaSCAMP6 in cultivating and improving wheat rust-resistant varieties, and the application comprises the following steps:

[0040] The verification method of the application of the wheat secretory carrier-associated membrane protein TaSCAMP6 in cultivating and improving wheat rust-resistant varieties comprises the following steps:

[0041] S101, obtaining TaSCAMP6 overexpression wheat, and performing molecular detection on the obtained TaSCAMP6 overexpression wheat;

[0042] S102, inoculating T1 generation overexpression plants with the prevailing race CYR32 of Puccinia striiformis and identifying the resistance of the transgenic plants to the prevailing race of the stripe rust.

[0043] The TaSCAMP6 transgenic Line74 plants and the TaSCAMP6 transgenic Line92 plants are obtained by overexpressing the TaSCAMP6 gene in the Line74 and Line92 strains respectively by using the transgenic technology, and the TaSCAMP6 transgenic positive plants are detected by using the PCR technology, and the PCR products are detected by using 1% agarose gel electrophoresis. Figure 2 Figure 2 In the figure, L74 and L92 are the TaSCAMP6 transgenic Line74 and Line92 strains; M is a DNA marker; WT is a wild type; and H2O is a water control group.

[0044] The nucleotide sequence of the wheat secretory carrier-associated membrane protein gene TaSCAMP6 is shown in SEQ ID NO: 1.

[0045] The amino acid sequence encoded by the wheat secretory carrier-associated membrane protein gene TaSCAMP6 is shown in SEQ ID NO: 2.

[0046] The plant of the application is preferably a monocotyledonous plant, and is more preferably a cereal crop that can be successfully infected and colonized by the wheat stripe rust fungus, and is particularly preferably wheat.

[0047] The application of the wheat secretory carrier-associated membrane protein gene TaSCAMP6 in improving wheat rust-resistant varieties provided by the application comprises the following steps:

[0048] ​The obtained TaSCAMP6 overexpression plants are inoculated with the affinity strain CYR32, and the disease resistance of the wheat is enhanced, indicating that TaSCAMP6 plays a positive regulation role in the interaction between the wheat and the stripe rust.

[0049] The CYR32 is inoculated to the overexpression plants, phenotype identification is carried out, and it is found that the TaSCAMP6 overexpression plants show enhanced resistance to the stripe rust CYR32, and the expression vector map is as shown in Figure 3 .

[0050] Forward primer: TaSCAMP6-nucleotide-F: ATGCATCACGACCCCAA;

[0051] Reverse primer: TaSCAMP6-nucleotide-R: CTTATGCCCTCGGAAGTAC.

[0052] The application of the wheat secretory carrier-associated membrane protein gene TaSCAMP6 in the improvement of a wheat rust-resistant variety is provided, PCR detection is carried out on the wild type 'Fielder' and the TaSCAMP6 overexpression plants, the main epidemic race CYR32 of the stripe rust is inoculated to the wild type and the positive strain of the TaSCAMP6 overexpression plants, and spores are produced on the wild type leaf after 14 days of inoculation, as shown in Figure 4 . The results show that the TaSCAMP6 overexpression plants have enhanced resistance to the stripe rust.

[0053] In conclusion, the application of the wheat secretory carrier-associated membrane protein TaSCAMP6 in the improvement of a wheat rust-resistant variety is provided, the TaSCAMP6 expression vector is constructed by using a gene recombination technology, the expression vector is delivered into the recipient wheat Fielder by using an agrobacterium-mediated wheat genetic transformation technology, the overexpression plants are identified as positive transgenic plants by PCR detection, the L74 and L92 two strains of the T1 generation of the positive transgenic plants are inoculated with the epidemic race CYR32, and it is found that the wheat secretory carrier-associated membrane protein TaSCAMP6 overexpression plants show reduced spore production and enhanced resistance compared with the Fielder after 14 days of observation.

[0054] The above merely describes preferred embodiments of the present application and is not used to limit the present application, and any modification, equivalent replacement and improvement made within the spirit and principle of the present application should be included in the protection scope of the present application.

Claims

1. A wheat secreted carrier-related membrane protein gene TaSCAMP6 In use in wheat breeding for resistance to stripe rust, characterized in that, The wheat secretory carrier-associated membrane protein gene TaSCAMP6 The nucleotide sequence of the wheat secretory carrier-associated membrane protein gene is shown as SEQ ID NO:

1.

2. Application of wheat secretory carrier-associated membrane protein TaSCAMP6 in breeding of wheat stripe disease resistant varieties, characterized in that, The amino acid sequence of the wheat secretory carrier-associated membrane protein TaSCAMP6 is shown as SEQ ID NO:

2.

3. Use according to claim 1, characterized in that, The nucleotide sequence of the wheat secretory carrier-associated membrane protein gene TaSCAMP6 expressed by means of agrobacterium-mediated genetic transformation has a positive regulation effect in the interaction between wheat and Puccinia striiformis, and overexpression of the nucleotide sequence of the wheat secretory carrier-associated membrane protein gene TaSCAMP6 can enhance the resistance of wheat to Puccinia striiformis.

4. A method for breeding a wheat variety resistant to stripe rust, the method comprising, overexpressing a wheat secretory carrier-associated membrane protein TaSCAMP6 or introducing a wheat secretory carrier-associated membrane protein gene into a plant TaSCAMP6 The amino acid sequence of the wheat secretory carrier-associated membrane protein TaSCAMP6 is shown as SEQ ID NO: 2, and the nucleotide sequence of the wheat secretory carrier-associated membrane protein gene TaSCAMP6 is shown as SEQ ID NO:

1.

5. The method of breeding a wheat variety resistant to stripe rust according to claim 4, wherein, Comprising: The nucleotide sequence of the wheat secretory carrier-associated membrane protein gene TaSCAMP6 is transformed into the cells of the plant to obtain a plant variety overexpressing the wheat secretory carrier-associated membrane protein TaSCAMP6.

6. The method of breeding a wheat variety resistant to stripe rust according to claim 4, wherein, Comprising: Constructing an expression vector containing the nucleotide sequence of the wheat secretory carrier-associated membrane protein gene TaSCAMP6 Transforming the immature embryos of the plants by using the method of Agrobacterium-mediated genetic transformation to obtain plant varieties overexpressing the wheat secretory carrier-associated membrane protein TaSCAMP6.

Citation Information

Patent Citations

  • Wheat receptor-like protein kinase gene TaLEMK1.1 and application thereof

    CN114621967A

  • Wheat receptor-like protein kinase TaFER-NW and application thereof

    CN118460503A