Sorghum seedling stage cold resistance related protein SbBA3 as well as coding gene and application thereof

Abstract

The invention discloses an application of a substance for regulating and controlling gene expression in regulating and controlling the cold resistance of sorghum at a seedling stage or an application in preparing a product for regulating and controlling the cold resistance of the sorghum at the seedling stage in the technical field of biology. The gene codes SbBA3 protein. According to the invention, the sorghum SbBA3 gene is overexpressed and instantaneously silenced by adopting heterologous overexpression and VIGS technologies respectively, and the new sorghum gene capable of obviously improving the cold resistance of sorghum at the seedling stage is obtained. According to the method, the cold resistance of the sorghum at the seedling stage is improved, gene resources capable of improving the cold-resistant germplasm of the sorghum are innovatively obtained, and the method has important significance on breeding of new varieties and guaranteeing of seed industry and grain safety and has great application and popularization value.

Description

Technical Field

[0001] The invention relates to the technical field of biotechnology, and in particular to a sorghum seedling cold tolerance-related protein SbBA3 and a coding gene and application thereof. Background Art

[0002] Sorghum (Sorghum bicolor (L.)) is one of the four major cereal crops in the world. It is a thermophilic crop originating from tropical or subtropical regions and is extremely sensitive to low temperatures. In low-temperature producing areas such as high latitudes and high altitudes, low temperature and chilling damage at the sorghum seedling stage has become one of the important factors affecting its yield and planting areas. Low temperature stress at the seedling stage seriously delays seedling growth, reduces the seedling rate, and ultimately affects sorghum yield.

[0003] Sorghum, the world's fifth largest cereal crop, originated in semi-arid tropical regions. It is a warm-season crop with strong drought and heat resistance, but is more sensitive to low temperature stress. Low temperature stress, as an agricultural meteorological disaster, mainly occurs during the crop growing season. As the temperature drops below the lower limit that the crop can tolerate, the crop is harmed, which in turn affects its normal growth and yield. In the actual production of sorghum, it is very susceptible to low temperature stress, especially during the vegetative growth period (germination and seedling stage). Sorghum is generally sown in early spring, when the temperature is changeable, resulting in low temperatures and cold weather from time to time. As a result, the sorghum has a low emergence rate and mildew after low temperature stress, resulting in yield losses, which seriously restricts sorghum production.

[0004] Therefore, seedling cold damage is the most serious period affecting sorghum yield, and research on cold tolerance of sorghum seedlings is of great significance. However, the use of traditional breeding methods to cultivate cold-tolerant sorghum varieties takes a long time and progress is relatively slow. The use of genetic engineering technology can directly transform the genetic background of plants at the gene level and transform the genetic traits of plants in a targeted manner. Discovering cold-tolerant genes in sorghum seedlings has very important theoretical and practical significance for breeding new cold-tolerant sorghum varieties. Summary of the invention

[0005] The present invention aims to provide a SbERF027 protein related to cold tolerance in the sorghum seedling stage and related biological materials and applications thereof, so as to regulate the cold tolerance in the sorghum seedling stage.

[0006] In order to achieve the above object, the present invention provides the following technical solution: The present invention provides the use of a substance for regulating gene expression in regulating the cold tolerance of sorghum seedlings or in the preparation of a product for regulating the cold tolerance of sorghum seedlings, wherein the gene encodes the SbBA3 protein, and the SbBA3 protein is the following protein A1), A2) or A3):

[0007] A1) the amino acid sequence is the protein of SEQ ID No. 1 in the sequence list;

[0008] A2) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the protein of A1) and having 75% or more identity with the protein of A1) and having activity of regulating cold tolerance at the seedling stage of sorghum;

[0009] A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0010] Among them, SEQ ID No. 1 consists of 189 amino acid residues.

[0011] The above-mentioned protein can be derived from sorghum.

[0012] In the above application, the identity of the protein refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be obtained.

[0013] In the above applications, the above 75% identity of the proteins may be at least 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% identity.

[0014] In the above application, the protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc. The amino acid sequences of some of the available tags are shown in Table 1.

[0015] Table 1 Tag sequences

[0016] Label Residue sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHQ c-myc 10 EQKLISEEDL

[0017] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0018] In the above application, the gene is a nucleic acid molecule encoding SbBA3 protein.

[0019] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0020] In the above application, the gene may be a cDNA molecule or a DNA molecule whose coding sequence of the coding chain is SEQ ID No. 2.

[0021] In the above application, the substance regulating gene expression is any one of the following F1, F2 or F3:

[0022] F1, sgRNA, siRNA, shRNA, miRNA or antisense RNA targeting the gene;

[0023] F2, a DNA molecule that produces an sgRNA targeting the gene, a DNA molecule that produces an siRNA targeting the gene, a DNA molecule that produces an shRNA targeting the gene, a DNA molecule that produces an miRNA targeting the gene, or a DNA molecule that produces an antisense RNA targeting the gene;

[0024] F3. an expression vector that produces an sgRNA targeting the gene, an expression vector that produces an siRNA targeting the gene, an expression vector that produces an shRNA targeting the gene, an expression vector that produces an miRNA targeting the gene, or an expression vector that produces an antisense RNA targeting the gene.

[0025] In order to solve the above technical problems, the present invention provides a reagent for improving the cold tolerance of sorghum seedlings, wherein the active ingredient of the reagent is the above-mentioned substance for regulating gene expression.

[0026] The active ingredients of the above-mentioned reagents may also contain other biological components and / or non-biological components. Those skilled in the art can determine the other active ingredients of the above-mentioned agents based on the cold resistance effect of sorghum seedlings.

[0027] In order to solve the above technical problems, the present invention also provides a method for improving the cold tolerance of sorghum at the seedling stage, comprising the following steps: inhibiting the expression of the SbBA3 protein in the recipient sorghum, reducing the abundance of the SbBA3 protein, and / or silencing the gene encoding the SbBA3 protein, so as to obtain the target sorghum having higher cold tolerance at the seedling stage than that of the recipient sorghum.

[0028] In the above method, the inhibition of the expression of the SbBA3 protein in the receptor sorghum, the reduction of the abundance of the SbBA3 protein, and / or the silencing of the gene encoding the SbBA3 protein can be achieved through the VIGS (virus induced gene silencing, VIGS) system, and the VIGS system includes expression plasmids containing pTRV2-SbBA3 and pTRV2, and the target sequence of pTRV2 can be positions 575-990 (420 bp in total) of SEQ ID No. 2 in the sequence list.

[0029] The present invention also provides the SbBA3 protein.

[0030] The present invention also provides a biological material related to the SbBA3 protein, wherein the biological material is any one of the following B1) to B5):

[0031] B1) a nucleic acid molecule encoding the protein;

[0032] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0033] B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0034] B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0035] B5) A transgenic plant cell line, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant cell line, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the expression cassette described in B2).

[0036] The present invention provides an application of a substance for regulating gene expression in regulating cold tolerance at the seedling stage of sorghum or in preparing a product for regulating cold tolerance at the seedling stage of sorghum, wherein the gene encodes the SbBA3 protein. The present invention uses heterologous overexpression to prove that the target gene SbBA3 has the function of enhancing the cold tolerance of rice plants, and at the same time uses the VIGS technology to silence the sorghum SbBA3 gene, providing a basis for obtaining a new sorghum germplasm with significantly improved cold tolerance at the seedling stage. The invention is of great significance to the innovation of sorghum cold-resistant germplasm resources, the cultivation of new varieties, and the guarantee of seed and food security, and has great application and promotion value. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 A schematic diagram of a climate box for treating seedling materials in an embodiment of the present invention;

[0038] Figure 2The statistical results of the phenotype (soil culture) and cold tolerance-related physiological indicators of the two sorghum varieties, SZ7 and Z-5, treated with low temperature for 7 days at the seedling stage in Example 1 of the present invention;

[0039] Figure 3 VEEN comparative analysis of the GO enrichment term "Response to cold" in Example 1 of the present invention;

[0040] Figure 4 The expression trend analysis results of differentially expressed genes enriched under the item "Response to cold" in Example 1 of the present invention;

[0041] Figure 5 The heat map comparison analysis (a) and homologous protein evolution tree comparison (b) of SbBA3 in Example 1 of the present invention;

[0042] Figure 6 The results of cold-induced expression (a) and tissue expression (b) of SbBA3 in Example 2 of the present invention;

[0043] Figure 7 The results of measuring gene expression, seedling survival rate and related cold tolerance indexes of the SbBA3 transiently silenced strain and the control plant after cold treatment in Example 2 of the present invention;

[0044] Figure 8 Figures a, b, c, and d are statistical graphs of phenotype, gene expression, seedling survival rate, and chlorophyll content, respectively. DETAILED DESCRIPTION

[0045] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0046] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0047] The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0048] The sorghum varieties SZ7 and Z-5 in the following examples are both germplasm resources, and the original species are preserved in Jilin Academy of Agricultural Sciences. The public can obtain them from Maotai College (i.e., the applicant) to repeat the experiments of this application.

[0049] The Agrobacterium tumefaciens strain GV3101 in the following examples is recorded in the non-patent document "Cai Lanfeng. Research on Agrobacterium tumefaciens-mediated Sugarcane Genetic Transformation Technology. Master's degree thesis. Issue 08, 2014", which can be obtained by the public from Maotai College (ie, the applicant) to repeat the experiments of this application.

[0050] The following examples used Excel statistical software to process the data, and the experimental results were expressed as mean ± standard deviation. Duncant's test was used, and P < 0.05 (*) indicated a significant difference, and P < 0.01 (**) indicated a very significant difference.

[0051] Example 1. Acquisition of SbBA3 gene

[0052] 1. Acquisition of SbBA3 gene

[0053] In this study, two sorghum materials with significant differences in cold tolerance at the seedling stage were selected, namely Suiza 7 (hereafter referred to as SZ7) and Zhong-5 (hereafter referred to as Z-5).

[0054] Cold resistance identification method ( Figure 1 ), specifically:

[0055] Cold treatment in an artificial climate chamber (ZRX-460B): Sorghum seedlings grown to the seedling stage (three-leaf stage) under normal conditions were moved to an artificial climate chamber at 4°C for 7 days.

[0056] Control: Sorghum grown at room temperature to the seedling stage under normal conditions was not subjected to low temperature stress.

[0057] Each material was replicated with 15 plants.

[0058] After the cold stress ended, the test materials were transferred to room temperature to resume growth. After one week, the phenotypic identification was carried out and the survival rate of the seedlings was calculated:

[0059] Seedling survival rate = number of surviving seeds after treatment / total number of seeds × 100%

[0060] The phenotypic identification results are shown in Figure 2 , Figure 2 Figure a shows the seedling stage photos of two materials after low temperature treatment (right side) and normal control (left side). Figure 2 Figures b, c, d and e are bar graphs of seedling survival rate, chlorophyll content, proline content and ion permeability, respectively. In the figures, "*" and "**" indicate significant and almost significant differences, respectively, and ns indicates no significant difference.

[0061] This showed that the cold tolerance of SZ7 at the seedling stage was significantly higher than that of Z-5.

[0062] Two sorghum materials grown to the seedling stage under normal conditions were transferred to an artificial climate chamber at 4°C for 7 days, and the control was treated for 0 hours. The ears treated with low temperature for 0 hours, 2 hours, 8 hours and 16 hours were taken for transcriptome sequencing, and a series of differentially expressed genes were obtained. The analysis found that the cold-response-related GO terms "Response to cold" ( Figure 3 ), Figure 3 Figures a and b represent the VEEN analysis results of GO terms enriched in the cold-sensitive material Z-5 and the cold-resistant variety SZ7 at three different time points, respectively. Figure c represents the GO term information shared by the two materials at different time points.

[0063] By analyzing the expression trend of differentially enriched genes under "Response to cold", two significantly enriched gene sets (Type1 and Type2) were obtained ( Figure 4 ), and heat map analysis was performed on the 8 genes in Type 1 above based on log2FC values ​​( Figure 3 ). It was found that the SORBI_3001G293800 gene was induced by low temperature in both sorghum materials, and the degree of induction in the cold-sensitive material Z-5 was significantly higher than that in the cold-tolerant material SZ7. Combined with phylogenetic tree analysis, it was found that SbCBA3 was homologous to the low-temperature response gene AtBAM3 (AT4G17090) in Arabidopsis and the rice β-amylase gene OsBAM2 (Os10g0465700) ( Figure 5 ), the study showed that plant amylase-related genes were involved in the response to external abiotic stresses such as low temperature, suggesting that SbCBA3 may be involved in the regulation of cold tolerance in sorghum seedlings; the results of cold-induced expression analysis were consistent with the results of the heat map, and the gene was up-regulated by low temperature in SZ7 earlier than in Z-5, and the expression level was higher in leaves, ears and seedlings ( Figure 6 ). Therefore, it is speculated that SORBI_3001G293800 may be a candidate gene for regulating cold tolerance in sorghum seedlings. The nucleotide sequence of the SORBI_3001G293800 gene is SEQ ID No.2, which encodes a β-amylase protein 3 (Beta-amylase 3), named SbBA3, and its amino acid sequence is SEQ ID No.1.

[0064] 2. Expression pattern of SbBA3 gene

[0065] Normal treatment: Take samples of different tissues of SZ7 under normal planting conditions, including seedlings, roots, stems, mature leaves, leaf sheaths, and spikes. After sampling, use liquid nitrogen to quickly freeze and store at -80℃ for later use.

[0066] Low temperature stress treatment: SZ7 and Z-5 grown to the seedling stage under normal conditions were transplanted into an artificial climate chamber at 4°C, and seedling leaf samples were taken at 0h, 2h, 8h, 16h, 1d, 2d, 4d, and 6d, respectively, quick-frozen in liquid nitrogen, and stored at -80°C for later use.

[0067] Total RNA was extracted from the samples treated above, and the first strand of cDNA was synthesized by reverse transcription using reverse transcriptase M-MLV. The first strand of cDNA was used as a template, and primers were used for real-time quantitative analysis, with SbActin1 as the internal reference gene. The SbBA3 amplification primer set consisted of qRT-SbBA3-F and qRT-SbBA3-R, and the SbActin1 amplification primer set consisted of Actin1-F and Actin1-R. The sequences are as follows:

[0068] SbBA3 amplification primers:

[0069] qRT-SbBA3-F:5'-CCTTGTGGAGAGCTGAGGTA-3';

[0070] qRT-SbBA3-R:5'-CCCGCATGTACTTGTCATAGCAT-3'

[0071] SbActin1 amplification primers:

[0072] Actin1-F:5'-CGAAGACATACTGGACGCAACA-3';

[0073] Actin1-R:5'-GGGCGGAAAGAATTAGAAGC-3'

[0074] The experiment was repeated three times.

[0075] Analysis of cold-induced expression of SbBA3 Figure 6 a. It can be seen that both SZ7 and Z-5 were induced by low temperature, indicating that the SbBA3 gene is a gene related to low temperature stress, and the low temperature induction in the low temperature sensitive material Z-5 at the seedling stage was significantly lower than that in the cold-tolerant parent SZ7.

[0076] The tissue expression pattern of SbBA3 Figure 6 b. It can be seen that the SbBA3 gene is expressed in different tissues, especially in leaves, ears and seedlings.

[0077] Example 2: Functional verification of SbBA3 gene

[0078] 1. Construction of SbBA3 VIGS silencing vector

[0079] The target was designed according to the literature description (Li et al: PbrMYB21, a novel MYB protein of Pyrusbetulaefolia, functions in drought tolerance and modulates polyamine levels by regulating arginine decarboxylase gene. Plant Biotechnology Journal, 15, 1186-1203). The specific target sequence was the 575-990 bp nucleotide sequence of SEQ ID No. 2 (420 bp in total).

[0080] pTRV2-SbBA3-F: AAGGTTACCGAATTCTCTAGATGCTGGAGGAGATGAGCAGCAApTRV2-SbBA3-R: CGTGAGCTCGGTACCGGATCCGGAAGAAGCCTGTGTCGTCA

[0081] Recombination-ligation reaction using SoSoo Cloning Kit Ver.2 (Beijing Qingke) was used as follows: 2×SoSoo Mix 5ul, PCR purified product 1.4ul, vector pTRV2 3.6ul, reacted at 50℃ for 20min, immediately transferred into competent E. coli DH5α, ice bathed for 20min, heat-shocked at 42℃ for 1min, then propagated the bacterial solution in a constant temperature shaker and plated for culture. After PCR monoclonal detection and sequencing, the specific primer sequences are as follows:

[0082] Detection primer: SbBA3-F: 5′-CATCGTGTACACGGACAGGT-3′;

[0083] SbBA3-R:5'-ATGTACTTGTCATAGCATTGG-3';

[0084] Sequencing primer: SbBA3-F1: 5′-TGCTGGAGGAGATG-3′;

[0085] SbBA3-R1:5'-GGAAGAAGCCTGTGTCGTCA-3'.

[0086] The sequencing results confirmed that the silencing target site of SbBA3 existed on the obtained recombinant vector, and finally the silencing vector of SbBA3 gene was obtained and named as pTRV2-SbBA3.

[0087] 2. Obtaining SbBA3 transiently silenced sorghum lines

[0088] The recombinant vector pTRV2-SbBA3 prepared above with the SbBA3 silencing target was transformed into Agrobacterium tumefaciens GV3101 by heat shock method to obtain the recombinant bacteria GV3101 / pTRV2-SbBA3, which was used to infect the young shoots (about 1 cm) of the transgenic receptor SZ7. Transient gene silencing sorghum seedlings were obtained, and their genomic DNA was extracted at the three-leaf stage. The expression level of SbBA3 was identified using the following primers. Plants with significantly lower expression levels than the control were selected for the next experiment.

[0089] qRT-SbBA3-F:5'-CCTTGTGGAGAGCTGAGGTA-3';

[0090] qRT-SbBA3-R:5'-CCCGCATGTACTTGTCATAGCAT-3'.

[0091] The plants infected in the same culture medium were regarded as one strain, and the expression level was the average value of multiple strains. The expression levels of the gene SbBA3 in strains sbba3-1 and sbba3-2 were significantly lower than those in the control plants, and the two gene transiently silenced strains could be used as cold-tolerant phenotype identification materials ( Figure 7 ).

[0092] 3. Identification of cold tolerance of SbBA3 sorghum

[0093] Artificial climate chamber cold resistance identification method ( Figure 1 The wild-type sorghum Z-5 and the SbBA3 sorghum silenced lines sbba3-1 and sbba3-2 were transferred to an artificial climate chamber at 4°C for 7 days, with 24 plants of each material being treated.

[0094] After the stress ended, the test materials were transferred to room temperature to resume sorghum growth. After one week, the survival rate of seedlings was observed and counted.

[0095] Survival rate = number of survivors after treatment / total number × 100%

[0096] The statistical results of seedling survival rate and related cold tolerance indexes are as follows Figure 7 As shown in Figure 2, under low temperature stress, the survival rate and chlorophyll content of the seedlings of the silent lines (sbba3-1 and sbba3-2) were significantly higher than those of the control plants (WT). Figure 8 As shown, through overexpression in rice, it was found that the seedling survival rate and chlorophyll content of the heterologous rice overexpression lines (OE1, OE3) under low temperature stress were significantly lower than those of the control plants (Nip), and there was no significant difference in the above results at normal temperature.

[0097] Figure 8 These are the results of measuring gene expression levels, seedling survival rates and related cold tolerance indices of the SbBA3 heterologous overexpressing plants and control plants after cold treatment in Example 2 of the present invention. Figure 7 Figures a, b, c, and d are statistical graphs of phenotype, gene expression, seedling survival rate, and chlorophyll content, respectively. Different lowercase letters in the figure indicate that there are significant differences in the fruiting rate of different varieties.

[0098] The above results indicate that low temperature encountered at the seedling stage may affect physiological indicators such as chlorophyll content, and ultimately affect the survival rate of sorghum. Under low temperature stress, the survival rates of sorghum and rice seedlings were negatively correlated with the expression level of the SbBA3 gene, indicating that the SbBA3 gene has the function of negatively regulating the tolerance of sorghum seedlings. By reducing its expression, the tolerance of sorghum to low temperature stress can be improved under low temperature stress.

[0099] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A sorghum seedling cold tolerance-related protein SbBA3, characterized in that: The SbBA3 protein is the following protein A1), A2) or A3): A1) the amino acid sequence is the protein of SEQ ID No. 1 in the sequence list; A2) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the protein of A1) and having 75% or more identity with the protein of A1) and having activity of regulating cold tolerance at the seedling stage of sorghum; A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of A1) or A2).

2. The sorghum seedling cold tolerance-related protein SbBA3 according to claim 1, characterized in that: The SbBA3 protein is derived from sorghum.

3. The sorghum seedling cold tolerance-related protein SbBA3 according to claim 1, characterized in that: The gene is a cDNA molecule or a DNA molecule whose coding sequence of the coding chain is SEQ ID No.

2.

4. The sorghum seedling cold tolerance-related protein SbBA3 according to claim 1, characterized in that: The substance that regulates gene expression is any one of the following F1, F2 or F3: F1, sgRNA, siRNA, shRNA, miRNA or antisense RNA targeting the gene; F2, a DNA molecule that produces an sgRNA targeting the gene, a DNA molecule that produces an siRNA targeting the gene, a DNA molecule that produces an shRNA targeting the gene, a DNA molecule that produces an miRNA targeting the gene, or a DNA molecule that produces an antisense RNA targeting the gene; F3. an expression vector that produces an sgRNA targeting the gene, an expression vector that produces an siRNA targeting the gene, an expression vector that produces an shRNA targeting the gene, an expression vector that produces an miRNA targeting the gene, or an expression vector that produces an antisense RNA targeting the gene.

5. Use of the sorghum seedling cold tolerance-related protein SbBA3 according to any one of claims 1 to 4 in an agent for improving the cold tolerance of sorghum seedlings, characterized in that: The active ingredient of the reagent is the substance for regulating gene expression as described in any one of claims 1-4.

6. The use of the sorghum seedling cold tolerance-related protein SbBA3 according to claim 5, characterized in that: The method comprises the following steps: inhibiting the expression of the SbBA3 protein described in claim 1 in a recipient sorghum, reducing the abundance of the SbBA3 protein described in claim 1, and / or silencing the gene of the SbBA3 protein described in claim 1, so as to obtain the target sorghum having higher cold tolerance at the seedling stage than that of the recipient sorghum.

7. The use of the sorghum seedling cold tolerance-related protein SbBA3 according to claim 5, characterized in that: The method of increasing the expression of the SbBA3 protein described in claim 1 in the recipient sorghum, increasing the abundance of the SbBA3 protein described in claim 1, and / or silencing the gene of the SbBA3 protein described in claim 1 is achieved through a VIGS system, wherein the VIGS system includes expression plasmids containing pTRV2 and pTRV2-SbBA3, and the VIGS target sequence may be positions 575-990 of SEQ ID No. 2 in the sequence list.

8. The biological material related to the cold tolerance-related protein SbBA3 in sorghum seedling stage according to claim 7, characterized in that: The biological material is any one of the following B1) to B5): B1) a nucleic acid molecule encoding the protein according to claim 1; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5) A transgenic plant cell line, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant cell line, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the expression cassette described in B2).

Images