A gntR17 gene deleted strain M5ΔgntR17 strain and its construction method and application

Abstract

The present invention provides a gntR17 gene deleted strain M5ΔgntR17 strain and its construction method and application, belonging to the field of biotechnology. The M5ΔgntR17 strain is deposited in the General Microbiology Center of China Committee for the Collection of Microorganisms, with a deposit date of July 4, 2024, and a deposit number of CGMCCNO.46061. The present invention found that the gntR17 gene is a related gene that affects the virulence of Brucella, and the deletion of the gntR17 gene can weaken the virulence of Brucella and improve safety. After deletion, it can significantly reduce the survival ability of Brucella in cells and mice, and has potential application value. The M5ΔgntR17 strain constructed after knocking out the gntR17 gene has weakened virulence than the original Brucella M5 strain, has high safety, and has similar immune protection to the M5-90Δ26 vaccine, and can be used as a candidate live attenuated vaccine strain for preventing animal brucellosis.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a gntR17 gene deleted strain M5ΔgntR17 strain and a construction method and application thereof. Background Art

[0002] Brucellosis, abbreviated as "brucellosis", is an important bacterial infectious disease that is transmitted between humans and animals. Infected animals mainly cause orchitis or epididymitis in male animals, and miscarriage, premature birth or stillbirth in female animals; infected humans mainly cause undulant fever and various complications.

[0003] Brucellosis is widespread and widespread worldwide, with approximately 500,000 new cases reported worldwide each year. This severely restricts international trade in animals and animal products, significantly impacting public health and socioeconomic development. Brucellosis is widespread in my country, with a general prevalence trend of higher prevalence in the north and lower prevalence in the south. In the past two decades, increased animal production, trade, and circulation have led to a resurgence of brucellosis, with incidence rates rising annually and reaching historically high levels, severely jeopardizing public health and the sustainable development of the animal husbandry industry.

[0004] The prevention and control of brucellosis primarily relies on quarantine and vaccination. Research and development of brucellosis vaccines has been ongoing since the early 20th century, evolving through inactivated, attenuated live, mutant, and new vaccines. Studies have shown that attenuated live Brucella vaccines offer significant protection, significantly outperforming inactivated vaccines. Therefore, vaccinating animals with attenuated live Brucella vaccines is a crucial measure for effectively controlling brucellosis. However, current attenuated live Brucella vaccines for veterinary use have limitations, such as high toxicity and significant atavism, which can cause harm to both humans and animals, and in severe cases, lead to disease. Furthermore, there is no effective vaccine for human brucellosis, and vaccination of animals with attenuated live vaccines carries the risk of transmission to humans. Therefore, developing safe and effective vaccines for both animals and humans is crucial for effectively curbing the brucellosis epidemic.

[0005] With the development of molecular biology techniques and a deeper understanding of the pathogenic mechanisms of Brucella, new genetically engineered vaccines for brucellosis are expected to replace traditional vaccines and overcome the shortcomings of existing vaccines. Therefore, the development of a new genetically engineered vaccine for brucellosis is of great significance for effectively curbing the epidemic. Summary of the Invention

[0006] The purpose of the present invention is to provide a gntR17 gene deleted strain M5ΔgntR17 strain and its construction method and application. The M5ΔgntR17 strain constructed after knocking out the gntR17 gene is less virulence than the original Brucella M5 strain and has high safety. It can be used as a candidate attenuated live vaccine strain for preventing animal brucellosis.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a gntR17 gene deleted strain M5ΔgntR17 strain, wherein the M5ΔgntR17 strain is obtained by deleting the gntR17 gene from the Brucella melitensis M5 strain, and the M5ΔgntR17 strain is deposited in the China General Microbiological Culture Collection Center with a deposit date of July 4, 2024 and a deposit number of CGMCC NO.46061.

[0009] The present invention also provides a method for constructing the above-mentioned M5ΔgntR17 strain, comprising the following steps:

[0010] (1) PCR amplified the upstream homology arm fragment and the downstream homology arm fragment of the gntR17 gene, and after the amplification, the two fragments were fused to obtain a fusion fragment;

[0011] (2) The fusion fragment was ligated with the linearized suicide plasmid pKB by homologous recombination to obtain a ligation product, and the suicide plasmid pKB-ΔgntR17 was screened;

[0012] (3) The suicide plasmid was electroporated into Brucella melitensis competent cells, and the M5ΔgntR17 strain was obtained by screening.

[0013] Furthermore, in step (1), the sequence of the primer group used to amplify the upstream homology arm fragment of the gntR17 gene is: GntR17-UF shown in SEQ ID NO: 1 and GntR17-UR shown in SEQ ID NO: 2; the sequence of the primer group used to amplify the downstream homology arm fragment of the gntR17 gene is: GntR17-DF shown in SEQ ID NO: 3 and GntR17-DR shown in SEQ ID NO: 4; the primer group used for the fusion is GntR17-UF and GntR17-DR.

[0014] Furthermore, in step (2), the screening method is: the ligation product of step (2) is transformed into Escherichia coli DH5a competent cells, and the kanamycin-resistant strain is screened in LB plates and liquid culture medium containing kanamycin, and then the bacterial liquid is PCR identified, and the pKB-ΔgntR17 plasmid is extracted.

[0015] Furthermore, in step (3), the screening method is: inoculating the transformed Brucella melitensis competent cells on a TSA plate containing kanamycin, picking up monoclonal bacteria for culture, and then negatively screening on a TSA plate containing sucrose, picking up monoclonal colonies, and continuing to culture them, using inner identification primers and outer identification primers, and PCR identifying the deletion strain M5ΔgntR17.

[0016] Furthermore, the sequences of the inner identification primers are: InGntR17-F shown in SEQ ID NO.5 and InGntR17-R shown in SEQ ID NO.6; the sequences of the outer identification primers are: OutGntR17-F shown in SEQ ID NO.7 and OutGntR17-R shown in SEQ ID NO.8.

[0017] The present invention also provides an application of a gntR17 gene deleted strain M5ΔgntR17 in the preparation of a Brucella attenuated live vaccine.

[0018] The M5ΔgntR17 strain of the present invention has the following beneficial effects compared with the prior art:

[0019] (1) The present invention found that the gntR17 gene is a related gene that affects the virulence of Brucella. The deletion of the gntR17 gene can weaken the virulence of Brucella and improve its safety. After deletion, it can significantly reduce the survival ability of Brucella in cells and mice, and has potential application value.

[0020] (2) The M5ΔgntR17 strain constructed after knocking out the gntR17 gene is less virulent than the original Brucella M5 strain and has higher safety. It has similar immune protection as the M5-90Δ26 vaccine and can be used as a candidate live attenuated vaccine strain for preventing animal brucellosis.

[0021] (3) The present invention found that the deletion of gntR17 gene affects the basic phenotype of Brucella, such as slowing down the growth rate in a low-nutrient environment and significantly reducing the ability to resist killing by immune mediators. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0023] Figure 1 The results of PCR amplification of the target gene fragment in Example 1;

[0024] Figure 2The results of identifying the suicide plasmid pKB-ΔgntR17 using universal primers M13F(-47) / R(-48) in Example 1;

[0025] Figure 3 Schematic diagram of PCR identification of the M5ΔgntR17 deletion strain using inner and outer primers in Example 1;

[0026] Figure 4 The results of PCR identification of the M5ΔgntR17 deletion strain in Example 1; A shows the PCR identification of the parental strain M5 and the M5ΔgntR17 deletion strain using the inner identification primers InGntR17-F and InGntR17-R; B shows the PCR identification of the parental strain M5 and the M5ΔgntR17 deletion strain using the outer identification primers OutGntR17-F and OutGntR17-R;

[0027] Figure 5 Experimental Example 1 is a Brucella growth curve determination, wherein A is the growth curve result of the parent strain M5 and the M5ΔgntR17 deletion strain in TSB medium; B is the growth curve result of the parent strain M5 and the M5ΔgntR17 deletion strain in MM basal medium; Statistical analysis: "ns" indicates that the data have no significant difference; "***" indicates that the p value is ≤ 0.001, and the data have significant differences;

[0028] Figure 6 The results of the tolerance test of Experimental Example 1; A represents the sensitivity of the parent strain M5 and the M5ΔgntR17 deletion strain to H2O2; B represents the tolerance of the parent strain M5 and the M5ΔgntR17 deletion strain to polymyxin B; C represents the tolerance of the parent strain M5 and the M5ΔgntR17 deletion strain to inactivated sheep serum and non-inactivated sheep serum; Statistical analysis: "ns" indicates that the data have no significant difference; "**" indicates that the p value is ≤ 0.01, and "***" indicates that the p value is ≤ 0.001 and the data are significantly different;

[0029] Figure 7 Figure 2 shows the results of Brucella adhesion and invasion of cells. Figure A shows the adhesion and invasion of RAW264.7 cells by the parent strain M5 and the M5ΔgntR17 deletion strain. Figure B shows the adhesion and invasion of HeLa cells by the parent strain M5 and the M5ΔgntR17 deletion strain. Statistical analysis: "***" indicates that the p value is ≤ 0.001, indicating that the data are significantly different.

[0030] Figure 8 Survival test of the parental strain M5 and the M5ΔgntR17 deletion strain in RAW264.7 cells and HeLa cells in Experimental Example 2; Statistical analysis: "***" indicates p value ≤ 0.001, indicating significant differences in the data;

[0031] Figure 9 For Experimental Example 2, the pathogenicity of the parental strain M5 and the M5ΔgntR17 deletion strain was evaluated in a mouse infection experiment. Figure A shows the spleen bacterial load of mice infected with the parental strain M5 and the M5ΔgntR17 deletion strain at 1, 2, and 4 weeks; and the spleen weight of mice infected with the M5 and M5ΔgntR17 deletion strains at 1, 2, and 4 weeks. Statistical analysis: "***" indicates a p value ≤ 0.001, indicating a significant difference in the data.

[0032] Figure 10 These are the results of the immune protection test of M5ΔgntR17 as a vaccine in Experimental Example 2; Figure A shows the spleen bacterial load in mice 30 days after immunization with the deletion strain M5ΔgntR17 and the vaccine strain M5-90Δ26, and 2 weeks after M5 challenge; Figure B shows the spleen weight in mice 30 days after immunization with the deletion strain M5ΔgntR17 and the vaccine strain M5-90Δ26, and 2 weeks after M5 challenge; Statistical analysis: "***" indicates that the p value is ≤ 0.001, and the data are significantly different;

[0033] Figure 11 These are the results of histopathological changes in the liver of mice 30 days after immunization with the deletion strain M5ΔgntR17 and the vaccine strain M5-90Δ26 in Experimental Example 2, and 2 weeks after M5 challenge; the arrows point to the liver granulomas formed by Brucella infection.

[0034] Preservation Instructions

[0035] M5ΔgntR17 strain, this strain is deposited in the General Microbiology Center of China Culture Collection Administration, classification name: Brucella melitensis, address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing; preservation date: July 4, 2024, preservation number: CGMCCNO.46061. DETAILED DESCRIPTION

[0036] The following are detailed descriptions of the embodiments of the present invention. The embodiments are intended to explain the present invention and are not to be construed as limiting the present invention. Where specific techniques or conditions are not specified in the embodiments, the techniques or conditions described in the literature within the art or the product specifications are used. Reagents or instruments used without manufacturer's indication are commercially available conventional products.

[0037] The present invention constructs the M5ΔgntR17 strain by knocking out the gntR17 gene. Compared with the original Brucella M5 strain, the M5ΔgntR17 strain has weakened virulence and high safety. After deletion, the survival ability of Brucella in cells and mice can be significantly reduced. It has similar immune protection as the M5-90Δ26 vaccine and can be used as a candidate attenuated live vaccine strain for preventing animal brucellosis.

[0038] Example 1

[0039] In Example 1 of the present invention, the gntR17 gene deletion strain M5ΔgntR17 was constructed, and the specific method is as follows:

[0040] (1) Primer design:

[0041] The complete genome sequence of Brucella M28 (from NCBI GenBank, sequence numbers: NC_017244.1, NC_017245.1) was used as a template to design the required primers. The primer sequences are as follows:

[0042] Primer pair for amplifying the upstream homology arm fragment GntR17-U of the gntR17 gene:

[0043] GntR17-UF (SEQ ID NO. 1):

[0044] GGTACCCGGGGATCCCAGAGGATAACATGGCCGTC;

[0045] GntR17-UR (SEQ ID NO. 2):

[0046] GAGGCGGCGCATTTCGGTTTTATAGATAATGTTCT;

[0047] Primer pair for amplifying the downstream homology arm fragment GntR17-D of the gntR17 gene:

[0048] GntR17-DF (SEQ ID NO. 3):

[0049] ATTATCTATAAAACCGAAATGCGCCGCCTCGCCTT;

[0050] GntR17-DR (SEQ ID NO. 4):

[0051] TGCCTGCAGGTCGACGGCTTCACGCCTTGCCGTCG;

[0052] Internal identification primers:

[0053] InGntR17-F (SEQ ID NO.5): GTATCATTGCGGGCGAGATC;

[0054] InGntR17-R (SEQ ID NO. 6): GGTGAGAATGAGACGGTGGA;

[0055] Outer identification primers:

[0056] OutGntR17-F (SEQ ID NO.7): TGAATGGAAACAGGCCGGCA;

[0057] OutGntR17-R (SEQ ID NO. 8): TGCAAGGCGCATTGAAGCTG.

[0058] (2) Amplification and fusion of target genes:

[0059] Using the Brucella melitensis M5 genome as a template, the upstream homology arm fragment GntR17-U and the downstream homology arm fragment GntR17-D of the gntR17 gene were PCR amplified using the GntR17-UF / UR and GntR17-DF / DR primer pairs, respectively. The PCR amplification system was 50 μL, including 1 μL DNA template (100 ng / μL), 2 μL each of the upstream primer (10 pmol / μL) and the downstream primer (10 pmol / μL), 25 μL of 2× PrimeSTAR Max Premix (Takara), and deionized water to make up to 50 μL; the PCR reaction conditions were 98°C pre-denaturation for 2 minutes, 98°C for 10 seconds, 55°C for 15 seconds, and 72°C for 30 seconds, for 35 cycles, and finally extension at 72°C for 10 minutes. The PCR products were subjected to 1% agarose gel electrophoresis, and the results were as follows: Figure 1 As shown. Figure 1 It can be seen that the amplified GntR17-U and GntR17-D fragments are approximately 700 bp in size, which is consistent with the expected results.

[0060] Then, the target gene fragment was recovered by Tiangen agarose gel recovery kit, and the gel-recovered GntR17-U and GntR17-D were used as templates and GntR17-UF / DR as primers. Overlap-PCR was performed to fuse the upstream and downstream homology arm fragments. In a 50 μL PCR amplification reaction system, 1 μL of gel-recovered GntR17-U (10-20 ng / μL) and GntR17-D (10-20 ng / μL) were added, 2 μL of upstream primer GntR17-UF (10 pmol / μL) and downstream primer GntR17-DR (10 pmol / μL) were added, and 25 μL of 2× PrimeSTAR MaxPremix (Takara Company) was added and deionized to 50 μL. The PCR reaction conditions were 98°C pre-denaturation for 2 min, 98°C for 10 sec, 55°C for 15 sec, and 72°C for 1 min, for 35 cycles, and finally extension at 72°C for 10 min. The PCR products were electrophoresed on 1% agarose gel. Figure 1 As shown, the upstream and downstream fusion fragment GntR17-UD is approximately 1400 bp, which is consistent with the expected size.

[0061] (3) Construction of suicide plasmid:

[0062] The fusion fragment GntR17-UD was ligated with the linearized pKB plasmid using the Novagen homologous recombination kit. The ligation product was transformed into competent Escherichia coli DH5a cells and screened on LB plates containing 50 μg / mL kanamycin. Single colonies with kanamycin resistance were selected and inoculated into LB liquid medium containing kanamycin for culture. Subsequently, bacterial culture PCR was performed using universal primers M13F(-47) / R(-48). The PCR reaction system was 20 μL, including 1 μL of culture medium, 1 μL of upstream and downstream primers, 10 μL of 2× Taq Master Mix (Novagen), and 7 μL of deionized water. The PCR reaction conditions were 95°C denaturation for 2 min, 95°C for 15 sec, 60°C for 15 sec, and 72°C for 1 min, for 35 cycles, and a final extension at 72°C for 10 min.

[0063] Figure 2 PCR identification results showed that the target fragment was approximately 1400 bp in size, consistent with the expected result. The correctly identified recombinant bacteria were amplified in LB culture, and the suicide plasmid was extracted using the Tiangen Mini-Extraction Kit and named pKB-ΔgntR17. The correctly sequenced plasmid was stored for future use.

[0064] (4) Construction of gene-deleted strains:

[0065] Brucella melitensis M5 (purchased from China Veterinary Microbial Culture Collection Center, culture collection number: CVCC18) was cultured in TSB until the early logarithmic growth phase (OD 600 After ice bath for 15 min, centrifuge at 8000 rpm for 5 min, collect the bacterial pellet, wash the bacterial cells twice with pre-cooled sterile deionized water, add pre-cooled 10% glycerol water to resuspend the bacterial pellet, and obtain Brucella electrotransformation competent cells. Add 2 μg of pKB-ΔgntR17 plasmid to 90 μL Brucella competent cells, incubate on ice for 10 minutes, add the mixture to an electroporation cup, electroporate the plasmid into Brucella competent cells at 2.4 kV and 400 Ω, immediately add 900 μL of preheated TSB, shake and culture at 200 rpm for 6-8 hours, spread the entire bacterial solution on a TSA plate containing kanamycin, and culture at 37°C and 5% CO2 for 3-5 days. Pick a single clone of bacteria, inoculate it in TSB and shake and culture at 37°C for 2-3 days. Spread the bacterial solution on a TSA plate containing 5% sucrose for the second round of screening. Use InGntR17-F / R and OutGntR17-F / R as the inner and outer identification primers, respectively, to perform PCR identification of the deletion strain. The PCR reaction system and reaction conditions are the same as those described in step (3). The schematic diagram of PCR identification is shown in the figure below. Figure 3 shown.

[0066] Depend on Figure 3 It can be seen that the fragment size of the parental strain identified by PCR using the inner primers InGntR17-F / R is 356bp, and the deletion strain should not have this band; the band size of the parental strain identified by PCR using the outer primers OutGntR17-F / R is 1102bp, and the deletion strain has a band size of 409bp due to the deletion of 693bp.

[0067] Figure 4 PCR identification results showed that the parental strain M5 had a band size of approximately 350 bp using the inner primers, consistent with the expected size. No significant band amplification was observed in the deletion strain M5ΔgntR17, also consistent with expectations. PCR identification using the outer primers revealed a band size of approximately 1100 bp in the parental strain M5, also consistent with the expected result. The deletion strain M5ΔgntR17 had a band size of approximately 400 bp, also consistent with the expected deletion strain. These results indicate that the M5ΔgntR17 strain was successfully constructed.

[0068] Test Example 1

[0069] Test Example 1 of the present invention verified the basic phenotypes of the Brucella M5ΔgntR17 strain and the Brucella M5 parent strain in Example 1, and the specific method is as follows:

[0070] (1) Growth curve determination:

[0071] Brucella M5 parent strain and M5ΔgntR17 deletion strain were cultured in vitro to the logarithmic growth phase and the OD 600 The bacterial solution was inoculated into TSB and MM at a ratio of 1:10, and cultured at 37°C and 220 rpm. 100 μL of bacterial solution was taken every 6 h to measure the OD 600 The bacterial growth curve is drawn according to the value. The results are shown in Figure 5 .

[0072] like Figure 5 As shown in the results, in TSB medium, the growth rate of M5ΔgntR17 was consistent with that of the parent strain, indicating that the deletion of the gntR17 gene did not affect the growth ability of Brucella in TSB. In MM basal medium, the growth ability of M5ΔgntR17 was significantly weaker than that of the parent strain M5, indicating that the deletion of the gntR17 gene affected the growth of Brucella in low-nutrient medium.

[0073] (2) Tolerance test

[0074] Brucella M5 parent strain and M5ΔgntR17 deletion strain were cultured in vitro to the logarithmic growth phase, and the bacterial solution was diluted to 5×10 5 CFU / mL, the obtained bacterial solution was subjected to the following experiments:

[0075] A. Hydrogen peroxide tolerance test: Use sterile PBS to dilute H2O2 to a final concentration of 2mM and 1mM, take 50μL of each and put it in an EP tube, then add 50μL of the diluted bacterial solution to the EP tube, and set up a negative control group, take 50μL of PBS solution in an EP tube and add 50μL of the diluted bacterial solution to the EP tube, blow the mixture to mix, and then culture it at 37°C and 220rpm for 1h. After the incubation, add 900μL of sterile PBS and mix well, then dilute it 10 times, and take 100μL of the suspension to coat the TSA plate. Culture at 37°C for 3-5 days, count the bacterial colonies, and calculate the bacterial survival rate. Three repeated experiments were set up for each group of experiments for each strain. The results are as follows Figure 6 shown.

[0076] B. Brucella resistance to positive bactericidal peptides test: prepare polymyxin B solutions with concentrations of 2 mg / mL and 1 mg / mL respectively, take 50 μL of each in an EP tube, then add 50 μL of the diluted bacterial solution to the EP tube, set up a negative control group, take 50 μL of PBS solution in an EP tube and add 50 μL of the diluted bacterial solution to the EP tube, blow the mixture to mix, and place it at 37°C and 220 rpm for 1 hour. After the incubation, add 900 μL of sterile PBS and mix, then dilute it 10 times, and take 100 μL of the suspension to coat the TSA plate. Culture at 37°C for 3 to 5 days, count the bacterial colonies, and calculate the bacterial survival rate. Three repeated tests were set up for each group of tests for each strain, and the results are as follows Figure 6 shown.

[0077] C. Anti-bacterial ability test of natural serum of adult sheep: using sheep serum inactivated at 56℃ for 30min as control, the bactericidal ability of M5ΔgntR17 strain against non-inactivated sheep serum was studied. 950μL of each sheep serum was taken in a 2mL EP tube, 50μL of the diluted bacterial solution was added to each EP tube and mixed by pipetting. Then a control group was set up, i.e. 950μL of PBS was taken in a 2mL EP tube and 50μL of the diluted bacterial solution was added thereto. Three replicates were made for each strain, and then placed in a 37℃ incubator for 1.5h. The bacterial solution after standing was diluted 10 times, and 100μL of the diluted bacterial solution was taken for hanging plate. Cultured in a 37℃ incubator for 3-4d, the monoclonal colonies on the plate were counted, and the survival rate of Brucella was calculated with the PBS group as the control. The results are as follows: Figure 6 shown.

[0078] (Bacterial survival rate = bacterial CFU of the treatment group / bacterial CFU of the PBS control group × 100%).

[0079] Figure 6The results showed that the M5ΔgntR17 strain had significantly lower tolerance to hydrogen peroxide solutions at final concentrations of 0.5mM and 1.0mM than the parent strain M5, indicating that the deletion of gntR17 weakens Brucella's ability to resist oxidative stress. Furthermore, the M5ΔgntR17 strain also had significantly lower tolerance to polymyxin B solutions at final concentrations of 0.5mg / mL and 1.0mg / mL than the parent strain M5, indicating that the deletion of gntR17 weakens Brucella's ability to resist killing by positive bactericidal peptides. Furthermore, the survival rate of the M5ΔgntR17 strain in adult sheep serum was significantly lower than that of the parent strain M5, while in non-inactivated adult sheep serum, the survival rate of the M5ΔgntR17 strain was similar to that of the parent strain M5, indicating that the deletion of the gntR17 gene weakens Brucella's resistance to killing by non-immune sheep serum.

[0080] Test Example 2

[0081] Test Example 2 of the present invention detected the virulence and immune protection evaluation of Brucella M5ΔgntR17 strain, and the specific steps were as follows:

[0082] (1) Brucella M5ΔgntR17 strain adhesion, invasion, and intracellular survival assay

[0083] A. Brucella M5ΔgntR17 strain adhesion and invasion cell assay:

[0084] Brucella M5 and M5ΔgntR17 strains were cultured in TSB until the logarithmic growth phase, and the bacterial concentration was adjusted to OD 600 Value = 1.0.

[0085] One day in advance, mouse macrophages RAW264.7 or HeLa cells were seeded into 24-well cell culture plates and cultured for 20-24 hours until the cells reached a monolayer. Wash the cells twice with DMEM and inoculate them at a bacteria / cell ratio of 100:1 for RAW264.7 cells and 500:1 for HeLa cells, with triplicate wells set up for each group. After inoculation, the cell plates were centrifuged at 400 × g for 5 minutes at 25°C. After centrifugation, the cell plates were incubated at 37°C in a 5% CO2 incubator for 1 hour, which was considered infection time 0. After the cells are infected, they are washed three times with PBS, 200 μL of 0.25% Triton-X 100 solution is added to each well to lyse the cells, 100 μL of cell lysate is diluted 10-fold and then plated, cultured in a 37°C, 5% CO2 incubator for 3-4 days, the number of monoclonal colonies is counted and the original CFU of each well is calculated, which is the amount of adhered bacteria at this time; after the cells are infected, they are washed three times with PBS, DMEM containing 100 μg / mL gentamicin is added and incubated for 1 hour to kill extracellular bacteria. Subsequently, the cells are washed three times with PBS to remove extracellular bacteria, 200 μL of 0.25% Triton-X 100 solution is added to each well to lyse the cells, 100 μL of cell lysate is diluted 10-fold and then plated, cultured in a 37°C, 5% CO2 incubator for 3-4 days, the number of monoclonal colonies is counted and the original CFU of each well is calculated, which is the amount of invading bacteria at this time. The results are as follows: Figure 7 shown.

[0086] Figure 7 The results showed that in the RAW264.7 cell infection group, the ability of the M5ΔgntR17 strain to adhere to RAW264.7 cells was similar to that of the parent strain M5, but its ability to invade RAW264.7 cells was significantly improved; in the HeLa cell infection group, the ability of the M5ΔgntR17 strain to adhere to and invade HeLa cells was significantly improved. This result may be related to the fact that the deletion of the Brucella gntR17 gene affects the bacterial outer membrane structure.

[0087] B. Intracellular survival assay:

[0088] Brucella M5 and M5ΔgntR17 strains were cultured in TSB until the logarithmic growth phase, and the bacterial concentration was adjusted to OD 600Value = 1.0. Mouse macrophages RAW264.7 or HeLa cells were inoculated into 24-well cell culture plates one day in advance and cultured for 20-24 hours until the cells grew into a monolayer. The infection dose and infection method were the same as those in the A cell adhesion and invasion test. After the cells completed the infection process, DMEM containing 100 μg / mL gentamicin was used to kill extracellular bacteria. The cells were washed 3 times with PBS. After removing the extracellular bacteria, the cells were replaced with DMEM solution containing 50 μg / mL gentamicin and 1% FBS to maintain the cells. 1 hour, 8 hours, 24 hours and 48 hours after infection, the cells were washed 3 times with PBS. 200 μL of 0.25% Triton-X100 solution was added to each well to lyse the cells. 100 μL of cell lysate was diluted 10-fold and then plated. The cells were cultured in a 37°C, 5% CO2 incubator for 3-4 days. The CFU were counted and the original CFU of each well was calculated. The intracellular survival curve of Brucella was drawn. The results are shown in the figure. Figure 8 shown.

[0089] Figure 8 The results showed that the M5ΔgntR17 deletion strain exhibited an increase in intracellular bacterial load in both RAW264.7 and HeLa cells in the early stages of infection compared to the parental strain M5, and its intracellular survival ability was significantly weakened as the infection time prolonged. These results suggest that the deletion of the gntR17 gene impairs the ability of Brucella to survive intracellularly.

[0090] (2) Pathogenicity test in mice:

[0091] Brucella M5 and M5ΔgntR17 strains were cultured in TSB until the logarithmic growth phase, and the bacterial concentration was adjusted to OD 600 Value = 1.0 (at this time, the bacterial concentration is about 5×10 9 CFU / mL), and the bacterial solution was diluted with PBS to about 1×10 7 CFU / mL.

[0092] Thirty female BALB / c mice aged 6-8 weeks were divided into M5 and M5ΔgntR17 inoculation groups, with 15 mice in each group. Each mouse was intraperitoneally injected with 0.2 mL of bacterial solution (approximately 1×10 6 CFU / mouse). At the 1st, 2nd, and 4th week after infection, 5 mice from each group were quickly killed by cervical dislocation. The spleens were removed, the degree of spleen swelling was observed, and the spleen weight was weighed. 3 mL of 0.25% Triton-X100 PBS solution was added to the spleen for tissue grinding. After ten-fold dilution, 100 μL was spread on a TSA plate. After monoclonal colonies appeared, the CFU was calculated, the original bacterial load in each spleen was estimated, and a bar graph was drawn. The bacterial load and spleen enlargement of mice inoculated with the M5 and M5ΔgntR17 strains were statistically analyzed to evaluate the residual virulence of the bacteria. The results are shown in Figure 2. Figure 9 shown.

[0093] Figure 9 The results showed that one week after bacterial inoculation, the bacterial load in the spleens of mice infected with M5ΔgntR17 was significantly reduced compared with the M5 parent strain, while the spleen weight of mice infected with M5ΔgntR17 was not significantly different from that of the M5 parent strain. Two weeks after bacterial inoculation, the bacterial load and spleen weight of mice infected with M5ΔgntR17 were both significantly reduced compared with those of the M5 parent strain. Four weeks after bacterial inoculation, the bacterial load in the spleens of mice infected with M5ΔgntR17 was significantly reduced compared with those of the M5 parent strain, while the spleen weight of mice infected with M5ΔgntR17 was not significantly different from that of the M5 parent strain. These experimental results indicate that gntR17 gene deletion significantly reduces the pathogenicity of Brucella M5 strain in mice.

[0094] (3) Immunoprotective test: Brucella M5ΔgntR17 and vaccine strain M5-90Δ26 were cultured in vitro by TSB until the logarithmic growth phase, and the bacterial concentration was adjusted to OD 600 Value = 1.0 (at this time, the bacterial concentration is about 5×10 9 CFU / mL), and the bacterial solution was diluted with PBS to about 1×10 6 CFU / mL. Thirty female BALB / c mice aged 6-8 weeks were divided into PBS group, M5ΔgntR17 group and M5-90Δ26 group, with 5 mice in each group. Each mouse was intraperitoneally injected with 0.2 mL of bacterial solution (approximately 1×10 6 CFU / mouse), the mice in the PBS group were intraperitoneally injected with 0.2 mL PBS, and 30 days after vaccination, all mice were treated with 5×10 4 The mice were challenged with the M5 strain at a dose of 100 CFU / mouse. Two weeks after challenge, all mice were quickly killed by cervical dislocation. The spleens of the mice were removed, the degree of spleen swelling was observed, and the spleen weight was weighed. 3 mL of 0.25% Triton-X100 PBS solution was added to the spleen for tissue grinding. After ten-fold dilution, 100 μL was spread on a TSA plate. After monoclonal colonies appeared, the CFU were counted and calculated, and the bacterial load per gram of spleen was estimated. The results are shown in Figure 2. Figure 10 shown.

[0095] Figure 10The results showed that 2 weeks after M5 infection, the Brucella load in the spleens of mice immunized with M5ΔgntR17 and M5-90Δ26 was significantly decreased compared with that of the PBS vaccination group, and the difference was significant; there was no significant difference in the Brucella load in the spleens of mice immunized with M5ΔgntR17 and M5-90Δ26; the spleen weight results showed that compared with the spleen weight of mice in the PBS group, the spleen weight of mice immunized with M5ΔgntR17 and M5-90Δ26 was significantly decreased, and the difference was significant; there was no significant difference in the spleen weight of mice immunized with M5ΔgntR17 and M5-90Δ26.

[0096] To further evaluate the immune protection of the M5ΔgntR17 and M5-90Δ26 vaccine strains, the livers of mice challenged with M5 were removed and fixed in 4% paraformaldehyde for 24-48 hours. The livers were then sent to Wuhan Seville for tissue section preparation and HE staining to observe the pathological changes in the liver. The results are as follows: Figure 11 shown.

[0097] Figure 11 The results showed that compared with the PBS-vaccinated group, mice vaccinated with the M5ΔgntR17 and M5-90Δ26 vaccine strains significantly reduced the formation of Brucella-induced liver granulomas. There was almost no difference between the M5ΔgntR17 and M5-90Δ26 groups, with scattered small granulomas formed in some locations with M5-90Δ26. These results indicate that M5ΔgntR17 is a good vaccine candidate, with similar immune protection efficacy to the commercial vaccine M5-90Δ26, with no significant difference.

[0098] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A gntR17 Gene deletion strain M5∆ gntR17 strain, characterized in that The M5∆ gntR17 Brucella melitensis M5 strain gntR17 The M5∆ gntR17 The strain was deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms, with the address being No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; the deposit date is July 4, 2024, and the deposit number is CGMCC NO. 46061.

2. An M5∆ according to claim 1 gntR17 The method for constructing a strain is characterized in that The steps include: (1) PCR amplification gntR17 After amplification, the upstream homology arm fragment and the downstream homology arm fragment of the gene are fused to obtain a fusion fragment; (2) The fusion fragment is connected with the linearized suicide plasmid pKB by homologous recombination to obtain a connection product, and the suicide plasmid pKB-Δ is screened. gntR17 ; (3) The suicide plasmid was electroporated into Brucella melitensis competent cells, screened, and extracted to obtain M5Δ gntR17 strain; In step (1), amplification gntR17 The sequences of the primers used for the upstream homology arm fragment of the gene are: GntR17-UF shown in SEQ ID NO: 1 and GntR17-UR shown in SEQ ID NO: 2; gntR17 The sequences of the primer set used for the downstream homology arm fragment of the gene are: GntR17-DF shown in SEQ ID NO: 3 and GntR17-DR shown in SEQ ID NO: 4; the primer set used for the fusion is GntR17-UF and GntR17-DR; The Brucella melitensis competent cells described in step (3) are prepared from Brucella melitensis M5 with a strain collection number of CVCC18.

3. M5∆ according to claim 2 gntR17 The method for constructing a strain is characterized in that In step (2), the screening method is as follows: the ligation product of step (2) is transformed into Escherichia coli DH5a competent cells, kanamycin-resistant strains are screened in LB plates and liquid culture medium containing kanamycin, and then PCR identification of the bacterial liquid is performed, and the pKB-ΔgntR17 plasmid is extracted.

4. M5∆ according to claim 2 gntR17 The method for constructing a strain is characterized in that In step (3), the screening method is as follows: the transformed Brucella melitensis competent cells are inoculated on a TSA plate containing kanamycin, a single clone of bacteria is picked and cultured, and then negatively screened on a TSA plate containing sucrose, a single clone of bacteria is picked, and after further culture, the inner identification primer and the outer identification primer are used to PCR identify the deletion strain M5Δ gntR17 strain.

5. M5∆ according to claim 4 gntR17 The method for constructing a strain is characterized in that The sequences of the inner identification primers are: InGntR17-F shown in SEQ ID NO.5 and InGntR17-R shown in SEQ ID NO.6; the sequences of the outer identification primers are: OutGntR17-F shown in SEQ ID NO.7 and OutGntR17-R shown in SEQ ID NO.

8.

6. Use of the gntR17 gene deleted strain M5∆gntR17 according to claim 1 in the preparation of an attenuated live Brucella vaccine.

Images