Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

143 results about "Brucellosis" patented technology

A bacterial infection that spreads from infected animals or unpasteurized animal products to human.

Indirect enzyme linked immunosorbent assay (ELISA) of deer's brucellosis

Indirect ELISA of deer's brucellosis belongs to the veterinary field and is used for diagnosing deer's brucellosis to improve the diagnosis level of the prior art. Biomaterials used in the assay of the invention comprise pig brucella vaccine 2 (S2) as an antigen, an enzyme labeled antibody rabbit anti-deer IgG-HRP, a standard positive serum, a standard negative serum and a serum to be assayed; and the assay comprises the following steps: coating the antigen, washing, adding the serum, adding the rabbit anti-deer IgG-HRP, adding a substrate liquid, terminating a reaction, testing by an enzyme-linked detector, adjusting to zero at 490nm, testing the OD value of each hole, and determining the result is positive when the OD value is equal to or greater than 0.32. According to the invention, the S2 is used as the antigen, the rabbit anti-deer IgG-HRP is used as the enzyme labeled antibody, and the indirect ELISA is used to diagnose the deer's brucellosis, so compared with previous diagnosis methods, the indirect ELISA of the invention has the advantages of good specificity, sensitivity and repeatability, and accurate diagnosis.
Owner:JILIN AGRICULTURAL UNIV

Human and animal brucella antibody immunochromatography test paper and preparation method thereof

The invention relates to the field of zoonosis immune diagnosis and discloses a brucellosis antibody detection immunochromatography test strip based on colloidal gold as a marking material and a preparation method of the test strip. In a quick brucellosis antibody detection technology, the 40-nm colloidal gold labeled with staphylococcus aureus protein A (SPA) is sprayed on glass fibers to form a gold labeled pad. Genes OMP31 and BP26 are cloned from a brucella genome, form prokaryotic expression recombinant plasmids and are transformed in escherichia coli to express proteins omp31 and bp26, the two proteins as coating antigens are respectively coated on a nitrocellulose membrane to serve as detection lines, and the detection lines, the gold labeled pad, a specially treated sample loading pad and water absorption paper are assembled into an immunochromatography detection device. The test strip has the characteristics of strong specificity, high sensitivity, convenience, simplicity, economy and the like, can be applied to typing detection of brucellosis antibodies of sheep and cattle, and has very important meaning and practical application value for brucellosis monitoring and prevalence control.
Owner:SHIHEZI UNIVERSITY

Immunogenic compositions including rough phenotype Brucella host strains and complementation DNA fragments

Live attenuated vaccines against brucellosis and infection by other diseases are described. It has been discovered that trans complementation of the Brucella wboA gene can be used to maintain an expression vector in an attenuated Brucella host cell in a vaccinee. Further, heterologous antigens can be expressed using this Brucella platform, thus effecting a multivalent vaccine against Brucella and the disease corresponding to the heterologous antigen.
Owner:UNITED STATES OF AMERICA THE AS REPRESENTED BY THE SEC OF THE ARMY

Method of identification of animals resistant or susceptible to disease such as ruminant brucellosis, tuberculosis, paratuberculosis and salmonellosis

The present invention relates to materials and methods for identifying animals that are resistant or susceptible to diseases associated with intracellular parasites such as brucellosis, tuberculosis, paratuberculosis and salmonellosis. More particularly, the present invention relates to the identification of a gene, called NRAMP1, which is associated with the susceptibility or resistance of an animal, such as an artiodactyla to diseases such as brucellosis, tuberculosis, paratuberculosis and salmonellosis. Still more particularly, the present invention relates to the identification of specific sequences of bovine NRAMP1 which associate with resistance or susceptibility to ruminant brucellosis, tuberculosis, paratuberculosis and salmonellosis, and to the method of identifying said sequences to identify animals who are susceptible or resistant to disease.
Owner:MCGILL UNIV +1

Brucellosis indirect enzyme-linked immunosorbent assay milk liquid antibody reagent kit

ActiveCN101592660AMeet the needs of epidemic preventionQuick test methodMaterial analysisPositive controlBrucellosis
The invention aims to provide a brucellosis indirect enzyme-linked immunosorbent assay milk liquid antibody reagent kit which meets the demand of epidemic prevention of animals in our country and is quick, sensitive, specific and steady. The reagent kit is assembled by utilizing a purified lipopolysaccharide mixture of smooth bacterium burgeri and rough bacterium burgeri as an antigen coated ELIAS plate, using an immune healthy cow to prepare a positive control milk liquid, using a healthy non-immune cow to prepare a negative control milk liquid, taking a receptor-protein AG which is labeled by enzyme and is combined with Fc segments of mammals as an enzyme labeled conjugate, and is matched with a diluent, a washing liquid, a substrate solution A, a substrate solution B, H2O2, and a stop buffer. The brucellosis indirect enzyme-linked immunosorbent assay milk liquid antibody reagent kit establishes a quick, sensitive, specific and accurate inspection method which is suitable for brucellosis diagnosis and epidemiological investigation, and meets the demand of the epidemic prevention of the animals in our country.
Owner:哈尔滨平河生物技术有限公司 +2

Construction method and expression method of coexpression vector of L7/L12, Omp31, Rs alpha and sodC Brucella immune proteins

The invention discloses a construction method and an expression method of a coexpression vector of L7 / L12, Omp31, Rs alpha and sodC Brucella immune proteins. The disclosed coexpression vector includes a double expression vector pETDuet-1 and a double expression vector pRSFDuet-1, which are both expressed in the same host bacteria, wherein the two double expression vectors are respectively connected with encoding genes of two Brucella immune proteins. On this basis, the invention also discloses the construction method and the expression method of the coexpression vector. L7 / L12, Omp31, Rs alpha and sodC Brucella immune proteins all with good immunity functions can be expressed simultaneously by the coexpression vector disclosed by the invention and are effectively used for preparing subunit vaccine of the Brucella gene engineering and preventing and controlling various brucellosis.
Owner:LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI

Cattle and sheep brucellosis indirect enzyme-linked immunosorbent assay antibody detection kit and preparation method thereof

The invention relates to a cattle and sheep brucellosis indirect enzyme-linked immunosorbent assay antibody detection kit and a preparation method thereof, belongs to the field of detection of pathogens of zoonotic infections and aims at solving the problems of low sensitivity, poor specificity and the like in detection of Brucella by adopting other antigens. The kit is assembled by taking a recombinant Brucella BCSP31 protein with expression induced by SUMO as an expression vector in Escherichia coli to serve as an antigen-coated ELISA (enzyme-linked immunosorbent assay) plate, adding serum to be detected and rabbit anti-bovine HRP-IgG or rabbit anti-goat HRP-IgG and adding a washing buffer solution, a blocking solution, a TMB (3,3',5,5'-Tetramethylbenzidine) primer solution and a stop solution for matching. The prokaryotic expression vector, namely the SUMO, is utilized to express the Brucella BCSP31 protein in an efficient and soluble manner, the kit is used for establishing a Brucella ELISA detection method, the detection has better repeatability and specificity, and cattle and sheep Brucella can be fast and efficiently detected by utilizing the method.
Owner:INST OF SPECIAL ANIMAL & PLANT SCI OF CAAS +1

Brucellosis nucleic acid vaccine

The present invention discloses one kind of Brucellosis nucleic acid vaccine. The active component of the vaccine is one of the following mixture: 1. the mixture of at least two of the recombinant containing BCSP31 gene, the recombinant containing sodC gene and the recombinant containing L7 / L12 gene obtained through cloning BCSP31, sodC and L7 / L12 gene separately into eukarotic cell expression vector; and 2. the mixture of at least two of recombinant expression vectors obtained through fusing BCSP31, sodC and L7 / L12 gene separately with other nucleic acid sequence or deleting partial sequence or mutating partial nucleotides to obtain nucleotide sequence coding protein with the same activity as that of BCSP31, sodC and L7 / L12 gene and cloning separately to the eukarotic cell expression vector. The vaccine of the present invention may be used in preventing brucellosis of human body and animal.
Owner:PEKING UNIV

Brucella live vaccine and production method thereof

The invention relates to brucella and a production method of a brucella vaccine. In the vaccine, a recombinant brucella rS2-deltaWboA strain is taken as a production strain. A smooth recombinant strain is transformed into a rough recombinant strain by deleting base sequences among WboA genes 1-897bp of a brucella S2 strain and eliminating the forming condition of an O chain in a smooth brucella cell wall LPS (Lipopolysaccharide) structure with a non-resistant gene screening technology. The safety of the rough recombinant strain is improved remarkably, and a good immune effect on brucelliasis is still kept. Due to the adoption of the strain to the production of the vaccine, the current situation that a brucella vaccine immune animal cannot be distinguished from a wild strain infected animal easily is changed, and the safety of the conventional vaccine is effectively improved.
Owner:CHINA INST OF VETERINARY DRUG CONTROL

Brucella melilitensis bp26 gene-deleted M5-90 vaccine strain

The invention relates to a recombined brucella melilitensis, wherein the recombined brucella melilitensis completely deletes the bp26 gene. Safe tests prove that the brucella melilitensis is consistent with a parent vaccine strain. Virulent attack protection tests prove that a mutant strain has immune protection consistent with the parent vaccine strain. The mutant strain has significance for distinguishing vaccine immunity from wild type brucellosis infection from the standpoint of serology and controlling, monitoring and purifying brucellosis disease.
Owner:HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI

Brucella omp31 antigenic epitope and monoclonal antibody thereof, and application of brucella omp31 antigenic epitope and monoclonal antibody thereof

InactiveCN104086634AGood specificity recognition abilityAccurate identificationAntibacterial agentsBacterial antigen ingredientsBrucella antigenEpitope
The invention discloses a brucella omp31 antigenic epitope and a monoclonal antibody thereof, and an application of the brucella omp31 antigenic epitope and the monoclonal antibody thereof. The sequence of the epitope is GGYIGINAGYAGGKFK. The invention also discloses the monoclonal antibody identifying the epitope, and the application of the epitope and the monoclonal antibody in preparing reagents or medicines used for diagnosing, preventing or treating brucellosis.
Owner:SOUTHERN MEDICAL UNIVERSITY

Preparation method and product of live brucellosis vaccine

The invention discloses a preparation method of a Brucellosis live vaccine and a product thereof. The method comprises primary strain preparation, secondary strain preparation and bacterial solution culture, wherein in the step of bacterial solution culture, the secondary strain is inoculated onto a liquid culture medium, and air is introduced in a manner of gradually increasing ventilation for culture; and after the bacteria strain is cultured for 30 hours, pure oxygen is introduced till the bacterial strain is cultured for 36 hours. In the method disclosed by the invention, pure oxygen is introduced at a time when it is most suitable for bacteria to prorogate in a large amount in the bacterial solution culture step, so the quantity of the cultured bacteria is increased greatly to 150 to190 billion per milliliter. When the method is used, the bacterial solution is not required to be concentrated; and the method has the advantages of high yield, low production cost and the like.
Owner:哈药集团生物疫苗有限公司

DNA loaded Brucella ghost composite vaccine

The invention discloses a DNA loaded Brucella ghost composite vaccine. The preparation method comprises following steps: introducing a suicide plasmid that contains a nucleic acid molecule encoding atemperature sensitive regulatory protein cI857, a nucleic acid molecule encoding a bacteriophage splitting protein E, and a nucleic acid molecule encoding a bacterial nuclease protein A into Brucella;utilizing a homologous recombination technology to obtain recombinant Brucella; culturing the recombinant Brucella to obtain a bacterial solution, processing the bacterial solution at a high temperature, collecting bacterial cells, and adding target DNA to obtain the DNA loaded Brucella ghost composite vaccine. The composite vaccine has following advantages: (1) the vaccine has the characteristics of bacterial ghost, compared with a conventional killed vaccine or an attenuated live vaccine, the side effect of the composite vaccine is small, the safety is high, and the protection effect is good; and (2) the bacterial ghost is a safe and effective carrier for delivering DNA vaccines, can introduce nucleic acid vaccines into antigen presenting cells, and performs high efficient expression. The composite vaccine has an important meaning for controlling the epidemic spreading of brucellosis and has a wide application range.
Owner:INNER MONGOLIA HUAXI BIOTECH

Integration cattle NRAMPl macrophage specificity expression vector/cattle fibroblast and method thereof

InactiveCN102559749AEfficient specificityPrevention of bovine brucellosisFermentationVector-based foreign material introductionCell systemBrucellosis
The invention discloses an integration NRAMPl macrophage specificity expression vector / cattle fibroblast and a method thereof. An expression vector pSP-NRAMPl-HA containing NRAMPl macrophage specificity and a Qinchuan cattle fibroblast system which is based on the vector and contains NRAMPl are structured, and the method utilizing the cell system as a nucleus donor cell provides a solid foundation for solving transgenosis cattle problem suffering from Qinchuan cattle brucellosis. According to the invention, the exogenous expression vector pSP-NRAMPl-HA is conducted into the cattle fibroblast by a liposome transfection method, negative cells are obtained by G418 screening, and proved by PCR, the aim gene NRAMPl is integrated into the genome of the cattle fibroblast; and finally the cattle fibroblast cell integrated with the NRAMP1 gene is taken as the nucleus donor, a nucleus-removing oocyte is moved into the nucleus donor, thus obtaining a transgenosis clone body.
Owner:NORTHWEST A & F UNIV

Fabrication method and application of electrochemical immunosensor for detecting brucellosis

The invention provides a fabrication method of an electrochemical immunosensor for detecting brucellosis, and belongs to the technical field of an electrochemical biosensor. The method comprises the steps of pre-processing a glassy carbon electrode, modifying a gold nanoparticle onto the glassy carbon electrode by a method of electrodeposition, introducing glutathione as a dirt-resistant material,self-assembling with a gold surface, effectively rejoining HA onto the glutathione by N-(3-dimethy inaminoproyl)-N'-ethyl carbodiimide and N-hydroxysuccinimide, and finally, enclosing a non-speical active site by erythritol. By the method, the problems of poor accuracy, complicated processing process and the like of an existing brucellosis detection method are solved. An electrode interface of the immunosensor has excellent hydrophilcity, the pollution-prevention property of a composite interface is obviously improved, the method has the advantages of ultrahigh sensitivity, relatively wide linear range, relatively low detection limit, good stability and repeatability, is simple and convenient to operate and can be used for detecting a brucellosis antibody in a complicated biological sample.
Owner:QINGDAO UNIV OF SCI & TECH

Monogene deletion rough-type Brucella and production method of Brucella vaccine

The invention relates to a monogene deletion rough-type Brucella and a production method of a Brucella vaccine. According to the recombinant strain, base sequences between 1-897bp of the WboA gene of a Brucella 2308 strain are deleted by virtue of a non-resistance gene screening technology so as to lose the conditions for the formation of O-chain in a smooth-type Brucella cell wall LPS (Lipopolysaccharide) structure, and thus the smooth-type Brucella is transformed into a rough -type Brucella. The safety of the rough-type recombinant strain is significantly improved, but a good immune effect on brucellosis is still maintained, the recombinant bovine Brucella is named Brucella r2308-delta WboA strain (CGMCC No.8885). The current situation that Brucella vaccine immune animals are hard to distinguish from wild-strain-infected animals is changed by a vaccine produced by the strain, and the safeties of existing vaccines are effectively improved.
Owner:CHINA INST OF VETERINARY DRUG CONTROL

Brucella molecular marker vaccine strain for bovine species and application thereof

ActiveCN105039233ASolve the problem of not being able to distinguish between artificial immunization and wild bacterial infectionReduced toxicityAntibacterial agentsBacterial antigen ingredientsBrucellosisMarker vaccine
The invention discloses a brucella molecular marker vaccine strain for bovine species and an application thereof. The brucella molecular marker vaccine strain for bovine species, which is provided by the invention, is obtained by replacing the coding gene of a protein bp26 of brucella BH1 with the coding gene of a BLS protein and the coding gene of a protein L7 / L12 and inactivating the coding gene of a wboA protein of brucella. Experiments prove that the molecular marker vaccine strain BH1deltabp26deltawboA-BL has good immunoprotection effects on brucellosis, has lower toxicity and obviously improved safety, can be used for immunoprophylaxis of brucellosis of cattle and sheep, can distinguish wild strain infected animals from immune animals by adopting the immunological technique, has great significance in monitoring, diagnosing, purifying and controlling brucellosis and has extensive application value.
Owner:INNER MONGOLIA HUAXI BIOTECH

Monoclonal antibody of brucella omp31 protein and application thereof

The invention discloses a brucella omp31 protein epitope and an antibody and application thereof. The sequence of the epitope is shown as GDDASALHTWSDKTKA. The invention further discloses a monoclonal antibody for identifying the epitope as well as the application of the monoclonal antibody. Both the brucella omp31 protein epitope and the monoclonal antibody contribute to diagnosis of brucellosis.
Owner:SOUTHERN MEDICAL UNIVERSITY

Immunology identification method for Brucella A19-delta VirB12 molecular marker vaccine

The invention discloses an immunology identification method for Brucella A19-delta VirB12 molecular marker vaccine. The method comprises the following steps: a, carrying out bioinformatics software analysis according to the VirB12 gene characteristics of Brucella A19, so as to obtain an active sequence, wherein the corresponding DNA sequence is a polypeptide 074 DNA sequence: GGCCTGACGGACAACAACTGCCCTCCTCCCGGTGATACGTACGCAA; b, conducting artificial synthesis on the sequence obtained in the step a by taking the DNA sequence as a template, so as to obtain polypeptide, wherein the amino acid sequence of the polypeptide is a polypeptide 074 amino acid sequence: GLTDNNCPPPGDTQ; c, taking the active polypeptide ingredient obtained in the step b as an envelope antigen. According to the method, the problem that an immune animal and a clinic sick animal are difficult to identify is solved, and the practical application value in preventing, controlling, eliminating and purifying cattle brucellosis is high.
Owner:VETERINARY INST XINJINAG ACADEMY OF ANIMAL SCI CLINIC MEDICAL SCI RES CENT XINJIANG ACADEMY OF ANIMAL HUSBANDRY SCI

Method for identifying brucella S2 vaccine strain by dual quantitative real-time PCR (polymerase chain reaction) and complete set of reagents used for method

The invention discloses a method for identifying a brucella S2 vaccine strain by dual quantitative real-time PCR (Polymerase Chain Reaction) and a complete set of reagents used for the method. The complete set of the reagents consist of a primer Bru-F1, a primer Bru-R1, a probe Bru-Probe1, a primer S2-F2, a primer S2-R2 and a probe S2-Probe2, and the nucleotide sequences of the primer Bru-F1, theprimer Bru-R1, the probe Bru-Probe1, the primer S2-F2, the primer S2-R2 and the probe S2-Probe2 are sequentially shown as SEQ ID NO: 1-SEQ ID NO: 6. Compared with other brucellosis nucleic acid detection methods, the method established by the invention directly performs qualitative and quantitative analysis and identification on the brucellosis S2 vaccine strain through fluorescence information, has the advantages of convenience, accuracy, sensitivity, specificity and the like, greatly shortens the detection time, has a great application value for prevention and control of brucellosis, and hasa wide application prospect. Epidemic situations can be controlled from the source, large-scale outbreak of the brucellosis epidemic situations is effectively prevented, and development of animal husbandry and public health safety are guaranteed.
Owner:CHINA ANIMAL DISEASE CONTROL CENT

Brucella recombinase polymerase amplification detection kit and application thereof

The invention belongs to the technical fields of genetic engineering and diagnostic reagents and particularly relates to a brucella recombinase polymerase amplification (RPA) detection kit and application thereof. The detection kit comprises a specific primer group and a probe. An RPA amplification product is detected by virtue of a test strip and is dropwise added to the test strip after being amplified for only about 10 minutes, and a result is read, so that a PCR amplification instrument and a quantitative PCR instrument are saved. A method provided by the invention has the advantages of strong specificity, good sensitivity, simple operation process, rapidness in detection and the like, the possibility is provided for the detection of field brucellosis, and a method which does not aimsat the diagnosis and treatment of diseases is provided for the research of brucella.
Owner:LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI

EryA gene deleted strain of brucella Rev.1, construction method and application thereof

The invention discloses an eryA gene deleted strain of brucella Rev.1, a construction method and an application thereof, and belongs to the technical field of gene engineering. Compared with a wild brucella strain, the eryA gene deleted strain provided by the invention has the advantage that all eryA genes are deleted. When the eryA gene deleted strain is used as a brucella vaccine strain, the eryA gene can be detected to distinguish the wild brucella strain from the eryA gene deleted strain, so that natural infection with brucella can be distinguished from artificial immunization, thereby effectively purifying brucellosis. According to the construction method of the eryA gene deleted strain, PCR identification and single colony sequencing verification are adopted to obtain the pure eryA gene deleted strain of brucella Rev.1 with deletion of the eryA genes in high reliability.
Owner:JINYUBAOLING BIO PHARMA CO LTD +1

Recombinant bacterium of brucella melitensis and use thereof

The invention discloses a recombinant strain for Brucella melitensis. The recombinant strain for the Brucella melitensis is a bacterial strain obtained by killing encoding genes of cold shock protein in the Brucella melitensis. Compared with an original strain, the obtained strain has virulence lower than that of the prior vaccine M5, and can be used as a vaccine to immunize animals without killing the genes. By utilization of the strain to immunize a mouse, whether a strain separated from the body of a sicken animal is a vaccine strain or a wild strain can be identified by the PCR method. The modification of the brucelliasis vaccine and the research of a diagnosis and identification agent have important significance in developing a brucelliasis gene deletion marker vaccine and a matched diagnosis and identification agent and promoting the elimination and purification of brucelliasis of the animals all over the world.
Owner:CHINA AGRI UNIV

Brucella three-gene recombinant plasmid, construction method thereof and expression and application thereof in escherichia coli

The invention discloses a brucella three-gene recombinant plasmid, a construction method thereof and expression and application thereof in escherichia coli, belonging to the technical field of geneticengineering. According to the technical scheme, a pET-28a(+) plasmid is taken as as a carrier, and a synthetic full-length gene Omp10-Omp28-L7 / L12 is inserted between pET-28a(+) restriction enzyme cutting sites BamHI and XhoI so as to establish a pET-28a(+)recombinant plasmid containing an Omp10-Omp28-L7 / L12 gene segment and a kanamycin screening label, namely pET-28a(+)-Omp10-Omp28-L7 / L12 recombinant plasmid. The brucella three-gene recombinant plasmid has the beneficial effects that brucella Omp10-Omp28-L7 / L12 is successfully cloned and is linked and converted to the recombinant plasmid, sothat the efficient soluble expression of the recombinant plasmid in an escherichia coli expression system is realized, an expressed protein is capable of inhibiting the infection, proliferation and transfer capabilities of brucella in the body fluid and cell levels, promoting the level of an antibody in a mouse and prolonging the immune time, and a novel treatment through is provided for the treatment of brucella diseases.
Owner:SHANDONG AGRICULTURAL UNIVERSITY

Method for detecting infectious disease pathogens and kit

The invention discloses a method for detecting infectious disease pathogens possibly existing in a biological sample. The infectious disease pathogens comprise chlamydia psittaci, pneumocystis carinii, leptospira, Q fever rickettsiosis and brucellosis. The method comprises the following steps: expanding nucleic acid fragments of the biological sample, and detecting the nucleic acid fragments by using a probe. The invention also provides primers used for expanding and the probe used for detection. The invention also provides a kit comprising the primers. The method has the advantages of high sensitivity, strong specificity, simple operation and wide sample range, can simultaneously detect various infectious disease pathogens, and is suitable for early diagnosis of respiratory infectious diseases.
Owner:海康生物科技(北京)有限公司

Nucleic acid double detection test strip for brucella and mycobacterium tuberculosis

PendingCN110714091ASerological testing methods are accurateMicrobiological testing/measurementForward primerNucleic acid detection
The invention discloses a nucleic acid double detection test strip for brucella and mycobacterium tuberculosis and relates to the field of bacterial detection. The nucleic acid double detection test strip comprises a brucella forward primer sequence shown in SEQ ID NO:1, a brucella reverse primer sequence shown in SEQ ID NO:2, a brucella probe sequence shown in SEQ ID NO:3, a mycobacterium tuberculosis forward primer sequence shown in SEQ ID NO:4, a mycobacterium tuberculosis reverse primer sequence shown in SEQ ID NO:5 and a mycobacterium tuberculosis probe sequence shown in SEQ ID NO:6. Isothermal amplification is performed on the brucella and the mycobacterium tuberculosis separately by a fluorescence marking method, nucleic acid detection is performed in combination with an immunochromatography technology, the method is more accurate than a traditional serologic detection method, and besides, the method can distinguish infection with the brucella and mycobacterium tuberculosis of animals simultaneously and has great significance in clinical control of brucella and mycobacterium tuberculosis.
Owner:ACAD OF MILITARY SCI PLA CHINA ACAD OF MILITARY MEDICAL SCI INST OF MILITARY VETERINARY MEDICINE

Serum-based rapid brucella vaccine strain infection detection method

The invention provides a serum-based rapid brucella vaccine strain infection detection method, and relates to the technical field of protein fingerprint spectrum detection. The invention provides characteristic protein combination for identifying serum infection of a brucella vaccine strain. The characteristic protein combination is used for constructing a standard detection model of vaccine strain infected brucellosis serum through a GA model algorithm of ClinProTools software, the recognition capability of the constructed model is 100%, and the cross validation value is 99.56%. MALDI-TOF MSmass spectrum data of to-be-detected serum are classified and analyzed by utilizing the standard detection model, and whether the to-be-detected serum is infected by a brucella vaccine strain or not can be accurately judged. The method is suitable for serum detection of high-risk groups infected by Brucella vaccine strains, is high in accuracy, good in repeatability and high in flux, detection of96 samples can be completed within 4 hours, the detection cost is low and the result is reliable, and the method has the broad application prospect.
Owner:ICDC CHINA CDC

ELISA (enzyme-linked immunosorbent assay) reagent kit for detecting IgM antibodies of brucellosis and application of ELISA reagent kit

InactiveCN107656057ABiological material analysisImmune profilingBrucella antigen
The invention discloses an ELISA (enzyme-linked immunosorbent assay) reagent kit for detecting IgM antibodies of brucellosis and application of the ELISA reagent kit. The ELISA reagent kit comprises brucella antigen coated microporous plates, HRP (horseradish peroxide) labeled brucella antigens, negative reference substances, positive reference substances, color developing agents A, color developing agents B, stop solution and concentrated cleaning solution. The application of the ELISA reagent kit on the basis of double-antigen sandwich immunoassay principles includes adding to-be-detected samples into the microporous plates, binding unknown antibodies in the samples with solid-phase antigens, carrying out washing to form stable unknown antibody-antigen complexes, adding labeled antigensinto the unknown antibody-antigen complexes to bind the labeled antigens with blank sites of IgM antibodies so as to form labeled antigen-IgM antibody-antigen complexes, washing the labeled antigen-IgM antibody-antigen complexes, and then adding the color developing agents into the labeled antigen-IgM antibody-antigen complexes; measuring absorbance OD (optical density) values under the conditionof detection wavelengths of 450 nm and then judging the to-be-detected samples according to critical values. The shade of colors and the degrees of concentration are in positive correlation function relationships. The ELISA reagent kit and the application have the advantage that the ELISA reagent kit can be used for monitoring early acute infection to detect the brucellosis of pigs, cattle and sheep.
Owner:LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI

Brucella shell as well as preparation method and application thereof

The invention relates to the field of microorganism, and in particular discloses a Brucella shell as well as a preparation method and application thereof. The preparation method comprises the following steps: cloning a lysis gene E having a nucleotide sequence shown in SEQ ID NO:1 to a plasmid pBV220 so as to obtain a recombinant plasmid pBV220::E; subsequently, amplifying the recombinant plasmid pBV220::E, and connecting the amplifying product to a plasmid pBBR1MCS-2; then transforming to Brucella; carrying out propagation culture on the recombinant strain at the temperature of 25-30 DEG C until the OD600 value of the strain is 0.8-1.2; raising the temperature to 37-45 DEG C until the OD600 value is stable; then centrifuging and collecting strain; and washing and then carrying out freeze thawing with a hypertonic solution so as to obtain the Brucella shell. According to the invention, the Brucella shell with high safety and good protection effect is prepared by transforming a fusion sequence of a temperature-controlling regulation sequence and the lysis gene E to the Brucella through adopting biotechnology, and the obtained Brucella shell has an important significance in control of epidemic and propagation of Brucella disease.
Owner:MILITARY VETERINARY RES INST PLA MILITARY MEDICAL ACAD OF SCI

SNP molecular marker used for identifying Brucella vaccine strain M5, and application of SNP molecular marker

The invention relates to the technical field of molecular markers, in particular to an SNP molecular marker used for identifying a Brucella vaccine strain M5, and application of the SNP molecular marker. The SNP molecular marker provided by the invention comprises a nucleotide sequence of which the polymorphism is A / C at the 37th site of a sequence as shown in SEQ ID NO.1, the polymorphism site of the SNP molecular marker is A and corresponds to the Brucella vaccine strain M5, and the polymorphism site of the SNP molecular marker is C and corresponds to a wild strain or other Brucella vaccine strains. The SNP molecular marker and a detection primer and a probe thereof can realize simple, convenient and efficient identification of the Brucella vaccine strain M5, the wild strain and other Brucella vaccine strains, are relatively high in accuracy, can be applied to Brucella disease pathogen monitoring and epidemiological analysis, and provide accurate technical support for Brucella disease prevention and control.
Owner:ICDC CHINA CDC
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More