Application of arabidopsis thaliana atpB gene in improvement of plant stress resistance

Abstract

The invention relates to application of an arabidopsis thaliana atpB gene in improvement of plant stress resistance, and belongs to the technical field of plant genetic engineering breeding. In order to provide more stress-resistant genes which can be applied to a transgenic technology to improve the stress resistance of plants, the invention provides application of an arabidopsis thaliana atpB gene in improving the stress resistance of the plants, and particularly relates to application of the arabidopsis thaliana atpB gene in improving the drought tolerance and / or salt tolerance of the plants. Comprising the following steps: constructing a plant overexpression vector containing an arabidopsis thaliana atpB gene, and transforming the plant overexpression vector into a plant to cultivate a drought-tolerant and / or salt-tolerant transgenic plant. The arabidopsis thaliana atpB gene is proved to be capable of responding to drought and salt stress, phenotypes of arabidopsis thaliana atpB overexpressed plants subjected to drought and salt stress treatment in a seedling stage are observed, and results show that the arabidopsis thaliana atpB gene can obviously improve drought tolerance and salt tolerance of transgenic plants; the gene is an excellent gene for drought-resistant and / or salt-resistant genetic engineering breeding of plants.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering breeding, and in particular relates to the application of Arabidopsis thaliana atpB gene in improving plant stress resistance. Background Art

[0002] Plant stress resistance refers to the ability of plants to resist, adapt and endure various environmental factors that are unfavorable to their growth and survival. This ability allows plants to maintain their growth and reproduction in adversity. In agricultural and forestry production, the use of plant stress resistance can improve crop yield and quality. By breeding crop varieties with excellent stress resistance, the impact of adversity on crop growth can be reduced and the stress resistance and adaptability of crops can be improved.

[0003] Genetic improvement is a common method to improve plant stress resistance, including screening stress-resistant varieties for hybrid breeding and using genetic engineering technology to introduce stress-resistant genes into plants, so that crops have stronger stress resistance. For example, introducing salt-alkali tolerance genes into crops through transgenic technology can significantly improve the salt-alkali tolerance of crops. Stress-resistant genes can come from natural stress-resistant plants and microorganisms, or they can be genes for proteins produced by plants to protect cells in adversity. There are many stress-resistant genes in plants and they are widely distributed, which makes the screening of stress-resistant genes extremely complicated. Different stress-resistant genes may have different functions and mechanisms of action, which also increases the difficulty of screening and identifying stress-resistant genes.

[0004] Chloroplast ATP synthase is closely related to plant energy metabolism and plays an important role in the interaction between plants and the external environment. In the energy metabolism of plants, ATP synthase a subunit-atpA and β subunit-atpB play a vital role. AtpB plays a core role in regulating the activity of ATP synthase and its interaction with reaction substrates. Previous studies have found that the Arabidopsis atpB gene has the ability to resist Pseudomonas syringae-Pst.DC3000. However, the antibacterial function and stress resistance of plants are relatively independent in biology. They are different adaptation mechanisms developed for different external pressures and challenges, and their objects and principles of action are different. Therefore, based on the antibacterial function of the Arabidopsis atpB gene, it is impossible to infer other functions of the gene, and the stress resistance function of the Arabidopsis atpB gene has not been reported. Summary of the invention

[0005] In order to provide more stress-resistant genes that can be applied to transgenic technology to improve plant stress resistance, the present invention provides the use of Arabidopsis thaliana atpB gene in improving plant stress resistance.

[0006] The technical solution of the present invention:

[0007] Application of Arabidopsis atpB gene in improving plant stress resistance.

[0008] Furthermore, the nucleotide sequence of the Arabidopsis thaliana atpB gene is shown in SEQ ID No: 1.

[0009] Furthermore, the application is the application of Arabidopsis thaliana atpB gene in improving plant drought tolerance and / or salt tolerance.

[0010] Furthermore, the application includes constructing a plant overexpression vector containing the Arabidopsis atpB gene, transforming the constructed plant overexpression vector into plants, and cultivating drought-resistant and / or salt-resistant transgenic plants.

[0011] Furthermore, the plant is a woody plant or a herbaceous plant.

[0012] Furthermore, the woody plant is Arabidopsis thaliana.

[0013] A plant overexpression vector containing the Arabidopsis thaliana atpB gene.

[0014] A recombinant genetic engineering bacterium containing the plant overexpression vector.

[0015] Furthermore, a plant overexpression vector containing the Arabidopsis atpB gene is introduced into Escherichia coli or Agrobacterium to construct the vector.

[0016] Beneficial effects of the present invention:

[0017] The present invention confirms that the Arabidopsis atpB gene can respond to drought and salt stress, and observes the seedling phenotypes of Col-0, atpB-OE, atpb and atpBpro:atpB plants after drought and salt stress treatment. Compared with Col-0 and atpBpro:atpB, atpB-OE and atpb have higher germination rate, green leaf rate and root length elongation phenotype. The seedling phenotype and related physiological indicators are detected, and the results show that atpB-OE improves the active oxygen scavenging ability of the plant, accumulates higher chlorophyll content and lower MDA content to resist drought and salt stress. This shows that the Arabidopsis atpB gene can significantly improve the drought and salt tolerance of transgenic plants, and is an excellent gene for plant drought and / or salt tolerance genetic engineering breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a comparison diagram of the expression of the Arabidopsis atpB gene under different drought stress times in Example 2;

[0019] Figure 2 This is a comparison diagram of the expression of the Arabidopsis thaliana atpB gene under different salt stress times in Example 2;

[0020] Figure 3 The following are comparison photos of seed germination phenotypes of Col-0, atpB-OE, atpb and atpBpro:atpB plants grown on culture media with different mannitol concentrations in Example 3;

[0021] Figure 4 and Figure 5 They are comparison diagrams of germination rate and green leaf rate of Col-0, atpB-OE, atpb and atpBpro:atpB plants grown on medium with different mannitol concentrations for 10 days in Example 3;

[0022] Figure 6 The following are photos of the root growth phenotypes of Col-0, atpB-OE, atpb and atpBpro:atpB plants in Example 4 grown on culture media with different mannitol concentrations;

[0023] Figure 7 This is a comparison chart of the root growth coefficients of Col-0, atpB-OE, atpb and atpBpro:atpB plants in Example 4 on culture media with different mannitol concentrations;

[0024] Figure 8 The phenotypic photos of Col-0, atpB-OE, atpb and atpBpro:atpB plants in Example 5 before and after drought treatment, and the value corresponding to each plant in the figure is the soil moisture content value;

[0025] Fig. 9 This is a comparison chart of chlorophyll a content, chlorophyll b content and total chlorophyll content of Col-0, atpB-OE, atpb and atpBpro:atpB plants before and after drought treatment in Example 5;

[0026] Fig.10 This is a comparison of the MDA content of Col-0, atpB-OE, atpb and atpBpro:atpB plants before and after drought treatment in Example 5;

[0027] Fig.11 The following are comparison photos of seed germination phenotypes of Col-0, atpB-OE, atpb and atpBpro:atpB plants grown on culture media with different NaCl concentrations in Example 6;

[0028] Fig.12 and Fig.13 They are comparison diagrams of germination rate and green leaf rate of Col-0, atpB-OE, atpb and atpBpro:atpB plants grown on medium with different NaCl concentrations for 10 days in Example 6;

[0029] Fig.14The following are photos of the root growth phenotypes of Col-0, atpB-OE, atpb and atpBpro:atpB plants grown on culture media with different NaCl concentrations in Example 7;

[0030] Fig.15 This is a comparison chart of the root growth coefficients of Col-0, atpB-OE, atpb and atpBpro:atpB plants in different NaCl concentration media in Example 7;

[0031] Fig.16 The phenotypic photos of Col-0, atpB-OE, atpb and atpBpro:atpB plants before and after salt stress treatment in Example 8;

[0032] Fig.17 These are typical pictures of NBT, DAB and trypan blue staining of Col-0, atpB-OE, atpb and atpBpro:atpB plants before and after salt stress treatment in Example 8;

[0033] Fig.18 This is a comparison chart of the chlorophyll a content, chlorophyll b content and total chlorophyll content of Col-0, atpB-OE, atpb and atpBpro:atpB plants before and after salt stress treatment in Example 8;

[0034] Fig.19 This is a comparison chart of the MDA content of Col-0, atpB-OE, atpb and atpBpro:atpB plants in Example 8 before and after salt stress treatment. DETAILED DESCRIPTION

[0035] The technical solution of the present invention is further described below in conjunction with the embodiments, but it is not limited thereto. Any modification or equivalent replacement of the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention shall be included in the protection scope of the present invention. The process equipment or devices not specifically noted in the following embodiments are all conventional equipment or devices in the art. If not specifically specified, the raw materials used in the embodiments of the present invention can be obtained commercially; if not specifically specified, the technical means used in the embodiments of the present invention are all conventional means well known to those skilled in the art.

[0036] Example 1

[0037] This example provides a method for preparing atpB-OE Arabidopsis thaliana overexpressing the atpB gene and a method for preparing atpBpro:atpB complemented plants of Arabidopsis thaliana atpb with atpB gene mutation.

[0038] Plant materials used in this example:

[0039] The wild-type Arabidopsis Col-0 is the Arabidopsis ihaliana with Columbia background. The Arabidopsis atpB gene T-DNA insertion mutant is numbered SALK 004946C. Arabidopsis mutant seeds were purchased from the ABRC website. The culture conditions were 23°C, 16 h light, and 8 h dark.

[0040] The strains and vectors used in this example are:

[0041] (1) Escherichia coli DH5α and Agrobacterium tumefaciens GV3101 (pSoup-P19) were purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0042] (2) The preparation method of the vector pSuper1300-Myc is as follows: a 35S promoter is added before the 5' end of the multiple cloning site sequence of the commercially available pCAMBIA1300 vector, and a Myc tag is added after the 3' end of the multiple cloning site sequence, namely the vector pSuper1300-Myc.

[0043] 1. The construction method of the Arabidopsis thaliana atpB gene overexpression vector and the recombinant genetic engineering bacteria containing the Arabidopsis thaliana atpB gene in this embodiment:

[0044] 1. Plant RNA extraction method:

[0045] The Arabidopsis leaves (0.5-1g) were placed in a 1.5mL microcentrifuge tube without RNAse, and small steel balls were placed in the tube. After being quickly frozen in liquid nitrogen, they were ground and crushed with a tissue crusher. 1mL TransZolUP was added to the centrifuge tube after the plant sample was ground, and the tube was vortexed into a homogenate using a homogenizer and then shaken at room temperature for 5min. Then 200μL of pre-cooled chloroform was added, vortexed and mixed, incubated at room temperature for 3min, and centrifuged at 10,000×g at 2-8℃ for 15min. After centrifugation, the upper colorless aqueous phase was transferred to a new 1.5mL microcentrifuge tube, and 500mL of pre-cooled isopropanol was added, inverted and mixed, and then allowed to stand for 10min. Centrifuged at 10,000×g at 2-8℃ for 10min, and the supernatant was removed. 1mL 75% ethanol (750μL anhydrous ethanol + 250μL DEPC water) was added, vortexed, and centrifuged at 7,500×g at 2-8℃ for 5min. Remove the supernatant, dry the precipitate at room temperature, add 50-100 μL RNA Dissolving Solution, incubate at 55-60°C for 10 min, and store at -70°C.

[0046] 2. Reverse transcription into cDNA

[0047] The total plant RNA was reverse transcribed into cDNA using the SPARKscriptⅡAll-in-one RT SuperMix for qPCR kit. All operations were performed on ice using enzyme-free microcentrifuge tubes and pipette tips. Specifically:

[0048] Add the components in Table 1 to the centrifuge tube in sequence, mix well and centrifuge briefly, then incubate at 50° for 15 min or 80°C for 5 sec. The product is divided and stored at -20°C.

[0049] Table 1

[0050]

[0051]

[0052] 3. Gene cloning

[0053] The Arabidopsis gene used in the experiment was cloned using wild-type Arabidopsis thaliana (Co1-0) cDNA as a template according to the PCR reaction system and reaction procedure shown in Tables 2 and 3.

[0054] Table 2

[0055]

[0056] Table 3

[0057]

[0058] The primer sequences used in this example are as follows:

[0059] Forward Primer: TGCTCTAGAATGAGAACAAATCCTACTACTT

[0060] Reserve Primer: CGGGGTACCTTTCTTCAATTTACTCTCCATTT

[0061] The sequence of the Arabidopsis thaliana atpB gene obtained in this example is as follows:

[0062] Serial number: ATCG00480.1

[0063] CDS Sequence(1497)

[0064]

[0065] 4.PCR product gel recovery (purification)

[0066] This test uses the Kangwei Century Gel Extraction Kit, specifically:

[0067] Cut the DNA band and put it into a microcentrifuge tube. After weighing, add an equal volume of Buffer PG and sol in a 50℃ water bath. During this period, gently turn the centrifuge tube upside down every 2-3 minutes. After cooling to room temperature, put it on the column. After the column is balanced, add 200μL Buffer PS to the adsorption column, 13,000rpm, 1min, and discard the waste liquid. Add the solution obtained in step 2 to the adsorption column, let it stand at room temperature for 2min, 13,000rpm, 1min, discard the waste liquid, add 450μL Buffer PW (containing anhydrous ethanol), 13,000rpm, 1min, and discard the waste liquid. 13,000rpm, empty for 1min, discard the waste liquid, and repeat the steps and centrifuge once. Put the adsorption column into a new 1.5ml microcentrifuge tube, add 50-100μL ddH2O (preheated in a 50℃ water bath) to the middle of the adsorption membrane in mid-air, let it stand at room temperature for 2min. 12,000rpm, 2min, store at -20℃.

[0068] 5. Double enzyme digestion

[0069] The purified product of the target gene was double-digested, and the components in Table 4 were added to a microcentrifuge tube in sequence. After gentle mixing, it was incubated at 37°C for 30 minutes. After adding 10× DNA Loading Buffer, agarose gel electrophoresis was performed again to recover the DNA.

[0070] Table 4

[0071]

[0072] The vector double enzyme digestion reaction system is shown in Table 5. After gentle mixing, the reaction was incubated at 37°C for 30 min, inactivated at 65°C for 20 min, and terminated.

[0073] Table 5

[0074]

[0075] 6. Recombinant plasmid ligation

[0076] Proceed according to the recombinant plasmid ligation system shown in Table 6, at 16°C for 1-3 h or at 4°C overnight.

[0077] Table 6

[0078]

[0079] 7. Heat shock transformation of E. coli

[0080] Remove the DH5α competent medium from -80℃ and melt it on ice; aspirate 10μL of the ligation product and add it to the competent medium, mix gently, and keep it on ice for 25min. Heat shock in a 42℃ water bath for 45s, remove the competent medium, and place it on ice for 2min. Add 700μL of LB medium without antibiotics, and culture at 37℃, 200rpm for 1h. Centrifuge at 6,000rpm for 1min. Pour off the supernatant and apply the remaining 100μL of bacterial solution on the corresponding culture medium after mixing by pipetting, and culture at 37℃ for 12-24h.

[0081] 2. Arabidopsis transformation method of this example

[0082] 1. Plasmid mini-prep: This experiment uses the EasyPure HiPure PlasmidMiniPrep Kit. For detailed steps, please refer to the instructions.

[0083] 2. Freeze-thaw transformation of Agrobacterium

[0084] Take out the GV3101 (pSoup-P19) competent state from the ultra-low temperature refrigerator, melt it at room temperature and insert it on ice; add 0.01-1μg pSuper1300-atpB-MYC plasmid to the melted Agrobacterium GV3101 (pSoup-P19) competent state. Stand on ice for 5 minutes, liquid nitrogen for 5 minutes, 37℃ water bath for 5 minutes, ice bath for 5 minutes; add 700μL of resistance-free LB medium to the centrifuge tube, culture at 28℃, 200rpm for 2 hours; centrifuge the centrifuge tube at 6,000rpm for 1 minute to collect the bacteria. Keep about 100μL of supernatant and use a micropipette to gently blow and resuspend the bacteria. Then, evenly spread the bacterial solution on the surface of the LB medium containing antibiotics. Invert and place in a 28℃ incubator for 2-3 days; pick a single colony from the plate and place it in LB liquid medium containing Rif and Kan resistance, culture it at 28℃ shaker at 200rpm for 2-3 days, and take 1μL of bacterial solution for PCR identification. Mix the successfully identified bacterial solution with glycerol and store it in a -80℃ refrigerator.

[0085] 3. Planting of Arabidopsis thaliana

[0086] Select a clean 1.5mL microcentrifuge tube and place the seeds to be sterilized in the 1.5mL centrifuge tube in advance. In the sterile operating table, add 900μL sterile water, 100μL sodium hypochlorite, and 1μL Tween-80 to the centrifuge tube in turn, and shake for 7-8 minutes. In the sterile operating table, wash the sterilized seeds with sterile water 5-6 times until the foam disappears. Use an inoculation loop to evenly spot the sterilized seeds on the 1 / 2MS culture medium and culture them in a light incubator for 1 week. Arabidopsis planting: Mix the seedling soil and vermiculite in a 1:1 ratio, water until the soil is completely moist, and then transplant the Arabidopsis seedlings that have grown to four leaves on the culture medium into the soil, and culture them in the Arabidopsis climate room (22℃, 16h light / 8h dark) for 2d, and continue to culture after removing the film.

[0087] 4. Arabidopsis Transformation

[0088] Using the inflorescence dip method:

[0089] Pick the pSuper1300-atpB-MYC positive colony and expand it in 50 mL LB liquid medium containing 50 mg / L Kan and 25 mg / L R Fif. Incubate overnight at 28°C in a shaker until OD 600 =1.8-2.0, centrifuge at 4,000 rpm, 4°C, 10 min to collect the bacteria. Resuspend the bacteria in sucrose solution (5 g sucrose per 100 mL distilled water + 25 μL Sliweet-77) and dilute the bacterial solution to OD 600 = 0.6-0.8. Carefully place the flower buds of the Arabidopsis plants in the bacterial solution with both hands and soak for about 20 seconds. After the infection is completed, bag and culture in the dark for 24 hours. After 24 hours, punch holes in the bag. Remove the bag after 2 days and culture normally in the Arabidopsis climate room. After one week, infect again using the same method.

[0090] 3. Preparation method of atpBpro:atpB complemented plants of atpB gene mutation Arabidopsis thaliana atpb in this example

[0091] pSuper1300-atpB-Myc was transformed into atpb using the inflorescence dip method to obtain T0 generation atpB complemented seeds, and then the T0 generation seeds were screened in a screening medium (1 / 2MS+50 mg / L hygromycin). The T1 generation positive plants obtained by screening were identified at the DNA level using hygromycin primers, and then the TRIzol method was used to extract atpb and total RNA from leaves of 8 positive plants. The RNA concentration of each sample was adjusted to be consistent, and the corresponding cDNA was obtained as a template through reverse transcription for transcription level identification. The expression level of atpB gene in positive plants was detected, and individual transgenic plants with high expression levels were selected for harvesting. T2 generation seeds were sown on the screening medium, and then the DNA level of T2 plants was detected. Positive plant seeds were collected from individual plants, and more than 30 seeds of the same number of positive plants were inoculated on the screening medium. Plants with green cotyledons and all surviving were transgenic homozygous plants. Two independent homozygous transgenic positive atpBpro:atpB plants were selected for the experiment.

[0092] Example 2

[0093] This example verifies that the Arabidopsis atpB gene can respond to drought and salt stress.

[0094] In this example, wild-type Arabidopsis thaliana Col-0 with consistent growth in the soil was selected and transferred to a nutrient solution containing 1 / 2 Hoagland for 2 days, and then transferred to 1 / 2 Hoagland + 200mM mannitol nutrient solution and 1 / 2 Hoagland + 125mM NaCl nutrient solution for further cultivation, and samples were taken at 0h, 1h, 3h, 6h, 9h, 12h and 24h.

[0095] Arabidopsis RNA was extracted using the TRIzol method, and cDNA was obtained by reverse transcription. RT-qPCR was used to detect the expression of Arabidopsis atpB gene under drought and salt stress at different times. Figure 1 and Figure 2 As shown in the figure, the expression of Arabidopsis atpB gene increased, indicating that it can respond to drought and salt stress.

[0096] Example 3

[0097] This example investigates the seedling phenotypes of wild-type Arabidopsis thaliana Col-0, atpB gene overexpressing Arabidopsis thaliana atpB-OE, atpB gene mutant Arabidopsis thaliana atpb, and complemented plants of atpB gene mutant Arabidopsis thaliana atpBpro:atpB under drought stress.

[0098] Col-0, atpB-OE, atpb and atpBpro:atpB plants were inoculated onto 1 / 2MS, 1 / 2MS+150mM mannitol and 1 / 2MS+175mM mannitol culture media for germination tests, and photos were taken to record the seed germination of the four strains at 3d, 7d and 11d. The germination rate and green leaf rate of each strain after 10d of growth on 1 / 2MS plus different concentrations of mannitol culture medium were investigated and counted.

[0099] Seed germination of the four strains Figure 3-Figure 5 As shown, 6 days after sowing on 1 / 2MS medium, the seeds of the four lines were able to germinate, and the germination rate and green leaf rate of atpB-OE and atpb were not significantly different from those of Col-0 and atpBpro:atpB.

[0100] After sowing on 1 / 2MS+150mM mannitol medium, it was found that on the 5th day, the germination rate of atpb had reached 95%, the germination rate of atpB-OE was 81%, the germination rate of Col-0 was 92%, and the germination rate of atpBpro:atpB was 90%; the green leaf rate of atpb was 80%, the green leaf rate of atpB-OE was 70%, while the green leaf rate of Col-0 was 57%, and the green leaf rate of atpBpro:atpB was 56%. Compared with Col-0 and atpBpro:atpB, the cotyledon growth of atpb and atpB-OE showed a more luxuriant state.

[0101] After sowing on 1 / 2MS+175mM mannitol medium, it was found that on the 8th day, atpB-OE and atpb all germinated, and the germination rates of Col-0 and atpBpro:atpB were both 94%; the green leaf rate of atpb was 56%, the green leaf rate of atpB-OE was 42%, while the green leaf rate of Col-0 was 35%, and the green leaf rate of atpBpro:atpB was 37%. The green leaf rate of atpb was significantly different from that of Col-0, and the overall growth of the cotyledons of Col-0 showed a wilting state.

[0102] The above results indicate that atpb and atpB-OE improve the tolerance of plants to drought stress.

[0103] Example 4

[0104] This example investigates the root length elongation phenotype of wild-type Arabidopsis Col-0, atpB gene overexpressing Arabidopsis atpB-OE, atpB gene mutant Arabidopsis atpb, and atpB gene mutant Arabidopsis atpb complemented plants atpBpro:atpB under drought stress.

[0105] Col-0, atpB-OE, atpb and atpBpro:atpB plants were inoculated on 1 / 2MS medium respectively. Some one-week-old plants with consistent germination were selected and inoculated on 1 / 2MS+175mM mannitol medium for root length detection test. The root length was observed and photographed every day.

[0106] like Figure 6 As shown, in the 1 / 2MS medium without mannitol, the root length growth of the four strains was basically the same. In the 1 / 2MS medium containing 175mM mannitol, compared with atpB-OE and atpb, the root length of Col-0 and atpBpro:atpB was shorter, and the root length growth was inhibited.

[0107] like Figure 7 As shown, by statistically analyzing the elongation of the main root, compared with Col-0 and atpBpro:atpB, with the increase of treatment days, the root length elongation rate of atpB-OE was significantly lower than that of Col-0 and atpBpro:atpB, and the root length elongation rate of atpb was significantly higher than that of Col-0 and atpBpro:atpB. This generally indicates that the mutation of the atpB gene improves the tolerance of Arabidopsis to drought stress.

[0108] Example 5

[0109] This example investigates the phenotypic and physiological index detection of wild-type Arabidopsis Col-0, atpB gene overexpressing Arabidopsis atpB-OE, atpB gene mutant Arabidopsis atpb, and atpB gene mutant Arabidopsis atpb complemented plants atpBpro:atpB under drought stress.

[0110] The Col-0, atpB-OE, atpb and atpBpro:atpB plants that had grown normally at 22°C for 4 weeks were subjected to drought and water deprivation treatments. The morphological changes of the seedlings during the stress period were observed and photographed.

[0111] The chlorophyll content determination method of the present invention is as follows:

[0112] (1) The following steps were performed under weak light. 0.2 g of fresh plant leaves were weighed, the surface was wiped clean, and cut into pieces;

[0113] (2) Place in a microcentrifuge tube, shake and break, add a small amount of 95% ethanol to wash in batches into a 50 mL centrifuge tube, and make up to 50 mL, and mix well;

[0114] (3) Using 95% ethanol as a blank, take 1 mL of the extract and measure the absorbance at wavelengths of 470 nm, 665 nm, and 649 nm;

[0115] Ca=13.95A665 -6.88A 649

[0116] Cb=24.96A 649 -7.32A 665

[0117] Total chlorophyll concentration = Ca + Cb

[0118] Chlorophyll content = (chlorophyll concentration × extract volume × dilution factor) / sample fresh weight

[0119] like Figure 8 As shown, at 20 days, compared with the control group, Col-0 and atpBpro:atpB lost water and wilted, and large areas of leaves turned yellow and fell over, and the same was true for atpB-OE; while atpb plants were still strong and the leaf chlorosis was less severe.

[0120] Chlorophyll content is closely related to photosynthesis, so the chlorophyll a, chlorophyll b and total chlorophyll contents of Col-0, atpB-OE, atpb and atpBpro:atpB plants subjected to drought and water deprivation treatments for 0d and 20d were measured.

[0121] like Fig. 9 As shown in the figure, statistical analysis showed that compared with Col-0 and atpBpro:atpB, the chlorophyll a, chlorophyll b and total chlorophyll contents of atpb and atpB-OE plants were higher than those of Col-0 and atpBpro:atpB, and atpb was more significant, reaching 1.6 times that of Col-0, indicating that atpb has a stronger ability to resist drought stress.

[0122] At the same time, the MDA of Col-0, atpB-OE, atpb and atpBpro:atpB plants were measured at 0d and 20d after drought and water deprivation treatment.

[0123] like Fig.10 As shown, compared with Col-0, the MDA content of atpB-OE was slightly lower than that of Col-0, and the MDA content of atpB was significantly lower than that of Col-0 and atpBpro:atpB was 4.7 times lower than that of Col-0.

[0124] The above results indicate that atpb and atpB-OE reduce the degree of oxidative damage in Arabidopsis thaliana under drought stress and improve the plant's tolerance to drought stress.

[0125] Example 6

[0126] This example investigates the seedling phenotypes of wild-type Arabidopsis thaliana Col-0, atpB gene overexpressing Arabidopsis thaliana atpB-OE, atpB gene mutant Arabidopsis thaliana atpb, and complemented plants of atpB gene mutant Arabidopsis thaliana atpBpro:atpB under salt stress.

[0127] Col-0, atpB-OE, atpb and atpBpro:atpB plants were inoculated onto 1 / 2MS, 1 / 2MS+100mMNaCl and 1 / 2MS+125mMNaCl culture media for germination tests, and photos were taken to record the seed germination of the four strains at 3d, 7d and 11d. The germination rate and green leaf rate of each strain after 10d of growth on 1 / 2MS plus different concentrations of NaCl culture medium were investigated and counted.

[0128] Seed germination of the four strains Figure 11-13 As shown, 6 days after sowing on 1 / 2MS medium, the seeds of the four lines were able to germinate, and the germination rate and green leaf rate of atpB-OE and atpb were not significantly different from those of Col-0 and atpBpro:atpB.

[0129] After sowing on 1 / 2MS+100mMNaCl medium, it was found that on the 5th day, the germination rate of atpb was 97%, the germination rate of atpB-OE was 94%, the germination rate of Col-0 was 81%, and the germination rate of atpBpro:atpB was 84%; on the 7th day, the green leaf rate of atpb reached 95%, the green leaf rate of Col-0 and atpBpro:atpB was 81%, and the green leaf rate of atpB-OE was only 61%. Compared with Col-0, the cotyledon growth of atpb showed a more luxuriant state, while atpB-OE was more wilted.

[0130] After sowing on 1 / 2MS+125mMNaCl medium, it was found that the overall germination rate of the four strains was about 10% lower than that on 1 / 2MS+100mMNaCl medium; at 6 days, the green leaf rate of atpb was 8%, and the green leaf rates of the other three strains were 0, indicating that the atpb mutant caused the tolerance of Arabidopsis thaliana to increase after NaCl treatment.

[0131] Example 7

[0132] This example investigates the root length elongation phenotypes of wild-type Arabidopsis thaliana Col-0, atpB gene overexpressing Arabidopsis thaliana atpB-OE, atpB gene mutant Arabidopsis thaliana atpb, and atpB gene mutant Arabidopsis thaliana atpb complemented plants atpBpro:atpB under salt stress.

[0133] Col-0, atpB-OE, atpb and atpBpro:atpB plants were inoculated on 1 / 2MS medium respectively. Some one-week-old plants with consistent germination were selected and inoculated on 1 / 2MS+100mMNaCl medium for root length detection test. The root length was observed and photographed every day.

[0134] like Fig.14 As shown, in the 1 / 2MS medium without NaCl, the root length growth of the four strains was basically the same. In the 1 / 2MS medium containing 100mMNaCl, compared with atpB-OE and atpb, the root length of Col-0 and atpBpro:atpB was shorter, and the root length growth was inhibited.

[0135] like Fig.15 As shown in the figure, by statistically analyzing the elongation of the main root, compared with Col-0 and atpBpro:atpB, as the treatment days increased, the root elongation rate of atpB-OE was slightly higher than that of Col-0 and atpBpro:atpB, and the root elongation rate of atpb was significantly higher than that of Col-0 and atpBpro:atpB. This generally shows that both atpB-OE and atpb can improve the tolerance of plants to salt stress.

[0136] Example 8

[0137] This example investigates the phenotypic and physiological index detection of wild-type Arabidopsis thaliana Col-0, atpB gene overexpressing Arabidopsis thaliana atpB-OE, atpB gene mutant Arabidopsis thaliana atpb, and atpB gene mutant Arabidopsis thaliana atpb complemented plants atpBpro:atpB under salt stress.

[0138] The Col-0, atpB-OE, atpb and atpBpro:atpB potted seedlings that had grown normally at 22°C for 4 weeks were watered with 150 mM NaCl for five days, and photos were taken to record the morphological differences of the four strains.

[0139] like Fig.16 As shown, compared with the control group at 0d, at 5d, Col-0 and atpBpro:atpB turned yellow and wilted, and the plants fell over, and the same was true for atpB-OE; while atpb plants were still strong and the leaf chlorosis was less severe.

[0140] In order to verify whether atpB-OE and atpb can remove hydrogen peroxide (H2O2) and superoxide anions (O2-·) in the body through the ROS pathway, the untreated and treated Arabidopsis were stained with nitrogen blue tetrazolium chloride (NBT), DAB and trypan blue to observe the H2O2 accumulation in leaf cells and the severity of cell death.

[0141] The NBT dyeing method is as follows:

[0142] Prepare nitro blue tetrazolium (NBT) staining solution, wash fresh leaves with distilled water, absorb the surface moisture and soak them in the staining solution, and store them in the dark at room temperature for more than 8 hours; then use anhydrous ethanol to soak the leaves for decolorization, and observe and photograph the staining results with a stereo microscope (IMAGEVIEW).

[0143] The DAB staining method of the present invention is:

[0144] Prepare 1mg / mL DAB (50mM Tris-AcOH, pH 5.0) solution, cut the leaves and put them into a centrifuge tube, add DAB solution until the sample is submerged, soak at room temperature in the dark for 8-12 hours, pour out the staining solution, put it into a decolorizing solution with a volume ratio of acetic acid: glycerol: ethanol of 1:1:3, and decolorize it in a water bath until the green color of the leaves disappears. After the leaves are fixed and decolorized with 60% glycerol, observe and take pictures under a microscope, and cells with hydrogen peroxide accumulation will be stained as brown spots.

[0145] The trypan blue staining method of the present invention is:

[0146] Prepare trypan blue dye solution. Trypan blue dye solution needs to be prepared before use. Cut the leaves and put them into a centrifuge tube. Add trypan blue dye solution until the sample is submerged. Boil in boiling water for 2 minutes and let stand at room temperature overnight. Pour out the dye solution and decolorize with 2.5g / mL chloral hydrate. After decolorization, fix the leaves with 60% glycerol. Under a microscope, you can see that dead cells will be stained blue.

[0147] The method for determining the MDA content in the present invention is:

[0148] Weigh 0.2g of plant tissue, cut it into pieces and put it into a centrifuge tube, freeze it quickly with liquid nitrogen, and grind the sample with a tissue shaker; add 1.6mL 10% TCA (1g powder + 10mL deionized water) into the centrifuge tube, vortex and shake for 1min; 12,000rpm, 10min; aspirate 700μL supernatant, add 700μL 0.67% TBA (0.67g thiobarbituric acid + 1mol / L NaOH to dissolve, 10% TCA to 100mL), mix well, and boil in water bath for 15min; use 700μL deionized water + 700μL 0.67% TBA as a blank control, and measure the absorbance at wavelengths of 450nm, 532nm and 600nm after cooling.

[0149] MDA concentration C (umol / L) = 6.45 (A 532 -A 600 )-0.56A 450

[0150] MDA content (umol / g Fw) = C × V / W

[0151] V: Extraction volume, 1.6 mL W: Sample fresh weight, 0.2 g

[0152] like Fig.17 As shown, compared with Col-0 and atpBpro:atpB, atpb has fewer dark blue and dark brown areas, indicating that it accumulates fewer dead cells and ROS and has a stronger reactive oxygen scavenging ability. atpB-OE contains more dark blue and dark brown areas and has a lower antioxidant capacity, indicating that the atpb mutant reduces the degree of oxidative damage in Arabidopsis and improves the plant's tolerance to salt.

[0153] The chlorophyll a, chlorophyll b and total chlorophyll contents of Col-0, atpB-OE, atpb and atpBpro:atpB plants were measured at 0d and 5d after NaCl stress treatment.

[0154] like Fig.18 As shown in the figure, statistical analysis showed that compared with Col-0 and atpBpro:atpB, the chlorophyll a, chlorophyll b and total chlorophyll contents of atpb and atpB-OE plants were higher than those of Col-0 and atpBpro:atpB, and atpb was more significant, reaching up to 1.4 times that of Col-0. This indicates that the atpb mutant significantly improved the tolerance of Arabidopsis thaliana after NaCl treatment.

[0155] At the same time, the MDA of Col-0, atpB-OE, atpb and atpBpro:atpB plants treated with NaCl at 0d and 5d was measured.

[0156] like Fig.19 As shown, compared with Col-0 and atpBpro:atpB, the MDA content of atpB-OE was slightly lower than that of Col-0 and atpBpro:atpB, and the MDA content of atpB was significantly lower than that of Col-0, which was 1.8 times lower than that of Col-0.

[0157] The above results indicate that both overexpression and mutant of atpB can enhance the salt tolerance of Arabidopsis thaliana, but the atpb mutant has a stronger ability to resist salt stress.

[0158] The reasons why both atpb mutants and atpB-OE can resist stress:

[0159] atpB-OE is resistant to salt and drought because the atpB gene positively regulates the plant's resistance to adverse stress. The higher the atpB expression level, the stronger the plant's resistance.

[0160] The atpb mutant is resistant to salt and drought because the synthesis of several subunits of ATP synthase is tightly coupled. The transcription level detected after spraying PstDC000 in the early stage showed that the expression of atpB in the atpa mutant increased, and the expression of atpA in the atpb mutant increased. Secondly, yeast, LCI and BiFC experiments proved that atpA and atpB proteins interacted in vivo and in vitro. Thirdly, the atpa atpb double mutant did not have the ability to resist adverse stress. Therefore, it was concluded that atpA and atpB have a complementary relationship. If atpA or atpB is missing alone, the other gene will produce a compensatory effect, thereby improving the plant's resistance to drought and salt. Therefore, the mutant also has the ability to resist drought and salt stress.

Claims

1. Application of Arabidopsis atpB gene in improving plant stress resistance.

2. The use of the Arabidopsis thaliana atpB gene in improving plant stress resistance as claimed in claim 1, characterized in that: The nucleotide sequence of the Arabidopsis thaliana atpB gene is shown in SEQ ID No:

1.

3. The use of the Arabidopsis thaliana atpB gene in improving plant stress resistance as claimed in claim 1 or 2, characterized in that: The application is the application of Arabidopsis thaliana atpB gene in improving the drought resistance and / or salt resistance of plants.

4. The use of the Arabidopsis thaliana atpB gene in improving plant stress resistance as claimed in claim 3, characterized in that: The application comprises constructing a plant overexpression vector containing the Arabidopsis thaliana atpB gene, transforming the constructed plant overexpression vector into plants, and cultivating drought-resistant and / or salt-resistant transgenic plants.

5. The use of the Arabidopsis thaliana atpB gene in improving plant stress resistance as claimed in claim 4, characterized in that: The plant is a woody plant or a herbaceous plant.

6. The use of the Arabidopsis thaliana atpB gene in improving plant stress resistance as claimed in claim 5, characterized in that: The herbaceous plant is Arabidopsis thaliana.

7. A plant overexpression vector containing the Arabidopsis thaliana atpB gene.

8. A recombinant genetically engineered bacterium containing the plant overexpression vector according to claim 7.

9. The recombinant genetically engineered bacterium according to claim 8, characterized in that: The plant overexpression vector containing the Arabidopsis atpB gene is introduced into Escherichia coli or Agrobacterium to construct.

Images