Rice HDA19 gene and application thereof in controlling occipital development and leaf included angle

Abstract

The invention discloses a rice HDA19 gene and application thereof in controlling occipital development and leaf included angle. The gene sequence is shown as a sequence table SEQ ID No: 1, and the protein sequence is shown as a sequence table SEQ ID No: 2. It is identified for the first time that HDA19 gene expression can obviously control rice leaf pillow development and leaf included angle size, rice HDA19 protein mutation enables the leaf pillow length to be increased, cells to be increased and the leaf included angle to be increased, and rice HDA19 protein overexpression enables the leaf pillow length to be shortened, the cells to be reduced and the leaf included angle to be reduced. The protein and the coding gene thereof have important theoretical and practical significance for improving the close planting property of plants and the yield of crops, can play an important role in genetic breeding of crops, and have wide application prospects.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and in particular relates to a rice HDA19 gene and an application thereof in controlling pulvinus development and leaf angle size. Background Art

[0002] Rice (Oryza sativa) is one of the world's major food crops, and nearly half of the world's population relies on rice as their main food source. China is not only a major producer of rice, but also one of its consumers. With the continuous growth of population and the decreasing cultivated land area, increasing grain yield per unit area has become a key issue that needs to be addressed. The country has made significant progress in science and technology and material investment, which has provided support for the research and development of excellent rice varieties. At the same time, by reasonably controlling the row spacing and plant spacing, and making full use of limited land resources, reasonable dense planting can be achieved in different ecological environments, thereby increasing the leaf area index and significantly increasing rice yield.

[0003] Leaf shape directly affects the efficiency of photosynthesis and the efficiency of light energy utilization, so the growth and yield of rice are closely related to its morphological characteristics. The leaf shape of a plant not only determines its plant shape, but also affects the yield of the crop to a certain extent. The leaf angle is an important factor affecting the leaf shape. The leaf angle refers to the inclination angle between the leaf blade and the stem or the degree of curvature between the leaf blade and the leaf sheath. This agronomic trait has an important influence on the plant configuration and grain yield. The upright leaf morphology can enhance the light capture capacity of photosynthesis, while increasing the planting density, thereby increasing the leaf area index. These factors jointly promote the increase in rice yield. Therefore, optimizing the leaf shape characteristics of rice will provide an effective way to achieve high-yield goals. Summary of the invention

[0004] The purpose of the present invention is to provide a HDA19 gene and its application in controlling the development of rice pulvinus and the size of leaf angle.

[0005] Rice HDA19 gene, wherein the polynucleotide of the HDA19 gene is as shown in (a), (b), (c) or (d):

[0006] (a) a polynucleotide as shown in SEQ ID No: 1 in the sequence listing; or

[0007] (b) a polynucleotide that can hybridize with the complementary sequence of SEQ ID No: 1 under stringent hybridization conditions, wherein the protein encoded by the polynucleotide still has the function of controlling pulvinus development and leaf angle;

[0008] (c) a polynucleotide having at least 90% homology with the polynucleotide shown in SEQ ID No: 1; or

[0009] (d) A polynucleotide mutant obtained by deleting, substituting or inserting one or more bases based on the polynucleotide shown in SEQ ID No: 1, and the protein encoded by the polynucleotide mutant still has the function of controlling pulvinus development and leaf angle.

[0010] Rice HDA19 protein, the amino acid sequence of the HDA19 protein is as shown in (a), (b) or (c):

[0011] (a) the amino acid sequence shown in SEQ ID No: 2 in the sequence listing; or

[0012] (b) an amino acid having at least 90% homology with the amino acid shown in SEQ ID No: 2; or

[0013] (c) A protein mutant obtained by deleting, substituting or inserting one or more amino acids on the basis of the protein shown in SEQ ID No: 2, and the protein still has the function of controlling pulvinus development and leaf angle.

[0014] A vector containing the rice HDA19 gene.

[0015] An engineered bacterium containing the rice HDA19 gene vector.

[0016] Primers for amplifying any fragment of the rice HDA19 gene.

[0017] The rice HDA19 gene is used in controlling the development of rice pulvinus and the size of leaf angle.

[0018] A method for increasing the angle of rice leaves and reducing the expression level of HDA19 protein in rice.

[0019] A method for reducing the angle of rice leaves and increasing the expression level of HDA19 protein in rice.

[0020] Beneficial effects of the present invention: The present invention identifies for the first time that the expression of the HDA19 gene can significantly control the development of rice pulvinus and the size of the leaf angle. The mutation of the rice HDA19 protein increases the length of the pulvinus, enlarges the cells, and increases the leaf angle. The overexpression of the rice HDA19 protein shortens the length of the pulvinus, reduces the cells, and reduces the leaf angle. The protein of the present invention and its encoding gene have important theoretical and practical significance for improving the dense planting of plants and crop yields, and will play an important role in crop genetic breeding, with broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It was obtained from the rice HDA19 gene silenced strain;

[0022] In the figure, a is the HDA19 gene silencing site; b is the change in expression level before and after HDA19 gene silencing.

[0023] Figure 2 is the expression level of HDA19 in the overexpression strain.

[0024] Figure 3 The whole plant phenotypes of rice mutants and overexpression plants.

[0025] Figure 4 is the leaf angle of rice mutant and overexpression plants;

[0026] In the figure, a is phenotype; b is data statistics.

[0027] Figure 5 The dorsal pulvinus phenotypes of rice mutants and overexpressing plants.

[0028] Figure 6 The dorsal length of the occipital was measured.

[0029] Figure 7 Longitudinal section of the dorsal occipital lobe (a) and cell length analysis (b). DETAILED DESCRIPTION

[0030] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0031] Example 1 Obtaining Rice HDA19 Gene Silencing Line

[0032] The 339-540 bp and 651-667 bp of the gene HDA19 (Os06g38470) sequence were selected as gene silencing sites (e.g. Figure 1 a) Design primers with specific restriction sites for PCR amplification of the sense and antisense strands, HDA19-RNAi-F1(KpnI):

[0033] CGGGGTACCCCCCGTCTTCGACGGCCTCTA (SEQ ID No: 3), HDA19-RNAi-R1 (XbaI): TGCTCTAGACCTCCTCCACACCATCCCCATG (SEQ ID No: 4), HDA19-RNAi-F2 (PstI):

[0034] AAACTGCAGCCCCGTCTTCGACGGCCTCTA (SEQ ID No: 5), HDA19-RNAi-R2 (XbaI): TGCTCTAGACTGGTGGTATTTGAGGAGCTCGAG (SEQ ID No: 6), for specific experimental steps, refer to Baulcombe, D (Baulcombe, D. RNA silencing in plants. Nature 431, 356-363 (2004).). The constructed vector was transformed into Nipponbare (commissioned by the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences) by Agrobacterium-mediated transgenic method to obtain three independent HDA19 gene silencing lines, and the gene silencing effect was evaluated by qRT-PCR, with primers Intron-130-F: GTTCTCTCGCGCTGGAGAGC (SEQ ID No: 7), Intron-130-R: CCACACCATCCCCATGGTG (SEQ ID No: 8), as shown in Figure 1 b, The expression level of HDA19 gene in the silenced rice line was significantly lower than that in the wild type.

[0035] Example 2 Obtaining HDA19 Overexpression Materials

[0036] Using Nipponbare as the background material, the CDS sequence of HDA19 was cloned by PCR amplification technology, and was connected to the pCAMBIA1300 vector by restriction digestion and ligation. The restriction sites were KpnI and SalI, and the primers used were HDA19-CDS-F: CGGGGTACCATGGACGCCTCCGCCGGA (SEQ ID No: 9), HDA19-CDS-R: CGCGTCGACTTATGTCTTCTGGTGCACCGATG (SEQ ID No: 10). After the sequencing was correct, the transgenic plants were obtained by Agrobacterium EHA105-mediated transgenic method (commissioned to the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences), and the rice lines identified as positive and with high gene expression were named HDA19-OE-1, HDA19-OE-2 and HDA19-OE-3. The HDA19-OE lines used in this example were all transgenic homozygous lines. After 14 days of pot culture, RNA from the aerial part of the HDA19 gene-silenced rice was extracted and reversed, and the expression level of HDA19 was detected using primers ACTIN-qRT-F: TGACGGAGCGTGGTTACTCAT (SEQ ID No: 11), ACTIN-qRT-R: GCAATGCCAGGGAACATAGTG (SEQ ID No: 12), HDA19-qRT-F: AGAACACCAAGGGCACAGAA (SEQ ID No: 13), and HDA19-qRT-R: AGGGAGCCTGGTTCGTCTAT (SEQ ID No: 14). Figure 2 The results showed that the expression level of HDA19 in the overexpression plants was significantly higher than that in the wild type, among which the relative expression level of HDA19 gene in HDA19-OE-1 was the highest.

[0037] Example 3 Phenotypic Identification of Rice Mutants and Overexpression Materials

[0038] The rice HDA19 gene silenced mutant and overexpression plants were cultured in pots for 50 days and their phenotypes were observed. Figure 3 . Randomly select individual rice plants of various types and take photos ( Figure 4 a), with the pulvinus as the intersection point, the sheath and the leaf blade as one edge each ( Figure 4 a white dotted line), and the angle of the fourth leaf at the top of the main tiller was measured and statistically analyzed using ImageJ software ( Figure 4 b) It was found that HDA19 mutant materials showed a significant increase in leaf angle phenotype compared with the wild type, while materials overexpressing this gene showed a significant decrease in leaf angle phenotype, indicating that HDA19 can change the leaf angle of rice.

[0039] Example 4 Observation of pulvinus development in rice mutants and overexpression materials

[0040] The pulvinus was cut off from the rice seedlings, and the dorsal length of the pulvinus was observed and measured under a microscope ( Figure 5 The analysis results are as follows: Figure 6 The pulvinus length of the mutant was significantly longer than that of the wild type, and the pulvinus length of the overexpressing plant was significantly shorter than that of the wild type. The longitudinal sections of the pulvinus were made and the cell morphology was observed under an ultraviolet microscope ( Figure 7 a), use the software that comes with the microscope to measure the cell length and analyze it ( Figure 7 b), it was found that the mutant cells were larger than the wild type, while the overexpression strain had an increased number of cells, smaller cells, and more densely arranged cells compared to the wild type.

[0041] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A rice HDA19 gene, characterized in that: The polynucleotide of the HDA19 gene is shown in (a), (b), (c) or (d): (a) a polynucleotide as shown in SEQ ID No: 1 in the sequence listing; or (b) a polynucleotide that can hybridize with the complementary sequence of SEQ ID No: 1 under stringent hybridization conditions, wherein the protein encoded by the polynucleotide still has the function of controlling pulvinus development and leaf angle; (c) a polynucleotide having at least 90% homology with the polynucleotide shown in SEQ ID No: 1; or (d) A polynucleotide mutant obtained by deleting, substituting or inserting one or more bases based on the polynucleotide shown in SEQ ID No: 1, and the protein encoded by the polynucleotide mutant still has the function of controlling pulvinus development and leaf angle.

2. Rice HDA19 protein, characterized in that The amino acid sequence of the HDA19 protein is shown in (a), (b) or (c): (a) the amino acid sequence shown in SEQ ID No: 2 in the sequence listing; or (b) an amino acid having at least 90% homology with the amino acid shown in SEQ ID No: 2; or (c) A protein mutant obtained by deleting, substituting or inserting one or more amino acids on the basis of the protein shown in SEQ ID No: 2, and the protein still has the function of controlling pulvinus development and leaf angle.

3. A vector containing the rice HDA19 gene according to claim 1.

4. An engineered bacterium containing the rice HDA19 gene vector according to claim 3.

5. Primers for amplifying any fragment of the rice HDA19 gene according to claim 1.

6. Use of the rice HDA19 gene according to claim 1 in controlling the development of rice pulvinus and the size of leaf angle.

7. A method for increasing the angle of rice leaves, characterized in that: Reduce the expression level of HDA19 protein in rice.

8. A method for reducing the angle of rice leaves, characterized in that: Improve the expression level of HDA19 protein in rice.

Images