Enrichment culture method of marine microbial flora as well as product and application of enrichment culture method

Abstract

The invention provides an enrichment culture method of a marine microbial flora and a product and application thereof. The enrichment culture method comprises the following steps: step 1, collecting a seawater sample of a marine organism culture area taking kelp as feed; step 2, performing high-temperature and high-pressure sterilization on an inorganic salt culture medium, and then adding kelp powder, mannitol and a yeast extract; adding a collected water sample according to the inoculum size of 1-5%, and then culturing for 7-10 days as a cycle under the conditions of 30-35 DEG C and 150-180 rpm; continuously culturing for 3 cycles, gradually reducing the concentration of mannitol and yeast extract to 0 in each test cycle, and increasing the concentration of kelp powder; and step 3, filtering to remove residual kelp powder, and centrifuging to obtain a precipitate, namely the functional microbial flora. The kelp powder is used as the unique carbon source to domesticate seawater flora in a marine organism culture area, a stable functional microbial flora is obtained, and the flora can efficiently ferment kelp or processing by-products of the kelp to produce the kelp sauce rich in umami peptides.

Description

[Technical field]

[0001] The present invention relates to the field of biotechnology, and in particular to a method for enriching and culturing marine microbial flora, and products and applications thereof. [Background technology]

[0002] Kelp is a large cold-water economic algae. It is not only a common marine vegetable, but also has formed an industrial chain in my country that integrates kelp seedling cultivation, breeding, food processing, algae chemical industry and biological product development. The economic, social and ecological benefits of the kelp industry are significant, and it has made important contributions in promoting employment, increasing fishermen's income, providing healthy food for the society, improving the ecological environment, and promoting the development of abalone and sea cucumber industries. According to the "China Fisheries Statistical Yearbook", Fujian Province is the main production area of ​​kelp in my country, with a planting area of ​​more than 20,000 hectares. Its industrial chain is one of the most important pillars of the province's marine economy, with an annual output value of nearly 10 billion yuan. However, at present, the processing of kelp in Fujian is mainly based on light dried and salted primary products, accounting for about 80% of kelp products. A small amount is processed into ready-to-eat products or leisure products, lacking high value-added intensive processing. In addition, through research on many kelp processing companies in Fujian Province, it was found that due to the poor taste of the root neck and leaf edges of kelp, nearly 40% of by-products produced during the processing process were not effectively utilized. As a nutrient-rich edible algae, kelp contains about 40 kinds of effective active ingredients, which give kelp a good taste, strong umami flavor and high nutritional value.

[0003] Umami peptides are a class of small molecule oligopeptides that are synthesized by protein hydrolysis or amino acids, with a relative molecular mass of 200-2000Da and produce umami taste. Compared with other umami substances, umami peptides have better processing characteristics, stronger flavoring ability, and higher nutritional value. They are in line with the food processing trend of "natural, nutritious, and safe" and have become a research hotspot in food flavor science and a key direction for the development of natural umami agents. The flavoring effect of umami peptides mainly depends on the length of the peptide chain, the amino acid composition, the order of amino acid arrangement, the chemical modification of the peptide, etc.; based on the protein crystal structure of the taste receptor heterodimer (T1R1 / T1R3), it is clarified that the hydrogen bond interaction and hydrophobic interaction between the flavoring amino acids in umami peptides, such as glutamic acid and aspartic acid, and the key residues of the T1R3 receptor are the molecular basis of the flavor of umami peptides. However, the research on umami peptides in my country is still in its infancy, mainly focusing on the extraction and identification of umami substances, and there is a lack of research on the taste mechanism and structural characterization. In addition, the traditional preparation method of umami peptides has the disadvantages of low yield, many impurities, and high cost. In addition, there are only a few types of food additives on the market, such as monosodium glutamate and chicken essence, and there is a lack of natural flavor enhancers. Therefore, under the background of the Healthy China strategy, flavor enhancers with both cost-effectiveness and health attributes will benefit the most. Guided by the basic research of umami peptides, the development of pure natural, high-yield, high-purity and low-cost flavor enhancers is the key direction of my country's food industry in the future.

[0004] By searching domestic and foreign invention patent applications related to kelp, it is found that there are few patents related to the utilization of kelp processing by-products, and they are mainly aimed at the development and utilization of polysaccharides or oligosaccharides in kelp, ignoring the recycling of proteins in kelp processing by-products, and there are no invention patent applications from the production of kelp umami peptides by fermentation of microbial flora. The enzymatic method commonly used in the currently authorized patents is to prepare umami peptides. Generally speaking, the enzymatic efficiency of a single protease preparation is extremely low, and the price of a composite enzyme preparation is relatively high, generally 1,000-20,000 yuan / kg. Therefore, the cost of preparing umami peptides by enzymatic method is relatively high, and the catalytic activity of the enzyme preparation is affected by multiple factors during the enzymatic hydrolysis process, making it difficult to mass produce. [Summary of the invention]

[0005] The technical problem to be solved by the present invention is to provide a method for enriching and culturing marine microbial flora, and its products and applications, by domesticating the seawater flora in the marine biological breeding area with kelp powder as the only carbon source, to obtain a stable functional microbial flora, which can efficiently ferment kelp or its processing by-products to produce kelp sauce rich in umami peptides.

[0006] The present invention is achieved in that:

[0007] A method for enriching and culturing a marine microbial flora, the enrichment and culturing method comprising the following steps:

[0008] Step 1, collecting seawater samples from a marine organism breeding area that uses kelp as feed;

[0009] Step 2, sterilizing the inorganic salt culture medium with high temperature and high pressure, adding kelp powder, mannitol, and yeast extract; adding the collected water sample at an inoculation rate of 1-5%, and then culturing at 30-35° C. and 150-180 rpm for a cycle of 7-10 days;

[0010] Subsequently, the culture was continued for several cycles, with the concentrations of mannitol and yeast extract gradually reduced and the concentration of kelp powder increased in each experimental cycle;

[0011] Step 3: Filter to remove the remaining kelp powder and obtain the precipitate after centrifugation, which is the functional microbial flora.

[0012] Furthermore, the components and contents of the inorganic salt culture medium in step 2 are as follows: sodium chloride 2.26 g / L; sodium sulfate 3.24 g / L; magnesium sulfate 3.248 g / L; calcium chloride 1.153 g / L; sodium bicarbonate 0.198 g / L; potassium chloride 0.721 g / L; sodium bromide 0.058 g / L; boric acid 0.058 g / L; sodium silicate 0.0024 g / L; phosphoric acid 0.002 g / L; ferric citrate 0.1 g / L; aluminum hexachloride 0.013 g / L; ammonia 0.002 g / L; lithium 0.0013 g / L.

[0013] Furthermore, the initial concentrations of kelp powder, mannitol, and yeast extract added in step 2 are 0.5%, 2%, and 2% by mass volume, respectively;

[0014] In the subsequent 3 cycles of culture, the concentration of kelp powder was increased in sequence of 1%, 1.5%, and 2%, and the concentration of mannitol and yeast extract was decreased in sequence of 1.5%, 1%, and 0.5%.

[0015] Furthermore, the high temperature and high pressure conditions in step 2 are 115-121°C.

[0016] Furthermore, a marine microbial community is provided, wherein the marine microbial community is obtained by enrichment culture according to the enrichment culture method of the marine microbial community.

[0017] Furthermore, in the microbial flora, microorganisms of four phyla, namely Euryarvhaeota, Proteobacteria, Balneolaeota and Firmicutes, account for 75%-95% of the total flora.

[0018] Furthermore, in the microbial flora, Euryarvhaeota accounts for 30-45% of the total flora, Proteobacteria accounts for 15-20% of the total flora, Balneolaeota accounts for 10-15% of the total flora, and Firmicutes accounts for 5-10% of the total flora.

[0019] Furthermore, an application of a marine microbial flora is provided, wherein the microbial flora is used to ferment kelp to prepare kelp sauce rich in umami peptides.

[0020] Furthermore, the step of using the microbial flora to ferment kelp is as follows: inoculating 1-5% of the microbial flora into the kelp, and fermenting at room temperature for 14-21 days to obtain kelp sauce rich in umami peptides.

[0021] Furthermore, water is added to the kelp sauce rich in umami peptides to prepare a solution, and the filtrate is obtained after filtration, and then centrifuged to remove water-insoluble components, and then the kelp umami peptide solution is obtained after passing through a 0.22 or 0.45 μm filter membrane, and the kelp umami peptide is obtained after freeze-drying.

[0022] The present invention has the following advantages:

[0023] 1. The present invention uses kelp powder as the sole carbon source to domesticate seawater samples from a marine biological breeding area that uses kelp as feed to obtain a stable functional microbial flora. The functional flora has strong protease activity and alginate lyase activity, and has very excellent protein and polysaccharide degradation effects. Microorganisms of the four phyla of Euryarvhaeota, Proteobacteria, Balneolaeota, and Firmicutes in the flora account for 75%-95% of the total flora, and the composition of the flora is very stable.

[0024] This functional flora is used to ferment kelp or its processing by-products. During the fermentation process, kelp protein and polysaccharides are degraded and converted into oligopeptides under the action of protease and alginate lyase. These oligopeptides have extremely strong umami characteristics and high content, and have good application prospects in the development of natural flavor enhancers.

[0025] 2. The present invention uses cheap kelp processing by-products as substrates, which greatly reduces production costs, and can continuously produce kelp umami peptides on a large scale through microbial fermentation. Compared with the enzymatic method commonly used in the prior art to prepare umami peptides, it has great advantages in cost and production scale.

[0026] 3. The present invention clarifies the amino acid composition of kelp oligosaccharides that can present freshness through separation, identification and molecular docking. The content of these oligopeptides can be used as an indicator, laying a good foundation for the formulation of kelp umami peptide food additives.

Brief Description of the Drawings

[0027] The present invention will be further described below in conjunction with embodiments with reference to the accompanying drawings.

[0028] Figure 1 This is a comparison diagram of kelp before and after fermentation in an embodiment of the present invention.

[0029] Figure 2 This is a composition analysis diagram of the kelp-degrading functional bacteria in an embodiment of the present invention.

[0030] Figure 3 Schematic diagram of the functional gene composition of kelp degradation and conversion into kelp sauce in the embodiment of the present invention.

[0031] Figure 4 This is a diagram showing the flavor effects of kelp sauce and four oligopeptides in an embodiment of the present invention. [Specific implementation method]

[0032] The following will be combined with the attached Figure 1-4 The technical scheme of the present invention is clearly and completely described in detail with specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be purchased commercially.

[0033] Example

[0034] 1. Sample collection

[0035] The collected samples include seawater samples from marine aquaculture areas, mainly including the kelp and abalone farming area in Dacheng Village, Xiaocheng Town, Lianjiang County, Fuzhou City, Fujian Province, and the kelp and sea cucumber farming area in Shacheng Port, Ningde City, Fujian Province. 1L of water sample was collected at each location.

[0036] 2. Enrichment of functional microbial flora in kelp fermentation

[0037] The functional bacteria were enriched by oligotrophic culture with kelp residue as the sole carbon source. 100 mL of inorganic salt culture medium (sodium chloride 2.26 g / L; sodium sulfate 3.24 g / L; magnesium sulfate 3.248 g / L; calcium chloride 1.153 g / L; sodium bicarbonate 0.198 g / L; potassium chloride 0.721 g / L; sodium bromide 0.058 g / L; boric acid 0.058 g / L; sodium silicate 0.0024 g / L; phosphoric acid 0.00 2g / L; ferric citrate 0.1g / L; aluminum hexachloride 0.013g / L; ammonia 0.002g / L; lithium 0.0013g / L) were sterilized at 121℃ and then added with kelp powder, mannitol and yeast extract at initial concentrations of 0.5%, 2% and 2% (mass volume ratio), 10mL of the collected water sample was added, and then cultured at 30℃ and 180rpm for 7 days to achieve the purpose of enriching the bacterial flora.

[0038] Subsequently, in each test cycle, the concentrations of mannitol and yeast extract were gradually reduced and the concentration of kelp powder was increased. The concentration of kelp powder was increased in sequence of 1%, 1.5%, 2%, and 5%, and the concentrations of mannitol and yeast extract were decreased in sequence of 1.5%, 1%, 0.5%, and 0. The residual kelp powder was removed by filtering through 8 layers of gauze, and the precipitate was obtained after centrifugation at 12000rpm, which was the functional flora. According to the water samples from each region, the enriched functional microbial flora were grouped and numbered as follows: Lianjiang-1, Lianjiang-2, ningde-3, ningde-4, ningde-5, ningde-6, and control group (water sample before enrichment culture).

[0039] 3. Fermented kelp sauce

[0040] 1% of the above-mentioned 6 groups of enriched microbial flora were inoculated into 6 groups of kelp respectively, and fermented at room temperature for 20 days to obtain kelp sauce rich in umami peptides. Figure 1 shown.

[0041] The kelp can be any part of the kelp, such as the root neck and leaf edge of the kelp.

[0042] 4. Analysis of protease activity of bacterial flora

[0043] The protease activity in the bacterial flora was determined with reference to the national SB / T 10317-1999 "Protease Activity Assay". Weigh 1g of kelp sauce, add 10ml of sterile water and shake vigorously for 1min, filter with 8 layers of gauze to remove the kelp residue, then centrifuge at 12000rpm for 10min, remove the precipitate, and take out the supernatant for determination. 1 mg / ml casein solution was prepared with lactic acid-sodium lactate buffer at pH 3.0, borax-sodium hydroxide buffer at pH 10.0, phosphate-sodium phosphate buffer at pH 7.5, and borax-sodium hydroxide buffer at pH 10.0, respectively. During the determination, 100 ul of the sample was added to 400 ul of the casein solution, and the reaction was carried out in a 40°C water bath for 10 minutes. Then, 100 ul of trifluoroacetic acid was added to terminate the reaction. After centrifugation, the supernatant was taken, and 500 ul of sodium carbonate and 100 ul of folin were added respectively. The absorbance of the reaction solution at a wavelength of 660 nm was determined by an enzyme reader. One unit of enzyme activity was defined as the amount of enzyme required to hydrolyze 1 ug of casein per minute at 30°C.

[0044] 5. Analysis of alginate lyase activity of bacterial flora

[0045] The alginate lyase activity of the bacterial community was determined using the 3,5-dinitrosalicylic acid (DNS) method. Weigh 1g of sodium alginate and add 20ml of pH 7.5 phosphate-sodium phosphate buffer to prepare the substrate. Weigh 1g of kelp sauce, add 10ml of sterile water, shake and mix, centrifuge at 10000rpm, take 150ul of the supernatant (4) and add 50ul of the substrate, keep warm in a 30℃ water bath for 30min, add 200L of DNS solution (104g / 5L NaOH, 30g / L 3,5-dinitrosalicylic acid, 910g / L potassium sodium tartrate, 25g / L phenol, 25g / L anhydrous sodium sulfite), and stop the reaction in a 100℃ boiling water bath for 10min. The absorbance of the reaction solution at a wavelength of 540nm was measured using an enzyme reader. One unit of enzyme activity is defined as the amount of enzyme required to hydrolyze 1ug of casein per minute at 30℃.

[0046] The details are shown in Table 1 below:

[0047] Table 1

[0048]

[0049] As can be seen from the above table, the functional microbial flora enriched in the present invention has strong protease activity and alginate lyase activity, and has very excellent protein and polysaccharide degradation effects.

[0050] 6. Analysis of bacterial flora stability

[0051] The functional bacterial community numbered Lianjiang-2 (HD) was inoculated into kelp by-products at 1%, and solid fermentation was carried out at 28°C for 14 days. The culture was continued for three generations. After the fermentation, the composition of the microbial community in the fermented kelp sauce was analyzed by metagenomic sequencing.

[0052] The results are as follows Figure 2 As shown: HD1 is the first generation, HD2 is the second generation H, and D3 is the third generation; by performing 16S rRNA sequencing analysis on the microbial flora in the three groups of kelp sauce cultures, the microbial composition of the kelp-degrading functional flora was analyzed. Microorganisms from the four phyla of Euryarvhaeota, Proteobacteria, Balneolaeota, and Firmicutes accounted for 80% of the total flora, proving that the composition of the flora is very stable.

[0053] 7. Metagenomic sequencing to analyze the composition of functional microbial flora

[0054] After extracting the total DNA of the fermented kelp sauce sample using a commercial metagenomic DNA extraction kit, primers (F: ACTCCTACGGGAGGCAGCAG (such as SEQ ID NO.1) / R: GGACTACHVGGGTWTCTAAT (such as SEQID NO.2)) were designed according to the conserved region, and sequencing adapters were added to the ends of the primers. PCR amplification was performed, and the products were purified, quantified and normalized to form a sequencing library. The constructed library was first subjected to library quality inspection, and the qualified library was sequenced using Illumina NovaSeq 6000. The raw image data files obtained by high-throughput sequencing (IlluminaNovaSeq and other sequencing platforms) are converted into raw sequencing sequences (SequencedReads) by base calling analysis. The results are stored in FASTQ (abbreviated as fq) file format, which contains the sequence information of the sequencing sequence (Reads) and its corresponding sequencing quality information. Trimmomatic v0.33 software is used to filter the RawReads obtained by sequencing; then cutadapt 1.9.1 software is used to identify and remove primer sequences to obtain Clean Reads that do not contain primer sequences; DADA2 denoising: The dada2 method in QIIME22020.6 is used for denoising, double-end sequence splicing and chimeric sequences are removed to obtain the final valid data (Non-chimeric Reads). The number of sample sequences at each stage is processed by statistical data to evaluate the data quality. The data is mainly evaluated by counting the number of sequences at each stage, sequence length and other parameters. The sequences were clustered using USEARCH[5](version10.0) at a similarity level of 97% (default), and OTUs were filtered using a threshold of 0.005% of all sequence numbers by default. The number of characteristic OTUs for each sample was obtained by clustering or denoising, and visualized using a bar chart. Species annotation was performed using classify-consensus-blast in QIIME2. Based on the alignment method, the most consistent alignment was found among the N (default 3) best alignment results for classification, with a minimum sequence similarity of 90%, a minimum coverage of 90%, and a minimum consistency of 51%.

[0055] Specific as Figure 3 As shown in the figure, by performing metagenomic sequencing analysis on the microbial flora in three kelp sauce cultures, the functional gene composition involved in the degradation and transformation of kelp sauce was analyzed. Figure 2 Dot 6 in the figure represents fresh amino acids. It can be seen that the abundance of genes involved in the metabolic pathway of fresh amino acids is relatively high, with a relative abundance of about 10%.

[0056] 8. Identification of umami peptides in kelp sauce

[0057] Weigh 5 grams of kelp sauce and add 45 mL of water to make a solution. After filtering through 6 layers of gauze, obtain the filtrate. The filtrate is centrifuged at 12000 rpm for 10 minutes to remove the water-insoluble components, and then the kelp umami peptide solution is obtained by passing through a 0.45 μm filter membrane. After freeze-drying, it is reconstituted with 5 mg / mL acetonitrile. The reconstituted kelp umami peptide solution is filtered through a 0.22 uM filter membrane and then enters the high-performance liquid chromatography mass spectrometry analysis. Mobile phase A: acetonitrile + 0.1% formic acid, mobile phase B: water, according to A: B = 1: 9 to 9: 1 gradient elution. The chromatographic column uses a C18 reverse phase column (2.1×100 mm, 1.7 μm, Waters, Bray, Ireland). The molecular weight is identified by a mass spectrometer, and the detection range is 200-2000.

[0058] The details are shown in Table 2 below:

[0059] Table 2

[0060]

[0061]

[0062] It can be seen that the kelp sauce obtained by fermentation of functional microbial flora contains a variety of umami peptides, among which aspartic acid and glutamic acid, two umami amino acids, account for a high proportion.

[0063] 9. Analysis of umami components of kelp sauce and umami peptides

[0064] Four fresh oligopeptides (EIL, STEV, GEEE, SMEAVEA) were chemically synthesized, and the taste effects of kelp sauce and the four oligopeptides were analyzed by electronic tongue. Six different sensor electrodes (platinum, gold, palladium, tungsten, titanium and silver) were used to detect different types of taste chemicals. Sucrose, quinine, salt, monosodium glutamate and citric acid were used as standard substances for sweetness, bitterness, saltiness, umami and sourness, respectively. Before using the electronic tongue, it was preheated for 20 minutes to ensure the stability of the system. After use, the sensor probe was cleaned with 100mL of ultrapure water to remove samples or impurities that may remain on the probe.

[0065] Test results such as Figure 4 As shown, it was found that the kelp sauce and the four oligopeptides had extremely strong umami taste. It can be seen that the umami taste of the kelp sauce is imparted by these four umami peptides, especially the oligopeptide GEEE, which also has a strong salty taste.

[0066] In summary, the present invention has the following advantages:

[0067] 1. The present invention uses kelp powder as the sole carbon source to domesticate seawater samples from a marine biological breeding area that uses kelp as feed to obtain a stable functional microbial flora. The functional flora has strong protease activity and alginate lyase activity, and has very excellent protein and polysaccharide degradation effects. Microorganisms of the four phyla of Euryarvhaeota, Proteobacteria, Balneolaeota, and Firmicutes in the flora account for 75%-95% of the total flora, and the composition of the flora is very stable.

[0068] This functional flora is used to ferment kelp or its processing by-products. During the fermentation process, kelp protein and polysaccharides are degraded and converted into oligopeptides under the action of protease and alginate lyase. These oligopeptides have extremely strong umami characteristics and high content, and have good application prospects in the development of natural flavor enhancers.

[0069] 2. The present invention uses cheap kelp processing by-products as substrates, which greatly reduces production costs, and can continuously produce kelp umami peptides on a large scale through microbial fermentation. Compared with the enzymatic method commonly used in the prior art to prepare umami peptides, it has great advantages in cost and production scale.

[0070] 3. The present invention clarifies the amino acid composition of kelp oligosaccharides that can present freshness through separation, identification and molecular docking. The content of these oligopeptides can be used as an indicator, laying a good foundation for the formulation of kelp umami peptide food additives.

[0071] Although the specific implementation modes of the present invention are described above, those skilled in the art should understand that the specific implementation modes described are only illustrative and are not intended to limit the scope of the present invention. Equivalent modifications and changes made by those skilled in the art in accordance with the spirit of the present invention should be included in the scope of protection of the claims of the present invention.

Claims

1. A method for enriching and culturing a marine microbial flora, characterized in that: The enrichment culture method steps are as follows: Step 1, collecting seawater samples from a marine organism breeding area that uses kelp as feed; Step 2, sterilize the inorganic salt culture medium with high temperature and high pressure, add kelp powder, mannitol, and yeast extract; add the collected water sample at an inoculation rate of 1-5%, and then culture at 30-35° C. and 150-180 rpm for 7-10 days as a cycle; Subsequently, the culture was continued for several cycles, with the concentrations of mannitol and yeast extract gradually reduced and the concentration of kelp powder increased in each experimental cycle; Step 3: Filter to remove the remaining kelp powder and obtain the precipitate after centrifugation, which is the functional microbial flora.

2. The method for enriching and culturing a marine microbial flora according to claim 1, characterized in that: The components and contents of the inorganic salt culture medium in step 2 are as follows: sodium chloride 2.26g / L; sodium sulfate 3.24g / L; magnesium sulfate 3.248g / L; calcium chloride 1.153g / L; sodium bicarbonate 0.198g / L; potassium chloride 0.721g / L; sodium bromide 0.058g / L; boric acid 0.058g / L; sodium silicate 0.0024g / L; phosphoric acid 0.002g / L; ferric citrate 0.1g / L; aluminum hexachloride 0.013g / L; ammonia 0.002g / L; lithium 0.0013g / L.

3. The method for enriching and culturing a marine microbial flora according to claim 1, characterized in that: The initial concentrations of kelp powder, mannitol and yeast extract added in step 2 are 0.5%, 2% and 2% by mass volume respectively; In the subsequent three cycles of culture, the concentration of kelp powder was increased in sequence of 1%, 1.5%, and 2%, and the concentration of mannitol and yeast extract was decreased in sequence of 1.5%, 1%, and 0.5%.

4. The method for enriching and culturing a marine microbial flora according to claim 1, characterized in that: The high temperature and high pressure conditions in step 2 are 115-121°C.

5. A marine microbial flora, characterized in that: The marine microbial flora is obtained by enrichment culture according to the enrichment culture method for a marine microbial flora according to any one of claims 1 to 4.

6. A marine microbial flora according to claim 5, characterized in that: In the microbial flora, microorganisms of four phyla, namely Euryarvhaeota, Proteobacteria, Balneolaeota and Firmicutes, account for 75% to 95% of the total flora.

7. A marine microbial flora according to claim 6, characterized in that: In the microbial flora, Euryarvhaeota accounts for 30-45% of the total flora, Proteobacteria accounts for 15-20% of the total flora, Balneolaeota accounts for 10-15% of the total flora, and Firmicutes accounts for 5-10% of the total flora.

8. An application of a marine microbial flora, characterized in that: The marine microbial flora is obtained by enrichment culture according to the enrichment culture method of a marine microbial flora according to any one of claims 1 to 4; the microbial flora is used to ferment kelp to prepare kelp sauce rich in umami peptides.

9. The use of a marine microbial flora according to claim 8, characterized in that: The steps of using the microbial flora to ferment kelp are as follows: inoculating 1-5% of the microbial flora into the kelp, and fermenting at room temperature for 14-21 days to obtain kelp sauce rich in umami peptides.

10. The use of a marine microbial flora according to claim 9, characterized in that: The kelp sauce rich in umami peptides is added with water to form a solution, and the filtrate is obtained after filtration. The water-insoluble components are removed by centrifugation, and then the kelp umami peptide solution is obtained after passing through a 0.22 or 0.45 μm filter membrane. The kelp umami peptide is obtained after freeze-drying.

Images