Application of NtPDX2 gene in tobacco plant height and stem leaf development

Abstract

The invention discloses application of a tobacco NtPDX2 gene in tobacco plant height and stem leaf development. The tobacco plant height, stem thickness and leaf area are adjusted by regulating and controlling tobacco NtPDX2 gene expression. The CDS sequence of the tobacco NtPDX2 gene is as shown in SEQ ID NO. 1; the amino acid sequence of the protein encoded by the gene is as shown in SEQ ID No.2. The NtPDX2 gene is edited by using a CRISPR / Cas9 mediated gene editing technology to obtain an editing material with reduced plant height, thinned stem and reduced leaf area, and the NtPDX2 gene is over-expressed by using a transgenic technology to obtain an over-expression material with increased plant height, thickened stem and enlarged leaf area. The gene serves as a positive regulation factor to participate in growth and development of the plant height, the stalk and the leaves, and a genetic material and a theoretical basis are provided for oriented improvement of a new tobacco variety for regulating the plant height and the stalk thickness.

Description

Technical Field

[0001] The invention relates to the technical field of crop breeding, and in particular to an NtPDX2 gene and an application thereof in tobacco plant height and stem and leaf development. Background Art

[0002] The most studied PDX gene in plants is its application in the metabolism of vitamin B6. Through the analysis of plant genomes, it was also found that PDX1 and PDX2 have the function of glutaminase, of which PDX2 is the region of glutamination and PDX1 is the region of synthase binding receptor. The properties and functions of PDX1 have been studied more in Arabidopsis. The PDX1 gene is expressed in all organs of the plant and the expression level is not regulated by osmotic pressure and abscisic acid. Through genetic screening, it was found that the vitamin B6 synthesis defective mutant pdx1.1 is overly sensitive to ammonium, which reveals the biological mechanism by which plants use PDX1.1-mediated vitamin B6 synthesis to resist ammonium-induced oxidative stress and maintain root growth. Studies have found that PDX1.2 in Arabidopsis plays a key role in embryonic development and heat shock resistance.

[0003] There are also related studies on PDX genes in other plants. Overexpression of PDX-II gene in potato (Solanum tuberosum L.) leads to increased accumulation of vitamin B6 in tuber tissue and enhanced tolerance to abiotic stress. Currently, most studies on PDX genes focus on the vitamin B6 synthesis pathway. Tobacco is an economic crop that harvests leaves. Studying the function of PDX genes in plant growth and development has key scientific significance and application prospects for tobacco breeding. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide an application of the NtPDX2 gene in tobacco plant height and stem and leaf development, and to regulate tobacco plant height, stem thickness and leaf area by regulating the expression of the tobacco NtPDX2 gene, thereby providing a theoretical basis and data support for tobacco breeding.

[0005] The technical problem to be solved by the present invention is achieved through the following technical solutions:

[0006] An application of tobacco NtPDX2 gene in tobacco plant height and stem and leaf development is to regulate tobacco plant height, stem thickness and leaf area by regulating tobacco NtPDX2 gene expression.

[0007] Preferably, in the above technical solution, the CDS sequence of the tobacco NtPDX2 gene is shown as SEQ ID NO.1; and the amino acid sequence of the protein encoded thereby is shown as SEQ ID No.2.

[0008] Preferably, in the above technical scheme, the application is to obtain a new tobacco variety with shorter plant height, thinner stems and smaller leaf area by editing the tobacco NtPDX2 gene through CRISPR / Cas9; or to obtain a new tobacco variety with taller plant height, thicker stems and larger leaf area by overexpressing the tobacco NtPDX2 gene.

[0009] Preferably, in the above technical scheme, the new tobacco variety obtained by editing the tobacco NtPDX2 gene by CRISPR / Cas9 is to artificially intervene in the mutation of the AGCTCCCTTATCATTCCTGGTGG (SEQ ID NO.11) fragment in the tobacco NtPDX2 gene, and the sequence of the fragment after insertion of the mutation is AGCTCCCTTATCATTCCTTGGTGG (SEQ ID NO.12), and the nucleotide sequence of the NtPDX2 gene after mutation is shown in SEQ ID NO.13.

[0010] Preferably, in the above technical solution, the method for obtaining a new tobacco variety comprises:

[0011] The method for obtaining a new tobacco variety with shorter plant height, thinner stems and smaller leaf area by editing the tobacco NtPDX2 gene through CRISPR / Cas9 comprises the following steps:

[0012] (A1) Designing sgRNA target site sequences and constructing a plant gene editing expression vector for editing the NtPDX2 gene;

[0013] (A2) Obtaining T0 generation editing material through tobacco genetic transformation;

[0014] (A3) T0 generation plants were self-pollinated to obtain homozygous editing material without T-DNA region sequence;

[0015] (A4) Planting homozygous materials without T-DNA sequences for two generations, observing their plant height, stem thickness, and leaf area, and evaluating their genetic stability;

[0016] The method for obtaining a new tobacco variety with increased plant height, thicker stems and larger leaf area by overexpressing the tobacco NtPDX2 gene comprises the following steps:

[0017] (B1) Designing the CaMV35S2-NtPDX2-nos expression cassette and constructing a plant expression vector that overexpresses the NtPDX2 gene;

[0018] (B2) Obtaining T0 generation editing materials through tobacco genetic transformation;

[0019] (B3) T0 generation plants were self-pollinated to obtain homozygous editing material containing T-DNA region sequences;

[0020] (B4) Planting homozygous materials containing the T-DNA region sequence for two generations, observing their plant height, stem thickness and leaf area, and evaluating their genetic stability.

[0021] Preferably, in the above technical solution, step (A1) and step (B1) are specifically:

[0022] (A1): Design the sgRNA target site sequence, synthesize a double-stranded sgRNA-scaffold fragment containing the sgRNA target site sequence and the gRNA scaffold sequence (SEQ ID No. 10); use restriction endonucleases XbaI and HindIII to digest the pCrispr-Cas9 vector and the sgRNA-scaffold fragment; connect the digested vector backbone and the double-stranded sgRNA-scaffold fragment with T4 ligase; transform the ligation product into Escherichia coli competent cells, detect positive clones and extract recombinant plasmids to obtain the gene editing plant expression vector pCRISPR / Cas9-sgRNA;

[0023] (B1): Design primers for full-length cDNA amplification of the NtPDX2 gene, and obtain the full-length cDNA amplification sequence of the NtPDX2 gene by PCR amplification; use restriction endonucleases BamHI and SacI to double-digest the pC23-CaMV35S2::nos vector; connect the cDNA product to the vector backbone that has been digested by enzymes using a homologous recombinase; transform the ligated product into Escherichia coli competent cells, detect positive clones and extract recombinant plasmids to obtain a plant overexpression vector containing the CaMV35S2::NtPDX2-cDNA::nos sequence.

[0024] Preferably, in the above technical solution,

[0025] Gene editing expression vector in step (A1):

[0026] The sgRNA target site sequence is AGCTCCCTTATCATTCCTGGTGG (SEQ ID No. 3);

[0027] The detection primer sequences used for the sgRNA guide sequence are: upstream primer NtPDX2-F1: TTTCAACGAACACATCGCAG (SEQ ID No. 4); downstream primer NtPDX2-R1: GAGCTAGACACTGAGGTGC (SEQ ID No. 5);

[0028] Plant overexpression vector of step (B1):

[0029] The primers for amplifying the full-length cDNA of the NtPDX2 gene were as follows: upstream primer NtPDX2-cDNA-F1: ATGGTTGTGGGGGTTCTTGCTT (SEQ ID No. 6); downstream primer NtPDX2-cDNA-R1: CTATTGGTATATGGGAAAATCAATTAT (SEQ ID No. 7);

[0030] The detection primer sequences used for the sgRNA guide sequence are: upstream primer JC-NtPDX2-F1: CACTTCAACATCTGGTCCTACA (SEQ ID No. 8); downstream primer JC-NtPDX2-R1: CACAATCCCACTATCCTTCGCA (SEQ ID No. 9).

[0031] Preferably, in the above technical solution, steps (A2) and (B2) are:

[0032] The Agrobacterium LBA4404 bacterial solution carrying the CRISPR / Cas9-sgRNA expression vector and the CaMV35S2::NtPDX2-cDNA::nos expression vector was soaked in tobacco leaf discs, and T0 generation tissue culture seedlings were obtained after co-cultivation, differentiation culture and rooting induction. The tissue culture seedlings were transplanted into greenhouse pots. After 2 months, samples were taken to detect the target editing and transgenic conditions, and the knockout plants and overexpression plants of the NtPDX2 gene were obtained, and the T0 generation seeds were harvested.

[0033] Preferably, in the above technical solution,

[0034] Step (A3) or (B3) is specifically:

[0035] The T0 generation seeds were self-pollinated and planted, and the homozygous plants with NtPDX2 gene editing and no T-DNA and the homozygous plants with CaMV35S2::NtPDX2-cDNA::nos were obtained through sgRNA target site editing detection and overexpression detection, and the T1 generation seeds were obtained;

[0036] Step (A4) or (B4) is specifically:

[0037] The T1 generation seeds were propagated and planted in pots, and multiple plants of knockout materials, overexpression materials and receptor materials were planted respectively. The plant height, stem thickness and leaf area were measured at different developmental stages.

[0038] A new tobacco variety is used in tobacco breeding, wherein the new tobacco variety is a new tobacco variety with shorter plant height, thinner stems and smaller leaf area obtained by editing the tobacco NtPDX2 gene by CRISPR / Cas9 according to any one of claims 3 to 9; or a new tobacco variety with taller plant height, thicker stems and larger leaf area obtained by overexpressing the tobacco NtPDX2 gene.

[0039] A genetically engineered bacterium contains a gene editing vector and overexpressed Agrobacterium.

[0040] The above technical solution of the present invention has the following beneficial effects:

[0041] The present invention constructs a CRISPR / Cas9 gene editing vector for editing the NtPDX2 gene through CRISPR / Cas9-mediated gene editing technology, and obtains NtPDX2 gene-edited safflower Dajinyuan knockout plants after editing material creation and molecular detection and identification.

[0042] The present invention provides a tobacco plant height, stem thickness and leaf area regulating gene NtPDX2. The plant height and topping plant height of T1 and T2 generation plants edited by the NtPDX2 gene are significantly lower than those of control plants, and the stem thickness is also significantly lower than that of the control plants. At the same time, the leaf area is also significantly lower than that of the control plants.

[0043] The present invention constructs a plant expression vector for overexpressing the NtPDX2 gene through transgenic technology, and obtains a safflower Dajinyuan overexpressing plant of the NtPDX2 gene after expression material creation and molecular detection and identification. The plant height and topping plant height of the T1 and T2 generation plants overexpressing the NtPDX2 gene are significantly higher than those of the control plants, and the stem thickness is also significantly higher than that of the control plants, and the leaf area is significantly higher than that of the control plants.

[0044] The present invention provides a set of mutant fragment sequences of tobacco NtPDX2 gene sequences, and a technical solution for studying gene function during tobacco plant height, stem and leaf growth and development, thereby increasing the functional research application of the gene in the technical field of tobacco growth and development.

[0045] In summary, editing the NtPDX2 gene using CRISPR / Cas9-mediated gene editing technology obtained edited materials with reduced plant height, thinner stems and smaller leaf area, while overexpressing the NtPDX2 gene using transgenic technology obtained overexpression materials with increased plant height, thicker stems and larger leaf area, indicating that this gene participates in the growth and development of plant height, stems and leaves as a positive regulatory factor, which provides genetic material and theoretical basis for the directional improvement of new tobacco varieties for regulating plant height and stem thickness. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] The accompanying drawings, which are incorporated in and constitute a part of the specification, illustrate embodiments of the invention and, together with the description, serve to explain the principles of the invention.

[0047] Figure 1 Schematic diagram of the structure of the gene editing vector pOREU3TR.

[0048] Figure 2 Schematic diagram of the structure of the overexpression vector pC23-35S2-PDX2-NOS.

[0049] Figure 3 Schematic diagram of the target site editing sequence of the NtPDX2 gene.

[0050] Figure 4 The height of the edited plants, overexpressed plants and control plants at the seedling stage (control CK, overexpressed OE, knockout mutant KO). The plant type identification of the plants at the seedling stage and the cluster stage

[0051] Figure 5 The plant heights of knockout plants, overexpression plants and control plants at the clustering stage (control CK, overexpression OE, knockout mutant KO).

[0052] Figure 6 The plant heights of knockout plants, overexpression plants and control plants at maturity (control CK, overexpression OE, knockout mutant KO).

[0053] Figure 7 The stem thickness of knockout plants, overexpression plants and control plants at maturity (control CK, overexpression OE, knockout mutant KO).

[0054] Figure 8 Observation of leaf conditions of different tobacco plants at the cluster stage (control CK, overexpression OE, knockout mutant KO).

[0055] Fig. 9 Observation of leaf conditions of different tobacco plants at maturity (control CK, overexpression OE, knockout mutant KO).

[0056] Fig.10 The leaf types of different tobacco plants at the cluster stage and maturity stage were determined and analyzed (control CK, overexpression OE, knockout mutant KO; Rosette stage: cluster stage, Flower stage: maturity stage; sand: foot leaves, lugs: lower two shed leaves, cutters: waist leaves).

[0057] Fig.11 is the expression level of NtPDX2 in different tissues of tobacco at different stages (seedling stage, cluster stage and flowering stage), namely roots, stems, leaves and flowers.

[0058] Fig.12 The expression levels of NtPDX2 in different tissues (roots, stems, and leaves) of different plants (control CK, overexpression OE, and knockout mutant KO) at different stages (seedling stage, cluster stage, and flowering stage).

[0059] Fig.13 To measure the agronomic traits of different tobacco materials at maturity, including natural plant height, topping plant height and stem girth (control CK, overexpression OE, knockout mutant KO). DETAILED DESCRIPTION

[0060] Various exemplary embodiments of the present invention will now be described in detail with reference to the accompanying drawings. It should be noted that the relative arrangement of components and steps, numerical expressions and numerical values ​​set forth in these embodiments do not limit the scope of the present invention unless otherwise specifically stated.

[0061] Unless otherwise specified, all experimental methods used in the following examples are conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained through commercial channels.

[0062] For the operation steps not described in detail in the following examples, refer to the corresponding part of the third edition of "Molecular Cloning Laboratory Manual" (written by J. Sambrook and DW Russell, Science Press) or refer to the instructions of the kits used.

[0063] The reagent materials and sources involved in the following examples are as follows:

[0064] The pCloneEZ-TOPO cloning vector is a product of Sino-US Taihe Biotechnology (Beijing) Co., Ltd., with the product catalog number C5851.

[0065] The pJET1.2 TA cloning vector was purchased from Haiji Biotechnology Co., Ltd. with the product catalog number D1901A.

[0066] The plasmid extraction kit is a product of Tiangen Biochemical Technology (Beijing) Co., Ltd., catalog number: DP103-03.

[0067] The DNA extraction kit is a product of Beijing Bomade Technology Development Co., Ltd., and the product catalog number is DN1501.

[0068] 2×EasyTaq PCR SuperMix is ​​a product of Beijing Quanshijin Biotechnology Co., Ltd., with the catalog number AS111-01.

[0069] The agarose gel purification and recovery kit is a product of Beijing Bomade Technology Development Co., Ltd., and the product catalog number is DR0101.

[0070] E. coli competent cells are products of Beijing Quanshijin Biotechnology Co., Ltd., with the catalog number of CD201-01.

[0071] Nucleic acid restriction endonucleases BamHI, SacI and HindIII are products of NEB, with catalog numbers R3136V, R3156V and R3104V.

[0072] The pCamBIA2300 vector is a product of Beijing Crespo Biotechnology Co., Ltd., with the product catalog number being VT11938.

[0073] The YEB medium and its formula involved in the following examples are as follows: 1 g yeast extract, 5 g peptone, 5 g sucrose and 0.98 g MgSO4 were added to 800 mL deionized water in sequence. The mixture was thoroughly mixed with a magnetic stirrer, the pH was adjusted to 7.0, the volume was fixed to 1 L, and the temperature was 121 ° C, 1.034 × 10 5 Sterilize with high temperature and high pressure for 15 min. After sterilization, store at 4°C. Add 1.25% agar powder to solid YEB medium before autoclaving.

[0074] The tobacco variety Honghua Dajinyuan involved in the following examples is stored in Yunnan China Tobacco Industry Co., Ltd. for a long time.

[0075] Example 1 Obtaining NtPDX2 gene overexpressing tobacco plants and character identification

[0076] 1.1 Obtaining transgenic tobacco plants by Agrobacterium-mediated method

[0077] 1.1.1 Construction of plant expression vector pC23-35S2-PDX2-NOS

[0078] 1) The whole plant of cultivated tobacco safflower Dajinyuan was used as the experimental material, and the total RNA of tobacco leaf tissue was extracted using an RNA extraction kit, and reverse transcribed into cDNA for use. Refer to the instructions of the plant RNA extraction kit to extract tobacco total RNA, 1μg of total RNA was extracted from the leaves for reverse transcription, and the transcription system was as follows:

[0079]

[0080] Mix thoroughly and incubate at 42°C for 3 minutes. Then add the following reagents to the system:

[0081]

[0082] The reaction conditions were 37°C for 15 min, 85°C for 10 sec, and ice bath for 5 min. The mixture was then stored in a -20°C refrigerator for later use.

[0083] 2) The CaMV35S2 promoter and nos terminator sequences were searched from the NCBI website, and the CaMV35S2 promoter and nos terminator sequences were artificially synthesized. In order to construct the vector, a HindIII restriction site and a linker were added to the 5' end of the CaMV35S2 promoter, and a BamHI restriction site was added to the 3' end; a SacI restriction site was added to the 5' end of the nos terminator, and an EcoRI restriction site was added to the 3' end; through PCR amplification, a BamHI restriction site was added to the 5' end of the cDNA sequence of the NtPDX2 gene, and a SacI restriction site was added to the 3' end.

[0084] 3) Primers were designed based on the CaMV35S2 promoter, nos terminator and cDNA sequence of NtPDX2 gene, and the fusion gene fragment CaMV35S2::NtPDX2-cDNA::nos was obtained by fusion PCR method, which was connected to the pJET1.2-T TA cloning vector. After correct sequencing, the intermediate vector pJET-35S2-NtPDX2-NOS was obtained.

[0085] 4) The pCamBIA2300 vector and the pJET-35S2-NtPDX2-nos vector were digested with EcoRI and HindIII, and the vector backbone of about 8.7 kb and the target fragment of about 1.9 kb of the NtPDX2 expression frame were connected to form the plant overexpression vector pC23-35S2-PDX2-NOS.

[0086] The schematic diagram of the plant overexpression vector pC23-35S2-PDX2-NOS is shown in Figure 1 As shown. In this expression vector, the target gene NtPDX2 is expressed by the CaMV35S2 promoter, and nos terminates the expression. The recombinant vector is obtained by keeping the other nucleotide sequences of the pCamBIA2300 vector unchanged.

[0087] 1.1.2 Preparation of Agrobacterium tumefaciens culture

[0088] The plant expression vector pC23-35S2-PDX2-NOS obtained in 1.1.1 was transformed into Agrobacterium tumefaciens LBA4404 by freeze-thaw method. Pick a single colony of Agrobacterium tumefaciens LBA4404 containing the plant expression vector pC23-35S2-PDX2-NOS and culture it in YEB medium at 28°C overnight. Pipette 1mL of bacterial solution and inoculate it into 100mL YEB medium and continue to culture at 28°C for 4-6 hours until the OD value is 0.6-0.8 for use.

[0089] 1.1.3 Preparation of transgenic tobacco

[0090] The leaves of sterile seedlings of Honghua Dajinyuan were cut into square leaf discs of 0.5-1.0 cm2, and the leaf discs were used as explants. The T-DNA in the plant expression vector pC23-35S2-PDX2-NOS was transferred into the genome of the recipient tobacco variety Honghua Dajinyuan by Agrobacterium-mediated method to obtain T0 transgenic tobacco plants (numbered OE). The specific operation steps of Agrobacterium-mediated tobacco genetic transformation refer to the method in the literature "Zhao Li, Zhong Ming, Ma Hui, et al. Establishment of Agrobacterium-mediated tobacco efficient genetic transformation system [J]. Jiangsu Agricultural Science, 2011, 39(03): 67-74."

[0091] 1.2 PCR detection of transgenic tobacco positive plants

[0092] The genomic DNA of OE was extracted using the new plant genomic DNA extraction kit of Beijing Kangwei Reagent Biotechnology Co., Ltd. in step 1.

[0093] Primers JC-NtPDX2-F1 and JC-NtPDX2-R1 were designed based on the cDNA sequence of the CaMV35S2 promoter and the NtPDX2 gene. The primer sequences are as follows:

[0094] Upstream primer JC-NtPDX2-F1: CACTTCAACATCTGGTCCTACA (SEQ ID No. 8);

[0095] Downstream primer JC-NtPDX2-R1: CACAATCCCACTATCCTTCGCA (SEQ ID No. 9).

[0096] PCR amplification was performed using JC-NtPDX2-F1 and JC-NtPDX2-R1 as primers and genomic DNA of transgenic tobacco plants as template. The PCR amplification program was as follows: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30sec, 62℃ annealing for 30sec, 72℃ amplification for 90sec, 30 cycles; 72℃ extension for 10min.

[0097] At the same time, the receptor material Honghua Dajinyuan and the plant expression vector pC23-35S2-PDX2-NOS were used as controls.

[0098] The results showed that the target band of about 580 bp could be amplified using the genomic DNA of transgenic tobacco OE plants and the plant expression vector pC23-35S2-PDX2-NOS as templates, while no target band was amplified in the non-transgenic control Honghua Dajinyuan.

[0099] 1.3 Analysis of plant height, stem thickness, and leaf area of ​​tobacco plants overexpressing OE

[0100] The T0 transgenic tobacco plants identified as positive by PCR were self-pollinated to obtain T1 transgenic tobacco seeds. The T1 transgenic tobacco seeds were planted, and then the plants were self-pollinated to harvest T2 seeds, and the T2 seeds were planted to obtain T2 overexpression transgenic tobacco plants.

[0101] The phenotypes of the overexpression and control plants at the seedling stage were observed. The results showed that compared with the recipient plants, the overexpression plants were larger ( Figure 4 ); at the cluster stage, the height of the overexpressing plants was significantly higher than that of the recipient plants ( Figure 5 At maturity, the height of the overexpression plants (98.4 cm) was significantly higher than that of the control plants (74.5 cm). Figure 6 and Figure 7 ); in terms of stem thickness, compared with the receptor plants (12.02 cm), the overexpression plants (13.64 cm) were significantly thicker than the receptor control plants ( Figure 7 ). At the same time, compared with the recipient plants, the leaf sizes at the seedling and cluster stages were also different. The leaves of the overexpression plants were the largest, followed by the recipient plants, and the leaves of the knockout plants were the smallest ( Figure 8 , Fig. 9 and Fig.10 ).

[0102] Example 2: Obtaining NtPDX2 gene knockout tobacco plants and character identification

[0103] 1.1 Obtaining NtPDX2 gene knockout plants by Agrobacterium-mediated method

[0104] 1.1.1 Construction of gene editing vector pCrispr-Cas9-sgRNA

[0105] 1) Use the online software CRISPR-P 2.0 (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR) to design the sgRNA guide sequence, and select the guide sequence with a high score and located in the appropriate position of the NtPDX2 gene sequence. The sgRNA sequence selected in this application is: AGCTCCCTTATCATTCCTGGTGG (SEQ ID No. 3), and the sequence is handed over to the company to synthesize a double-stranded sgRNA-scaffold fragment containing the sgRNA guide sequence and the gRNAscaffold sequence, and an XbaI restriction site and a linker are added to its 5' end, and a HindIII restriction site and a linker are added to its 3' end. The sgRNA-scaffold sequence is: TCTAGAAGCTCCCTTATCATTCCTGGTGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGAGTCGACCTGCAGGCATGCAAGCTT (SEQ ID No. 10).

[0106] 2) The pCrispr-Cas9 vector and sgRNA-scaffold fragment were digested with XbaI and HindIII, and the vector backbone of about 13.8kb and the target fragment of about 300bp of the sgRNA-scaffold fragment were connected using T4 ligase to form the gene editing vector pCrispr-Cas9-sgRNA. The schematic diagram of the structure of the gene editing vector pCrispr-Cas9-sgRNA is shown in Figure 2 shown.

[0107] 1.1.2 Preparation of Agrobacterium tumefaciens culture

[0108] The gene editing vector pCrispr-Cas9-sgRNA obtained in 1.1.1 was transformed into Agrobacterium tumefaciens LBA4404 by freeze-thaw method. Pick a single colony of Agrobacterium tumefaciens LBA4404 containing the gene editing vector pCrispr-Cas9-sgRNA and culture it in YEB medium at 28°C overnight. Pipette 1mL of bacterial solution and inoculate it into 100mL YEB medium and continue to culture at 28°C for 4-6 hours until the OD value is 0.6-0.8 for later use.

[0109] 1.1.3 Preparation of knockout tobacco materials

[0110] The leaves of sterile seedlings of Honghua Dajinyuan were cut into square leaf discs of 0.5-1.0 cm2. The leaf discs were used as explants. The gene editing vector pCrispr-Cas9-sgRNA was transferred into the recipient tobacco variety Honghua Dajinyuan through Agrobacterium-mediated method to obtain T0 generation gene-edited tobacco plants (numbered KO). The specific operation steps of Agrobacterium-mediated tobacco genetic transformation refer to the method in the literature "Zhao Li, Zhong Ming, Ma Hui, et al. Establishment of Agrobacterium-mediated tobacco efficient genetic transformation system [J]. Jiangsu Agricultural Science, 2011, 39(03): 67-74."

[0111] 1.2 PCR detection of positive knockout tobacco plants

[0112] The genomic DNA of OE was extracted using the new plant genomic DNA extraction kit of Beijing Kangwei Reagent Biotechnology Co., Ltd. in step 1.

[0113] Primers NtPDX2-F1 and NtPDX2-R1 were designed based on the cDNA sequence of the NtPDX2 gene. The primer sequences are as follows:

[0114] Upstream primer NtPDX2-F1: TTTCAACGAACACATCGCAG (SEQ ID No. 4);

[0115] Downstream primer NtPDX2-R1: GAGCTAGACACTGAGGTGC (SEQ ID No. 5).

[0116] PCR amplification was performed using NtPDX2-F1 and NtPDX2-R1 as primers and genomic DNA of knockout tobacco plants as template. The PCR amplification program was as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 sec, 56°C annealing for 30 sec, 72°C amplification for 90 sec, 30 cycles; 72°C extension for 10 min.

[0117] The results showed that when the genomic DNA of the knockout tobacco KO plant and the control Honghua Dajinyuan were used as templates, the target band of about 658 bp could be amplified. Subsequently, the PCR amplification product was sent to the company for sequencing analysis, and the results showed that the knockout tobacco KO plant had a single base "T" insertion in the NtPDX2 gene, while there was no base insertion or deletion mutation in the control Honghua Dajinyuan.

[0118] 1.3 Analysis of plant height, stem thickness and leaf area of ​​KO tobacco plants

[0119] The T0 generation knockout tobacco plants identified as positive by PCR were self-pollinated to obtain T1 generation knockout tobacco seeds. The T1 generation knockout tobacco seeds were planted, and then the plants were self-pollinated to harvest T2 bearing seeds, and the T2 generation seeds were planted to obtain T2 generation knockout tobacco plants.

[0120] The phenotypes of knockout and control plants at the seedling stage were observed. The results showed that compared with the recipient plants, the knockout plants were smaller ( Figure 4 ); at the cluster stage, there was no significant difference in plant height between the knockout material plants and the recipient plants ( Figure 5 At maturity, the knockout plants were shorter (67.2 cm) than the recipient plants (74.5 cm) ( Figure 6 and Figure 7 ); in terms of stem thickness, compared with the recipient plants (12.02 cm), the stem thickness of the knockout plants (10.83 cm) was significantly thinner than that of the recipient control plants ( Figure 7 ). At the same time, compared with the recipient plants, the leaf sizes at the seedling and cluster stages were also different. The leaves of the overexpression plants were the largest, followed by the recipient plants, and the leaves of the knockout plants were the smallest ( Figure 8 , Fig. 9 and Fig.10 ).

[0121] Example 3

[0122] The roots, stems, and leaves of red flower Dajinyuan in the seedling and cluster stage, as well as the roots, stems, leaves, and flowers of red flower Dajinyuan in the blooming stage were selected as samples, and the specific primers for tobacco NtPDX2 fluorescence quantitative analysis qNtPDX2-F / R and the specific primers for internal reference gene EF1 fluorescence quantitative analysis qEF1-F / R were designed (see Table 1). Fluorescence quantitative analysis was performed using TB Premix Ex Taq TM qPCR was performed using TliRNaseH Plus (Takara) and 2- ΔΔCT The relative expression level of genes was analyzed by the method, and 3 replicates were set for each reaction. Fig.11 .

[0123] Table 1 Primer sequence information

[0124]

[0125] Example 4

[0126] Agrobacterium infection was used to genetically transform tobacco to obtain overexpression and knockout mutant materials. Then, the control Honghua Dajinyuan (CK), NtPDX2 gene overexpression material (OE), and NtPDX2 gene knockout mutant (KO) were used as experimental materials. At the seedling stage, cluster stage, and flowering stage of tobacco plants, roots, stems, leaves, and roots, stems, leaves, and flowers were collected to detect the expression of NtPDX2 gene. The results are shown in Fig.12 .

[0127] Example 5

[0128] The control Honghua Dajinyuan (CK), NtPDX2 gene overexpression material (OE), and NtPDX2 gene knockout mutant (KO) were used as experimental materials. Plant type identification was carried out at the seedling stage and cluster stage, and leaf type identification, observation, and measurement and analysis of different leaves (foot leaves, lower two shed leaves, and waist leaves) were carried out at the cluster stage and mature stage. Fig.10 .

[0129] Research findings:

[0130] The phenotypes of overexpression, knockout and recipient plants at the seedling stage were observed, and the results showed that:

[0131] Compared with the recipient plants, the knockout plants were smaller and the overexpression plants were larger at the seedling and cluster stages; and the leaf sizes were also different at the cluster and mature stages, with the overexpression leaves being the largest, followed by the recipient plants, and the knockout plants having the smallest leaves.

[0132] At maturity, the knockout plants were shorter (67.2 cm) than the receptor plants (74.5 cm), while the overexpression plants (98.4 cm) were significantly taller than the receptor control plants ( Fig.13 ). This indicates that overexpression of the NtPDX2 gene can promote plant height increase, stem thickening, and leaf growth, thereby increasing leaf area and helping to increase leaf yield. This indicates that the NtPDX2 gene plays an important role in the growth and development of leaves, stem thickness, and plant height.

[0133] Although the present invention has been disclosed as above by the embodiments, it is not intended to limit the present invention. Any person skilled in the art may make various choices and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention is limited by the claims and their equivalents.

Claims

1. An application of tobacco NtPDX2 gene in tobacco plant height and stem and leaf development, characterized in that: The plant height, stem thickness and leaf area of ​​tobacco are regulated by regulating the expression of tobacco NtPDX2 gene.

2. The use according to claim 1, characterized in that: The CDS sequence of the tobacco NtPDX2 gene is shown in SEQ ID NO.1; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

3. The use according to claim 1, characterized in that: The application is to obtain a new tobacco variety with shorter plant height, thinner stems and smaller leaf area by editing the tobacco NtPDX2 gene through CRISPR / Cas9; or to obtain a new tobacco variety with taller plant height, thicker stems and larger leaf area by overexpressing the tobacco NtPDX2 gene.

4. The use according to claim 3, characterized in that: The new tobacco variety obtained by editing the tobacco NtPDX2 gene through CRISPR / Cas9 is that the AGCTCCCTTATCATTCCTGGTGG (SEQ ID NO.11) fragment in the tobacco NtPDX2 gene is artificially mutated. The sequence of the fragment after insertion of the mutation is AGCTCCCTTATCATTCCTTGGTGG (SEQ ID NO.12). The nucleotide sequence of the NtPDX2 gene after mutation is shown in SEQ ID NO.

13.

5. The use according to claim 3, characterized in that: Methods for obtaining new tobacco varieties include: The method for obtaining a new tobacco variety with shorter plant height, thinner stems and smaller leaf area by editing the tobacco NtPDX2 gene through CRISPR / Cas9 comprises the following steps: (A1) Designing sgRNA target site sequences and constructing a plant gene editing expression vector for editing the NtPDX2 gene; (A2) Obtaining T0 generation editing material through tobacco genetic transformation; (A3) T0 generation plants were self-pollinated to obtain homozygous editing material without T-DNA region sequence; (A4) Planting homozygous materials without T-DNA sequences for two generations, observing their plant height, stem thickness, and leaf area, and evaluating their genetic stability; The method for obtaining a new tobacco variety with increased plant height, thicker stems and larger leaf area by overexpressing the tobacco NtPDX2 gene comprises the following steps: (B1) Designing the CaMV35S2-NtPDX2-nos expression cassette and constructing a plant expression vector that overexpresses the NtPDX2 gene; (B2) Obtaining T0 generation editing materials through tobacco genetic transformation; (B3) T0 generation plants were self-pollinated to obtain homozygous editing material containing T-DNA region sequences; (B4) Planting homozygous materials containing T-DNA sequences for two generations, observing their plant height, stem thickness and leaf area, and evaluating their genetic stability.

6. The use according to claim 5, characterized in that: Step (A1) and step (B1) are specifically: (A1): Design the sgRNA target site sequence, synthesize a double-stranded sgRNA-scaffold fragment containing the sgRNA target site sequence and the gRNA scaffold sequence (SEQ ID No. 10); use restriction endonucleases XbaI and HindIII to digest the pCrispr-Cas9 vector and the sgRNA-scaffold fragment; connect the digested vector backbone and the double-stranded sgRNA-scaffold fragment with T4 ligase; transform the ligation product into Escherichia coli competent cells, detect positive clones and extract recombinant plasmids to obtain the gene editing plant expression vector pCRISPR / Cas9-sgRNA; (B1): Design primers for full-length cDNA amplification of the NtPDX2 gene, and obtain the full-length cDNA amplification sequence of the NtPDX2 gene by PCR amplification; use restriction endonucleases BamHI and SacI to double-digest the pC23-CaMV35S2::nos vector; connect the cDNA product to the vector backbone that has been digested by enzymes using a homologous recombinase; transform the ligated product into Escherichia coli competent cells, detect positive clones and extract recombinant plasmids to obtain a plant overexpression vector containing the CaMV35S2::NtPDX2-cDNA::nos sequence.

7. The use according to claim 5, characterized in that: Gene editing expression vector in step (A1): The sgRNA target site sequence is AGCTCCCTTATCATTCCTGGTGG (SEQ ID No. 3); The detection primer sequences used for the sgRNA guide sequence are: upstream primer NtPDX2-F1: TTTCAACGAACACATCGCAG (SEQ ID No. 4); downstream primer NtPDX2-R1: GAGCTAGACACTGAGGTGC (SEQ ID No. 5); Plant overexpression vector of step (B1): The primers for amplifying the full-length cDNA of the NtPDX2 gene were as follows: upstream primer NtPDX2-cDNA-F1: ATGGTTGTGGGGGTTCTTGCTT (SEQ ID No. 6); downstream primer NtPDX2-cDNA-R1: CTATTGGTATATGGGAAAATCAATTAT (SEQ ID No. 7); The detection primer sequences used for the sgRNA guide sequence are: upstream primer JC-NtPDX2-F1: CACTTCAACATCTGGTCCTACA (SEQ ID No. 8); downstream primer JC-NtPDX2-R1: CACAATCCCACTATCCTTCGCA (SEQ ID No. 9).

8. The use according to claim 5, characterized in that: Steps (A2) and (B2) are: The Agrobacterium LBA4404 bacterial solution carrying the CRISPR / Cas9-sgRNA expression vector and the CaMV35S2::NtPDX2-cDNA::nos expression vector was soaked in tobacco leaf discs, and T0 generation tissue culture seedlings were obtained after co-cultivation, differentiation culture and rooting induction. The tissue culture seedlings were transplanted into greenhouse pots. After 2 months, samples were taken to detect the target editing and transgenic conditions, and the knockout plants and overexpression plants of the NtPDX2 gene were obtained, and the T0 generation seeds were harvested.

9. The use according to claim 5, characterized in that: Step (A3) or (B3) is specifically: The T0 generation seeds were self-pollinated and planted, and the homozygous plants with NtPDX2 gene editing and no T-DNA and the homozygous plants with CaMV35S2::NtPDX2-cDNA::nos were obtained through sgRNA target site editing detection and overexpression detection, and the T1 generation seeds were obtained; Step (A4) or (B4) is specifically: The T1 generation seeds were propagated and planted in pots, and multiple plants of knockout materials, overexpression materials and receptor materials were planted respectively. The plant height, stem thickness and leaf area were measured at different developmental stages.

10. Application of a new tobacco variety in tobacco breeding, characterized in that: The new tobacco variety is a new tobacco variety with shorter plant height, thinner stems and smaller leaf area obtained by editing the tobacco NtPDX2 gene by CRISPR / Cas9 according to any one of claims 3-9; or a new tobacco variety with taller plant height, thicker stems and larger leaf area obtained by overexpressing the tobacco NtPDX2 gene.

Images