Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

36 results about "Brucellosis" patented technology

A bacterial infection that spreads from infected animals or unpasteurized animal products to human.

Vaccine for brucellosis

PCT designated stageWO2026024796A2Bacterial antigen ingredientsDepsipeptidesBrucella antigenPharmaceutical medicine
Provided herein are methods and compositions for the detection of Brucella antigen, and more particularly, to a vaccine or immunogenic composition comprising: Brucella strain from which at least a portion of the immunogenic protein DUF883 has been deleted provided in an amount sufficient to trigger an immune response against the immunogenic protein; and a pharmaceutically acceptable vaccine carrier.
Owner:TEXAS A&M UNIVERSITY

Brucella attenuated live vaccine strain M5ΔpyrE and construction method and application thereof

This invention provides a live attenuated Brucella vaccine strain M5Δ pyrE Its construction methods and applications belong to the field of biotechnology. The M5... pyrE The strain was obtained by knocking out Brucella mesenteriae strain M5. pyrE Genetically constructed and deposited at the China Center for Type Culture Collection. This invention discovers that... pyrE The gene is associated with Brucella virulence; knocking out this gene significantly weakens Brucella virulence and reduces its intracellular and mouse viability. Compared to the existing vaccine strain M5-9026, M5... pyrE The strain exhibits superior immunoprotective effects, effectively inducing humoral and Th1 cellular immune responses, and demonstrates good safety. The M5 strain constructed in this invention... pyrE This strain has promising potential as a candidate strain for a live attenuated vaccine to prevent brucellosis in animals.
Owner:SHANGHAI VETERINARY RESEARCH INSTITUTE CAAS (CHINESE ANIMAL HEALTH & EPIDEMIOLOGY CENTER SHANGHAI BRANCH)

A primer set, reagent kit, and detection method for detecting Brucella.

This invention discloses a primer set, kit, and method for detecting Brucella, belonging to the field of gene detection technology. The primer set comprises two pairs of specific RPA primers: primer pairs B1F1 (SEQ ID No. 3) and B1R1 (SEQ ID No. 6) targeting the B1 sequence, and primer pairs B2F1 (SEQ ID No. 8) and B2R1 (SEQ ID No. 11) targeting the B2 sequence. This invention also provides a kit containing this primer set and a detection method based on RPA-CRISPR-Cas12a. This application combines the high efficiency of RPA amplification with the ultra-high specificity of CRISPR-Cas12a detection, overcoming the shortcomings of traditional methods such as long processing time, low sensitivity, and susceptibility to false positives. It achieves rapid, sensitive, and specific detection of Brucella, and has significant application value in the early screening and monitoring of brucellosis.
Owner:JILIN UNIV FIRST HOSPITAL

Digital brucellosis antibody titer analysis system based on spectrophotometry

The invention relates to the technical field of antibody titer digitization analysis, in particular to a brucellosis antibody titer digitization analysis system based on a spectrophotometric method.According to the brucellosis antibody titer digitization analysis system, a full-time reaction kinetics absorbance curve is obtained through a data acquisition module; a signal decomposition module is utilized to decouple the signal into a low-frequency trend component and a high-frequency detail component; further identifying a reaction kinetics phase state through a low-frequency trend analysis module to lock an effective reaction interval and generate first-dimension analysis data, and controlling a high-frequency detail analysis module to generate second-dimension analysis data by taking the first-dimension analysis data as a time domain gating basis; finally, the comprehensive evaluation module constructs a coupling weight model based on the reaction kinetics phase state, and fuses the two-dimensional data to generate a comprehensive antibody activity evaluation value; according to the process, a self-adaptive analysis mechanism conforming to a reaction evolution rule is constructed, and accurate determination of the titer of the antibody is realized.
Owner:巴彦淖尔市动物疫病预防控制中心

Diagnostic test for brucellosis

PCT designated stageWO2026024794A1Bacterial antigen ingredientsMaterial analysisBrucella antigenDiagnostic test
Provided herein are methods, kits and systems for the detection of Brucella antigen, method for detecting brucellosis in a mammal comprising the steps of: obtaining or having obtained a biological sample suspected being infected with Brucella sp.; and detecting in the biological sample immunogenic protein DUF883 or anti-DUF883 antibodies, wherein the presence of DUF883 or anti-DUF883 antibodies are indicative that the mammal has been exposed to Brucella, e.g., to a vaccine or immunogenic composition comprising: immunogenic protein DUF883 provided in an amount sufficient to trigger an immune response against the immunogenic protein; and a pharmaceutically acceptable vaccine carrier.
Owner:TEXAS A&M UNIVERSITY

ELISA antibody detection kit for identifying brucella gene deletion live vaccine (M5-90△26 strain) and wild strain and application

The application discloses an ELISA antibody detection kit for identifying Brucella gene deletion live vaccine (M5-90△26 strain) and wild strains and application. The kit comprises enzyme-linked reaction plate 1 and enzyme-linked reaction plate 2. The enzyme-linked reaction plate 1 is coated with LPS extracted from the Brucella gene deletion live vaccine (M5-90△26 strain), and the enzyme-linked reaction plate 2 is coated with a Brucella BP26 antigen epitope polypeptide combination composed of polypeptides with amino acid sequences shown in SEQ ID NO:1-2. The application is suitable for goats and sheep inoculated with the Brucella gene deletion live vaccine (M5-90△26 strain), can effectively distinguish the antibody produced by the Brucella gene deletion live vaccine (M5-90△26 strain) and the antibody produced by wild strain infection, thereby realizing identification and detection, being favorable for prevention and control of brucellosis and optimization of a vaccination strategy, and providing technical support for healthy and sustainable development of animal husbandry.
Owner:CHINA ANIMAL HUSBANDRY IND

Lactic acid bacteria live vector vaccine for preventing and treating brucellosis and preparation method of lactic acid bacteria live vector vaccine

The invention belongs to the technical field of biological medicines, and particularly relates to a lactic acid bacteria live vector vaccine for preventing and treating brucellosis and a preparation method of the lactic acid bacteria live vector vaccine. The lactic acid bacteria live vector vaccine is obtained by transferring expression vectors for expressing Brucella omp19 protein and BvrR protein into lactic acid bacteria, and the lactic acid bacteria are lactobacillus cavings. The lactobacillus live vector vaccine for preventing and treating brucellosis is constructed by taking brucella omp19 protein and BvrR protein as immunogens and lactic acid bacteria as an antigen transfer vector, and the safety is good. After the vaccine is used for immunizing mice, the mice can obtain a higher antibody level, the duration is long, brucella infection is effectively inhibited, meanwhile, the production process of the vaccine is simplified, and the vaccine has a good application prospect.
Owner:SHANDONG PROVINCIAL CENT FOR ANIMAL DISEASE CONTROL & PREVENTION

A molecular marker and its use in identifying sheep susceptible to brucellosis

The present application relates to the field of animal breeding technology, and particularly relates to a molecular marker and application thereof in identifying sheep brucellosis susceptibility. The molecular marker comprises nucleic acid of a nucleotide sequence shown as SEQ ID NO. 1, and a polymorphism exists at the 101th position, and the polymorphism is C / G. The present application identifies a molecular marker related to sheep brucellosis susceptibility. By analyzing the genetic polymorphism of the marker, the susceptibility of sheep individuals to brucellosis can be determined. In addition, the molecular marker can also be used as an effective auxiliary selection tool, and is applied to breeding of new sheep strains with stronger brucellosis resistance, which has important application value for disease-resistant breeding of sheep.
Owner:INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES

Tibetan medicine composition for treating rheumatoid arthritis and preparation method

PendingCN121695250AAntipyreticAnalgesicsInflammatory factorsBrucellosis
The invention relates to the technical field of Tibetan medicine preparations, in particular to a Tibetan medicine composition for treating rheumatoid arthritis and a preparation method. The Tibetan medicine composition is prepared from 18 Tibetan medicines including fructus chebulae, fructus terminaliae billericae, emblic leafflower fruit and the like according to a specific weight ratio, and the monarch, minister, assistant and guide relationship is defined based on the Tibetan medicine true brucellosis theory; according to the preparation method, a low-temperature superfine grinding and step-by-step extraction process is innovatively adopted, three dosage forms of powder, a nano drug-loaded emulsion and a temperature-sensitive acupoint patch are developed, and a dual quality control system of HPLC (High Performance Liquid Chromatography) content determination and fingerprint spectrum is established. TNF-alpha and IL-6 target spots and nf-kb and PI3K-AKT inflammation pathways are synergistically regulated and controlled through multiple components, joint swelling and bone erosion are relieved, and gastrointestinal tract side effects of western medicines are avoided; the transdermal absorption efficiency is improved by a nano drug-loading technology, acupoint targeted drug delivery is realized by the temperature-sensitive patch, and verification shows that the joint swelling inhibition rate is greater than or equal to 70%, the inflammatory factor decrease amplitude is greater than or equal to 50%, and the patch is suitable for patients with mild, moderate and severe rheumatoid arthritis and has a wide clinical application prospect.
Owner:Shigatse Tibetan Hospital

Use of biomarkers to discriminate between acute and chronic phases of brucellosis

ActiveCN120971742BBiological testingBiologic markerBrucellosis
The application relates to the technical field of markers, in particular to application of biomarkers for identifying acute and chronic stages of brucellosis. A series of biomarkers related to acute and chronic stages of brucellosis are screened and found, and the biomarkers are significantly different between patients with acute and chronic brucellosis. The biomarkers can be used to realize acute and chronic staging of brucellosis, and have high sensitivity and specificity and good diagnostic efficiency. The application provides a new molecular diagnostic tool for acute and chronic staging of brucellosis, solves the problems of low specificity of existing serological detection and incapability of accurately judging clinical stages, and has a wide application prospect.
Owner:ICDC CHINA CDC

Attenuated strains of Brucella brucellosis and their applications, vaccines, antigens and reagent kits

This invention relates to the field of veterinary biological products, specifically to a live attenuated strain of Brucella brucellosis RB39, its applications, vaccines, antigens, and kits. The live attenuated Brucella brucellosis RB39 of this invention can be used to prepare a highly safe vaccine that can be injected into pregnant animals and provides good immunoprotection. Furthermore, this vaccine is suitable for immunization of multiple animal species. In addition, based on the live attenuated Brucella brucellosis RB39 of this invention, an antigen can be prepared to identify Brucella brucellosis antibodies, effectively distinguishing between vaccine immunization and natural infection, providing a scientific basis for brucellosis prevention and control.
Owner:INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES

Brucella specific amplification primer pair, visual detection product and detection method

The invention discloses a Brucella specific amplification primer pair, a visual detection product and a detection method, and relates to the technical field of biological detection. The Brucella specific amplification primer pair comprises an upstream primer of which the nucleotide sequence is shown as SEQ ID NO.2 and a downstream primer of which the nucleotide sequence is shown as SEQ ID NO.3; iSp18 modification exists between the 18th nucleotide and the 19th nucleotide of the upstream primer; and iSp18 modification exists between the 18th nucleotide and the 19th nucleotide of the downstream primer. The Brucella specific amplification primer pair can be applied to visual detection of Brucella, has the advantages of strong specificity, high sensitivity and good accuracy, has good practical application value in the aspect of early detection of brucellosis, and can provide a quicker detection means for prevention and control of brucellosis.
Owner:HENAN AGRICULTURAL UNIVERSITY

Monoclonal antibody combination for Brucella detection and application thereof

The invention discloses a monoclonal antibody combination for Brucella detection and application thereof, and belongs to the technical field of immunodetection. The monoclonal antibody combination disclosed by the invention comprises a monoclonal antibody 15F4 and a monoclonal antibody 32H9. On the basis of the monoclonal antibody combination, a double-antibody sandwich ELISA detection method with 15F4 as a capture antibody and enzyme-labeled 32H9 as a detection antibody is established, and key parameters such as coating concentration, closing conditions, incubation and color development time and the like are optimized. The method has high specificity on brucella, and does not cross with common cross-reactive bacteria such as escherichia coli O: 157, salmonella and the like; the sensitivity is high, and the detection limit can reach 1 * 10 < 5 > CFU / mL; the repeatability is good, and the intra-batch and inter-batch variation coefficients are both smaller than 10%. The invention provides a core reagent and a reliable means for early, rapid and accurate diagnosis of brucellosis, and is suitable for on-site screening of clinical samples and animal epidemic diseases.
Owner:SHIHEZI UNIVERSITY

A Brucella-deficient strain 104MΔBioZ, its construction method, and its application

PendingCN122326494ANucleotideBrucellosis
This invention belongs to the field of microbial technology, specifically relating to a Brucella-deficient strain 104MΔBioZ, its construction method, and its applications. The Brucella-deficient strain 104MΔBioZ is formed by knocking out a gene involved in biotin synthesis in the Brucella 104M genome. BioZ The strain obtained after gene sequencing; the strain involved in biotin synthesis BioZ The nucleotide sequence of the gene is shown in SEQ ID NO:1. This invention utilizes the knockout of biotin synthesis in Brucella 104M. BioZ A mutant strain was obtained through gene synthesis. The resulting mutant strain exhibited significantly reduced virulence compared to Brucella 104M and demonstrated highly effective resistance to infection by the parent Brucella. Results showed that immunizing healthy mice with the 104MΔBioZ strain described in this invention for brucellosis prevention is safe and provides high protection. The Brucella-deficient strain 104MΔBioZ has broad application prospects in the field of brucellosis prevention and control.
Owner:LANZHOU VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES(LANZHOU BRANCH CENTER OF CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER)

Brucella recombinant multi-epitope vaccine and application thereof

The invention belongs to the technical field of biological medicines, and particularly relates to a Brucella recombinant multi-epitope vaccine and application thereof. The invention provides a recombinant multi-epitope vaccine protein of Brucella. The vaccine protein is a first vaccine variant rBMEV1 or a second vaccine variant rBMEV2. Results of embodiments prove that the vaccine provided by the invention can excite strong cross immune response aiming at main pathogenic species (such as sheep species, cattle species and pig species) of Brucella. Animal experiments prove that the antibody can induce a high-level and lasting specific antibody, can obviously activate response of CD4 + and CD8 + T cells and corresponding cell factors, and has good safety at the same time. According to the invention, the problems of narrow protection spectrum, dependence on exogenous adjuvants, single immune type and the like of the traditional brucella vaccine are solved, and a new generation of efficient, broad-spectrum and safe candidate vaccine strategy is provided for prevention and control of brucellosis.
Owner:SHANXI AGRI UNIV

A continuous vaccination device for bio-inoculation

The application discloses a continuous vaccination device for biological inoculation and relates to the technical field of vaccination. The device comprises a first sliding frame, mirror-imaged electric sliding rails arranged on the first sliding frame, electric sliding blocks arranged in the mirror-imaged electric sliding rails, a first sliding block fixed to the electric sliding block in one side of the electric sliding rail on the first sliding frame, a second sliding block fixed to the electric sliding block in the other side of the electric sliding rail on the first sliding frame, and fastening ropes fixed between the mirror-imaged first sliding blocks and the mirror-imaged second sliding blocks. The first sliding frame cooperates with the fastening ropes to adjust and fix the position of the tail of the cow according to the body shape of the inoculated cow, so that the tail of the cow is no longer fixed by other people during the whole inoculation process, the infection risk of brucellosis is cut off from the source, and the risk of infection of the inoculation personnel is reduced.
Owner:TAIZHOU FENGDA AGRI & ANIMAL HUSBANDRY TECH CO LTD +1

Primer group and kit for detecting four bacterial abortion diseases of sheep

The invention provides a primer group and a kit for detecting four bacterial abortion diseases of sheep, belongs to the technical field of biological detection, establishes a multiplex PCR (polymerase chain reaction) detection method for sheep brucellosis, sheep abortion salmonellosis, listeriosis and chlamydia disease and a kit thereof, and has the characteristics of high sensitivity, strong specificity, simplicity and convenience in operation, short time consumption and the like. The rapid differential diagnosis of four sheep bacterial abortion diseases can be realized through one-time PCR amplification, and the method has important advantages in the field of sheep disease diagnosis and identification.
Owner:CANGZHOU NORMAL UNIV +1

SgRNA combination and application thereof in preparation of PRNP gene edited sheep

The invention relates to the technical field of animal breeding, in particular to an sgRNA combination and application thereof in preparation of PRNP gene edited sheep. The sgRNA combination comprises a PRNP-sgRNA 1: CCACATAGGCAGTTGGATCC (CCACATAGGCAGTTGGATCC), and a sgRNA combination And PRNP-sgRNA9: CTGGCGGAGGATGGAACACT (cytotoxic T Growth Growth Growth Growth The application comprises the following steps: introducing the sgRNA combination and the gene editor into embryo fibroblasts of sheep to obtain gene edited positive cells; performing somatic cell nuclear transplantation by taking a gene-edited positive cell as a nuclear donor to obtain a reconstructed embryo; and transplanting the reconstructed embryo into a receptor ewe body. A group of sgRNA combinations capable of efficiently and accurately knocking out the sheep PRNP gene is obtained through research and screening, and the sgRNA combinations can be used for preparing anti-brucellosis animal varieties (the 2h brucellosis clearance rate of PBMC cells reaches 100%) and have important application value.
Owner:INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES

Mobile disinfection system for brucellosis protection

The invention discloses a mobile disinfection system for brucellosis protection, and relates to the technical field of disinfection devices, the mobile disinfection system comprises a disinfection tank body and a mobile disinfector movably arranged in the disinfection tank body, and the disinfector integrates disinfection and garbage sorting functions; a main body is a power box, a swing arm device, a storage box device, a suction bag, a suction device and other garbage treatment structures are arranged on the box, a lifting power device is arranged at the bottom, and a limiting, buffering and propelling rotating structure is arranged; the atomization disinfection module comprises a high-pressure pump and an array type atomization spray head group (comprising horizontal and vertical spray heads), and the high-pressure pump is connected with the disinfection tank. The power box integrates a motor, a main control system, a searchlighting device, a signal device, a collection box and the like, can achieve mobile disinfection, garbage absorption, sorting and storage, is adaptive to brucellosis protection scenes, and improves the comprehensiveness and convenience of disinfection protection.
Owner:伊金霍洛旗动物疫病预防控制中心

Vaccine for brucellosis

PCT designated stageWO2026024796A3Bacterial antigen ingredientsAntibacterial agentsBrucella antigenPharmaceutical medicine
Provided herein are methods and compositions for the detection of Brucella antigen, and more particularly, to a vaccine or immunogenic composition comprising: Brucella strain from which at least a portion of the immunogenic protein DUF883 has been deleted provided in an amount sufficient to trigger an immune response against the immunogenic protein; and a pharmaceutically acceptable vaccine carrier.
Owner:TEXAS A&M UNIVERSITY

Primer group for detecting Slc11a1 gene polymorphism, detection product and application thereof

The invention discloses a primer group for detecting Slc11a1 gene polymorphism, a detection product and application of the primer group and the detection product, and relates to the technical field of gene detection. The kit comprises a first upstream primer, a second upstream primer and a downstream primer, the nucleotide sequence of the first upstream primer is shown as SEQ ID NO: 7, the nucleotide sequence of the second upstream primer is shown as SEQ ID NO: 8, the nucleotide sequence of the downstream primer is shown as SEQ ID NO: 9, a blocking group is arranged at the 3'end of the downstream primer, and tetrahydrofuran is introduced between the 16th nucleotide and the 17th nucleotide at the 3 'end of the downstream primer. According to the primer group and the detection product provided by the invention, the brucellosis resistant cattle can be simply, conveniently and efficiently detected at low cost. The invention provides a powerful technical tool for large-scale, rapid and low-cost cattle herd genetic resistance screening, significantly accelerates the breeding process of brucellosis-resistant cattle species, and has huge industrialization potential.
Owner:SANGON BIOTECH (SHANGHAI) CO LTD

Arthralgia-relieving and pain-relieving prescription for improving brucellosis

The invention provides an arthralgia-relieving and pain-relieving prescription for improving brucellosis. The arthralgia-relieving and pain-relieving prescription is prepared from the following raw materials in parts by weight: 5-15 parts of radix aconiti preparata, 10-20 parts of fried peach kernels, 15-25 parts of ligusticum wallichii, 15-25 parts of radix cyathulae, 15-25 parts of cassia twigs, 15-25 parts of radix saposhnikoviae and 10-20 parts of caulis spatholobi. The arthralgia-dredging and pain-relieving prescription can be used as an acoustic conductance directional penetration preparation for improving brucellosis, is combined with a non-invasive ultrasonic conductance technology, directly introduces the medicine into a diseased region, has high safety and effectiveness, and can obviously relieve arthralgia.
Owner:HEILONGJIANG PROVINCIAL POISONING RESCUE & TREATMENT CENT (HEILONGJIANG PROVINCIAL SECOND HOSPITAL HEILONGJIANG PROVINCIAL LABOR HEALTH & OCCUPATIONAL DISEASE RES INST)

Application of TRAPPC2 gene in regulation and control of infection ability and intracellular survival of animal immune cells to Brucella

The invention belongs to the technical field of genetic engineering, and relates to application of a TRAPPC2 gene in regulation and control of infection ability and intracellular survival of animal immune cells to brucella, and the nucleotide sequence of the TRAPPC2 gene is shown as SEQ ID NO: 1. After the TRAPPC2 gene in the mononuclear macrophage is knocked out, the infection ability of the Brucella to the mononuclear macrophage can be remarkably reduced, intracellular survival of the Brucella in immune cells is remarkably inhibited, the infection rate of the Brucella is remarkably reduced, and the Brucella can be effectively prevented from being infected. It is shown that the TRAPPC2 gene is a key gene for regulating and controlling the infection ability of animal immune cells to Brucella and intracellular survival. The TRAPPC2 gene disclosed by the invention can provide a new candidate molecular material for animal disease-resistant breeding work and related drug research and development; meanwhile, a new research direction and a new technical thought are provided for clinical treatment of brucellosis in the medical field.
Owner:CHINA AGRI UNIV

Antibody detection test strip of integrating primary screening and diagnosis of bovine brucellosis

An antibody detection test strip of integrating primary screening and diagnosis of bovine brucellosis is provided. The antibody detection test strip includes a primary screening test strip and a diagnosis test strip. Each of the primary screening test strip and the diagnosis test strip is composed of a polyvinyl chloride base plate, a sample pad, a colloidal gold labeled pad, a nitrocellulose membrane and an absorbent pad. The sample pad of the primary screening test strip and the sample pad of the diagnosis test strip are connected, and a connection is formed with a sample-loading hole. When in use, a serum to be tested as a sample is dripped into the sample-loading hole, and according to results presented by the primary screening test strip and the diagnosis test strip, brucellosis negative, positive or suspicious determination for the sample can be quickly made on site.
Owner:INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES

Construction method of Brucellosis online dynamic column diagram diagnosis model based on cytokines and diagnosis model

PendingCN121439246AMedical simulationMedical data miningBrucellosisCytokine
The invention discloses a construction method of a Brucellosis online dynamic column diagram diagnosis model based on cell factors and the diagnosis model, and relates to the technical field of Brucellosis diagnos.The construction method of the Brucellosis online dynamic column diagram diagnosis model based on the cell factors comprises the following steps that S1, clinical data are collected, detecting the level of cell factors in serum; s2, drawing a working characteristic curve of the subject, and identifying cell factors with diagnostic value; s3, screening out cell factors finally incorporated into the diagnosis model based on LASSO regression analysis, constructing the diagnosis model through multi-factor Logistic regression, and establishing an online dynamic column diagram; s4, analyzing and evaluating the calibration degree and clinical applicability of the diagnosis model; cytokine variables with important value for diagnosis are effectively screened out through the diagnosis model, and the stability and generalizability of the model are improved; the diagnosis model has high diagnosis performance and good clinical application prospects.
Owner:PEOPLES HOSPITAL OF XINJIANG UYGUR AUTONOMOUS REGION

A fever-reducing traditional Chinese medicine decoction for treating acute phase fever patients with brucellosis

The application discloses a fever-reducing traditional Chinese medicine decoction for treating acute fever of brucellosis, and relates to the technical field of traditional Chinese medicine.The decoction is composed of 15 kinds of traditional Chinese medicine decoction pieces, i.e., radix bupleuri, radix scrophulariae, radix paeoniae rubra, radix paeoniae alba, radix scrophulariae, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae alba, radix paeoniae
Owner:SIXTH PEOPLES HOSPITAL OF XINJIANG UYGUR AUTONOMOUS REGION

Brucellosis DIVA diagnosis antigen BruAb20955 and application thereof

The invention relates to the technical field of animal infectious disease diagnosis and vaccines, in particular to a Brucella disease DIVA diagnosis antigen BruAb20955, and the amino acid sequence of the BruAb20955 protein is as shown in SEQ ID NO: 2. A nucleotide sequence for coding the brucellosis DIVA diagnosis antigen is characterized in that the nucleotide sequence is as shown in SEQ ID NO: 1. A primer pair for amplifying the nucleotide sequence is characterized in that an upstream primer sequence is as shown in SEQ ID NO: 3, and a downstream primer sequence is as shown in SEQ ID NO: 4. The invention further discloses application of the nucleotide sequence, the amino acid sequence and the BruAb20955 protein in preparation of a DIVA diagnostic reagent for brucellosis. The invention further discloses application of the nucleotide sequence, the amino acid sequence and the BruAb20955 protein in preparation of brucellosis prevention and control vaccines. According to the invention, a new molecular marker which can be used for differential diagnosis of Brucella wild virus infection and vaccine immunity is screened and identified at home and abroad for the first time, and meanwhile, an indirect ELISA method which can be used for experimental differential diagnosis is established by utilizing the new marker molecule. The judgment critical value of the method is 1.908.
Owner:LANZHOU VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES(LANZHOU BRANCH CENTER OF CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER)

A brucellosis rose bengal plate agglutination test plate

ActiveCN224471687UVertical planeBrucellosis
This invention provides a brucellosis benzalkonium chloride agglutination test plate, comprising a plate body with detection slots for holding the test solution. Each detection slot includes a bottom surface, an inclined surface, and an arc surface. The angle between the inclined surface and the vertical plane is 23.5°, and the angle between the bottom surface and the inclined surface is 113.5°. A groove is provided at the bottom of the plate body. There are twenty-four detection slots. The plate body is made of highly transparent PMMA material. This invention can replace traditional glass slides in the benzalkonium chloride agglutination test. It is safe, efficient, and easy to use, with high transparency. The liquid spreads evenly within the wells without external force, meeting national standards and contributing to clear test results with distinct positive and negative results. It is suitable for manual testing and compatible with various instruments and equipment. The PMMA raw material has sufficient stability and corrosion resistance, ensuring that the reagents and samples are not affected by the material properties, thus preventing the results from being affected.
Owner:NANJING YINGJIE BIOTECHNOLOGY CO LTD

Antibody detection test strip of integrating primary screening and diagnosis of sheep brucellosis

An antibody detection test strip of integrating primary screening and diagnosis of sheep brucellosis includes: a test strip 1 of primary screening and a test strip 2 of diagnosis, each including a PVC base plate, a sample pad, a colloidal gold labeled pad, a nitrocellulose membrane and an absorbent pad. For the test strip 1, the colloidal gold labeled pad is coated with colloidal gold labeled Brucella LPS and mouse anti Flag monoclonal antibody, and test and control lines are respectively coated with a Brucella monoclonal antibody M4 and a sheep anti-mouse IgG antibody. For the test strip 2, the colloidal gold labeled pad, and test and control lines are respectively coated with a colloidal gold labeled Brucella LPS, a rabbit anti-sheep IgG antibody and a Brucella monoclonal antibody M4. When in use, a serum is dripped into its sample-loading hole, and brucellosis determination can be made on site according to results presented by the test strips 1 and 2.
Owner:INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES

Vaccination identification button for electronic identification button tags for identifying cattle vaccinated against brucellosis, and related kits and methods.

We provide EID button tags for tagging and identifying cattle that have been vaccinated against brucellosis. [Solution] The EID button tag is provided, comprising a shell having a central opening, a transponder disposed within the shell, a male punch having a disc-shaped punch body and a stem extending from the punch body toward the end, the stem having a head configured to be irreversibly inserted into the central opening, a mounting opening formed through the punch body, and a mounting channel extending coaxially along the stem toward the end from the mounting opening, and a vaccination identification button having a disc-shaped visual identifier and a mounting stem extending from the visual identifier toward the end, the mounting stem configured to be irreversibly inserted into the mounting channel.
Owner:ALLFLEX USA LLC