Method for monitoring activity of chimeric antigen receptor T cells in real time
By expressing CAR and EGFP in T cells, and using the expression of IL2 promoter and fluorescent protein to indicate the activation status of T cells, the high cost and complexity of monitoring the activation status of CAR-T cells in the existing technology is solved and achieved Real-time and accurate monitoring results are achieved.
Patent Information
- Application Number
- CN202411478591.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-22
- Publication Date
- 2025-01-21
AI Technical Summary
In the prior art, the method of monitoring the activation status of CAR-T cells is expensive, the equipment requirements are high, and the experimental operation is complex, making it difficult to achieve real-time, simple and efficient monitoring.
通过将CAR序列、EGFP序列、IL2启动子序列和荧光蛋白序列克隆至载体中,生成重组质粒,利用慢病毒包装并感染T细胞,实现CAR-T细胞与EGFP共表达,并通过IL2启动子和 The expression of fluorescent protein indicates the activation state of T cells, and uses a streaming cytometer in real time monitoring.
Real-time and accurate monitoring of CAR-T cell activation status, reducing the complexity and cost of equipment and experimental operations, and providing a simple and efficient monitoring method.
Smart Images
Figure CN119331942A_ABST
Abstract
Description
Technical Field
[0001] The present application belongs to the field of biomedicine and cell therapy technology, and in particular, relates to a method for real-time monitoring of chimeric antigen receptor T cell activity. Background Art
[0002] As an innovative cell immunotherapy, CAR-T cell therapy has achieved remarkable results in the clinical treatment of hematological tumors. As a promising biotechnology, CAR-T is an important means to conquer tumors. However, the research on CAR-T is still very limited, so that CAR-T technology has not made effective progress in the treatment of solid tumors.
[0003] In order to further study the interaction between CAR-T cells and tumor cells, as well as the activation mode and activation status of CAR-T cells, it is necessary to develop a simple, effective and monitorable method to characterize CAR-T cells. Currently, the main means of monitoring CAR-T cells are live cell dynamic imaging technology. Live cell dynamic imaging technology is highly dependent on equipment and is expensive, which is not suitable for the widespread promotion of the present invention using genetic engineering methods.
[0004] Therefore, there is an urgent need to provide a simple and efficient method that reduces both equipment requirements and complex experimental operations to achieve real-time monitoring of the activation state of CAR-T cells. Summary of the invention
[0005] The purpose of the present application is to provide a method for real-time monitoring of the activity of chimeric antigen receptor T cells, aiming to solve the problems in the prior art of monitoring CAR-T cells, such as high cost, high equipment requirements and complex experimental operations.
[0006] In order to achieve the above application purpose, the technical solution adopted in this application is as follows:
[0007] In a first aspect, the present application provides a method for real-time monitoring of chimeric antigen receptor T cell activity, comprising the following steps: cloning a CAR sequence, an EGFP sequence, an IL2 promoter sequence, and a fluorescent protein sequence into a vector to obtain a recombinant plasmid;
[0008] The recombinant plasmid is packaged by using a lentivirus to obtain a lentivirus precipitate containing the recombinant plasmid;
[0009] Providing a T cell suspension, mixing and incubating the lentiviral precipitate containing the recombinant plasmid with the T cell suspension to obtain CAR-T cells;
[0010] The CAR-T cells are co-cultured with tumor cells, and the activity of chimeric antigen receptor T cells is monitored in real time using a flow cytometer.
[0011] In some embodiments, the fluorescent protein sequence is selected from mCherry fluorescent protein.
[0012] In some embodiments, the step of packaging the recombinant plasmid using a lentivirus to obtain a lentivirus precipitate containing the recombinant plasmid includes: providing an auxiliary plasmid, and mixing the auxiliary plasmid with the recombinant plasmid to obtain a mixed plasmid;
[0013] Providing 293T cells to be used, and adding the mixed plasmid dropwise into the 293T cells to be used for transfection to obtain a supernatant;
[0014] The supernatant is concentrated using a lentivirus concentrate and centrifuged to obtain a lentivirus precipitate containing the recombinant plasmid.
[0015] In some embodiments, the auxiliary plasmid is selected from PSPAX plasmid and PMD2G plasmid, and the mass ratio of the recombinant plasmid to the PSPAX plasmid and PMD2G plasmid is 4:3:2.
[0016] In some embodiments, the step of mixing the auxiliary plasmid with the recombinant plasmid to obtain a mixed plasmid further includes: providing a PEI transfection agent, and the ratio of the mass of the PEI transfection agent to the total mass of the auxiliary plasmid and the recombinant plasmid is 3:1; the PEI transfection agent, the auxiliary plasmid and the recombinant plasmid are evenly mixed, and allowed to stand for 15 to 20 minutes to obtain a mixed plasmid.
[0017] In some embodiments, the 293T cells to be used are selected from 293T cells with a confluence of 80% to 90%.
[0018] In some embodiments, the step of adding the mixed plasmid dropwise to the stand-by 293T cells for transfection to obtain a supernatant includes: adding the mixed plasmid dropwise to the stand-by 293T cells, mixing for 8 to 9 hours, changing the liquid, and then performing transfection for 48 hours to obtain a supernatant.
[0019] In some embodiments, the step of concentrating the supernatant with a lentivirus concentrate and centrifuging to obtain a lentivirus precipitate containing the recombinant plasmid includes: concentrating the supernatant with a 4-fold lentivirus concentrate at 4°C overnight, and then centrifuging at 4°C and 2000g / min for 30 minutes to obtain a lentivirus precipitate containing the recombinant plasmid.
[0020] In some embodiments, the concentration of the T cell suspension is 1×10 6 cells / mL, and the volume ratio of the T cell suspension to the lentiviral precipitate containing the recombinant plasmid is 2mL:100μL.
[0021] In some embodiments, the step of mixing and incubating the lentiviral precipitate containing the recombinant plasmid with the T cell suspension includes: mixing and incubating the lentiviral precipitate containing the recombinant plasmid with the T cell suspension for 24 to 25 hours.
[0022] In some embodiments, the tumor cells are selected from HCT116 tumor cells.
[0023] In some embodiments, the CAR-T cells are co-cultured with tumor cells, and the step of using a flow cytometer to monitor the activity of chimeric antigen receptor T cells in real time includes: harvesting the co-cultured cells after 16 hours and 48 hours of co-culture, incubating the cells in the dark with a CD3 antibody for 30 minutes, harvesting the cells, and monitoring in real time using a flow cytometer.
[0024] In the first aspect, the present application provides a method for real-time monitoring of the activity of chimeric antigen receptor T cells, which utilizes a promoter of the cytokine IL2 produced during the CAR-T activation process, and utilizes the expression of downstream fluorescent genes to indicate the activation of T cells. The activation of T cells can be observed in a timely manner by fluorescence observation; the method utilizes a CAR and EGFP co-expression system, uses EGFP to indicate the expression of CAR, and the fluorescent gene is used to display the activation state of T cells. The dual fluorescence system can accurately and real-time describe the activation state of CAR-T cells. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0026] Figure 1 Schematic diagram of the pLenti-EF1A-CAR-2A-EGFP vector provided in the examples of the present application.
[0027] Figure 2 Schematic diagram of the pLenti-EF1A-CAR-2A-EGFP-pIL2-mcherry vector provided in the examples of the present application.
[0028] Figure 3 The flow cytometry results of CAR-Jurkat cells provided in the examples of the present application after co-culture with (the following list) or without (the above list) tumor cells, the horizontal axis is EGFP, and the vertical axis is mcherry. DETAILED DESCRIPTION
[0029] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.
[0030] In this application, the term "and / or" describes the association relationship of associated objects, indicating that there may be three relationships. For example, A and / or B can mean: A exists alone, A and B exist at the same time, and B exists alone. A and B can be singular or plural. The character " / " generally indicates that the associated objects are in an "or" relationship.
[0031] In this application, "at least one" means one or more, and "plurality" means two or more. "At least one of the following" or similar expressions refers to any combination of these items, including any combination of single items or plural items. For example, "at least one of a, b, or c", or "at least one of a, b, and c" can all mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, c can be single or multiple, respectively.
[0032] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution, some or all of the steps can be executed in parallel or sequentially, and the execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.
[0033] The terms used in the embodiments of the present application are only for the purpose of describing specific embodiments, and are not intended to limit the present application. The singular forms "a", "an" and "the" used in the embodiments of the present application and the appended claims are also intended to include plural forms, unless the context clearly indicates other meanings.
[0034] The weight of the relevant components mentioned in the embodiment description of the present application can not only refer to the specific content of each component, but also represent the proportional relationship between the weights of the components. Therefore, as long as the content of the relevant components is proportionally enlarged or reduced according to the embodiment description of the present application, it is within the scope disclosed in the embodiment description of the present application. Specifically, the mass described in the embodiment description of the present application can be a mass unit known in the chemical industry such as μg, mg, g, kg, etc.
[0035] The terms "first" and "second" are used only for descriptive purposes to distinguish objects such as substances from each other, and should not be understood as indicating or implying relative importance or implicitly indicating the number of indicated technical features. For example, without departing from the scope of the embodiments of the present application, the first XX may also be referred to as the second XX, and similarly, the second XX may also be referred to as the first XX. Thus, features defined as "first" and "second" may explicitly or implicitly include one or more of the features.
[0036] The first aspect of the present application provides a method for real-time monitoring of chimeric antigen receptor T cell activity, comprising the following steps:
[0037] S01. Clone the CAR sequence, EGFP sequence, IL2 promoter sequence and fluorescent protein sequence into the vector to obtain a recombinant plasmid;
[0038] S02. packaging the recombinant plasmid using a lentivirus to obtain a lentivirus precipitate containing the recombinant plasmid;
[0039] S03. Providing a T cell suspension, mixing and incubating the lentiviral precipitate containing the recombinant plasmid with the T cell suspension to obtain CAR-T cells;
[0040] S04. Co-culture the CAR-T cells with tumor cells, and then use a flow cytometer to monitor the activity of chimeric antigen receptor T cells in real time.
[0041] The first aspect of the embodiments of the present application provides a method for real-time monitoring of the activity of chimeric antigen receptor T cells. The method utilizes a promoter of cytokine IL2 produced during the CAR-T activation process, and utilizes the expression of downstream fluorescent genes to indicate the activation of T cells. The activation of T cells can be observed in time by fluorescence observation. The method utilizes a CAR and EGFP co-expression system, uses EGFP to indicate the expression of CAR, and the fluorescent gene is used to display the activation state of T cells. The dual fluorescence system can accurately and real-time describe the activation state of CAR-T cells.
[0042] In step S01, the CAR sequence, EGFP sequence, IL2 promoter sequence and fluorescent protein sequence are cloned into a vector to obtain a recombinant plasmid.
[0043]
[0044] In some embodiments, the specific bases of the EGFP sequence are shown in Seq. No. 2, specifically: atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaag。
[0045] In some embodiments, the specific bases of the T2A sequence are shown in Seq. No. 3, specifically: gagggcagaggaagtcttctaacatgcggtgacgtggaggagaatcccggccct。
[0046] In some embodiments, the specific bases of the IL2 promoter sequence are as shown in Seq. No. 4, specifically: acgccttctgtatgaaacagtttttcctccacgccttctgtatgaaacagtttttcctccacgccttctgtatgaaacagtttttcctccacgccttctgtatgaaacagtttttcc tccggggatctggcgcggtcccaggtccacttcgcatattaaggtgacgcgtgtggcctcgaacaccgagcgaccctgcagcgacccgcaagcttggcattccggtactgttggtaaa.
[0047] In some embodiments, the fluorescent protein sequence is selected from mCherry fluorescent protein.
[0048] In some embodiments, the specific bases of the mcherry sequence are as shown in Seq.No.5, specifically:.
[0049] In some embodiments, the step of cloning the CAR sequence, EGFP sequence, IL2 promoter sequence and fluorescent protein sequence into a vector to obtain a recombinant plasmid comprises:
[0050] The optimized CAR sequence and EGFP sequence were cloned into the pLenti-EF1A-MCS vector, and the two proteins were connected in series using the 2A co-expression system to achieve the effect of co-expression of CAR and EGFP (pLenti-EF1A-CAR-2A-EGFP). On this basis, the IL2 promoter sequence and fluorescent protein sequence were inserted into the pLenti-EF1A-CAR-2A-EGFP vector, which is pLenti-EF1A-CAR-2A-EGFP-pIL2-mcherry.
[0051] In step S02, the recombinant plasmid is packaged with a lentivirus to obtain a lentivirus precipitate containing the recombinant plasmid.
[0052] In some embodiments, the step of packaging the recombinant plasmid using a lentivirus to obtain a lentivirus precipitate containing the recombinant plasmid comprises:
[0053] G01. Providing an auxiliary plasmid, mixing the auxiliary plasmid with the recombinant plasmid to obtain a mixed plasmid;
[0054] G02. Providing 293T cells to be used, adding the mixed plasmid dropwise to the 293T cells to be used for transfection to obtain a supernatant;
[0055] G03. The supernatant is concentrated using a lentivirus concentrate and centrifuged to obtain a lentivirus precipitate containing the recombinant plasmid.
[0056] In step G01, a helper plasmid is provided, and the helper plasmid is mixed with the recombinant plasmid to obtain a mixed plasmid.
[0057] In some embodiments, the auxiliary plasmid is selected from PSPAX plasmid and PMD2G plasmid, and the mass ratio of the recombinant plasmid to the PSPAX plasmid and PMD2G plasmid is 4:3:2.
[0058] In some embodiments, the step of mixing the auxiliary plasmid with the recombinant plasmid to obtain a mixed plasmid further includes: providing a PEI transfection agent, and the ratio of the mass of the PEI transfection agent to the total mass of the auxiliary plasmid and the recombinant plasmid is 3:1; the PEI transfection agent, the auxiliary plasmid and the recombinant plasmid are evenly mixed, and allowed to stand for 15 to 20 minutes to obtain a mixed plasmid.
[0059] In step G02, 293T cells to be used are provided, and the mixed plasmid is added dropwise into the 293T cells to be used for transfection to obtain a supernatant.
[0060] In some embodiments, the 293T cells to be used are selected from 293T cells with a confluence of 80% to 90%.
[0061] In some embodiments, the step of adding the mixed plasmid dropwise to the stand-by 293T cells for transfection to obtain a supernatant includes: adding the mixed plasmid dropwise to the stand-by 293T cells, mixing for 8 to 9 hours, changing the liquid, and then performing transfection for 48 hours to obtain a supernatant.
[0062] In step G03, the supernatant is concentrated using a lentivirus concentrate and centrifuged to obtain a lentivirus precipitate containing the recombinant plasmid.
[0063] In some embodiments, the step of concentrating the supernatant with a lentivirus concentrate and centrifuging to obtain a lentivirus precipitate containing the recombinant plasmid includes: concentrating the supernatant with a 4-fold lentivirus concentrate at 4°C overnight, and then centrifuging at 4°C and 2000g / min for 30 minutes to obtain a lentivirus precipitate containing the recombinant plasmid.
[0064] In step S03, a T cell suspension is provided, and the lentiviral precipitate containing the recombinant plasmid is mixed and incubated with the T cell suspension to obtain CAR-T cells.
[0065] In some embodiments, the concentration of the T cell suspension is 1×10 6 cells / mL, and the volume ratio of the T cell suspension to the lentiviral precipitate containing the recombinant plasmid is 2mL:100μL.
[0066] In some embodiments, the step of mixing and incubating the lentiviral precipitate containing the recombinant plasmid with the T cell suspension includes: mixing and incubating the lentiviral precipitate containing the recombinant plasmid with the T cell suspension for 24 to 25 hours.
[0067] In step S04, the CAR-T cells are co-cultured with tumor cells, and then the activity of chimeric antigen receptor T cells is monitored in real time using a flow cytometer.
[0068] In some embodiments, the tumor cells are selected from HCT116 tumor cells.
[0069] In some embodiments, the CAR-T cells are co-cultured with tumor cells, and the step of using a flow cytometer to monitor the activity of chimeric antigen receptor T cells in real time includes: harvesting the co-cultured cells after 16 hours and 48 hours of co-culture, incubating the cells in the dark with a CD3 antibody for 30 minutes, harvesting the cells, and monitoring in real time using a flow cytometer.
[0070] The following describes the invention in conjunction with specific embodiments.
[0071] Example 1
[0072] A method for real-time monitoring of chimeric antigen receptor T cell activity
[0073] The specific steps are as follows:
[0074] 1. Vector design: The optimized CAR sequence (Seq.No.1) and EGFP sequence (Seq.No.2) were cloned into the pLenti-EF1A-MCS vector. The two proteins were connected in series using the 2A ((Seq.No.3) co-expression system to achieve the effect of CAR and EGFP co-expression (pLenti-EF1A-CAR-2A-EGFP). On this basis, we inserted the IL2 promoter ((Seq.No.4) and fluorescent protein (mcherry) sequence ((Seq.No.5)) into the pLenti-EF1A-CAR-2A-EGFP vector, which is pLenti-EF1A-CAR-2A-EGFP-pIL2-mcherry.
[0075] 2. Packaging of lentivirus: 293T cells were cultured to a confluency of 80-90%, and the cells were replaced with fresh culture medium (DMEM complete culture medium: 10% FBS, 1% double antibody). After 1 hour, the auxiliary plasmids (PMD2G and PSPAX) were mixed with pLenti-EF1A-CAR-2A-EGFP and pLenti-EF1A-CAR-2A-EGFP-pIL2-mcherry main plasmids in a ratio of 4:3:2 (main plasmid: PSPAX: PMD2G), and 3 times the mass ratio of PEI was added. After mixing, the mixture was allowed to stand for 15 minutes, and DNA / PEI was added dropwise to the cells. After 8 hours, the medium was changed, and the supernatant was harvested 48 hours after transfection. The supernatant was concentrated overnight at 4°C using 4X lentivirus concentrate, and the virus precipitate was obtained by centrifugation (2000g, 30 minutes, 4°C). It was resuspended in PBS and stored in aliquots at -80°C.
[0076] 3. Preparation of CAR-T cells: Jurkat cells are immortalized cell lines of human T cells and are a common model for studying human T cells. Harvest the suspended Jurkat cells, centrifuge (300g, 5 minutes), resuspend in fresh culture medium, count the cells, dilute the cells to 1×106 cells / mL, add 100ul of virus per 2mL of cells, return to the incubator, wash off the virus after 24 hours and continue to culture.
[0077] 4. Co-culture of CAR-T cells and tumor cells: Jurkat cells transfected with pLenti-EF1A-CAR-2A-EGFP virus and pLenti-EF1A-CAR-2A-EGFP-pIL2-mcherry virus were harvested, the cells were counted, 50,000 cells were taken out respectively, and placed in a culture dish, tumor cells HCT116 were harvested, and 10,000 tumor cells were added to the CAR-Jurkat cells respectively.
[0078] 5. Flow cytometry detection: The co-cultured cells were harvested at 16 hours and 48 hours of co-culture, and the cells were incubated with CD3 antibody (BD, UCHT1) in the dark for 30 minutes. The cells were harvested and cell clustering was detected using flow cytometry.
[0079] Results
[0080] The constructed CAR vector is as follows Figure 1 , Figure 2 As shown, Figure 1 This is a schematic diagram of the pLenti-EF1A-CAR-2A-EGFP vector. Figure 2 Schematic diagram of the pLenti-EF1A-CAR-2A-EGFP-pIL2-mcherry vector.
[0081] Jurkat cells, CAR-EGFP Jurkat cells, and CAR-EGFP-pIL2-mcherry Jurkat cells were co-cultured with tumor cells HCT116, respectively. As a control, an experimental group not co-cultured with tumor cells was set up, such as Figure 3 As shown, it can be found that Jurkat cells and CAR-EGFP Jurkat cells do not produce mcherry fluorescence regardless of whether they are in contact with tumor cells. CAR-EGFP-pIL2-mcherry Jurkat cells do not produce mcherry fluorescence when they are not co-cultured with tumor cells, that is, when they are not in contact with tumor antigens. However, after contacting tumors, CAR-EGFP-pIL2-mcherryJurkat cells emit mcherry fluorescence. The results show that the molecular strategy of CAR-EGFP-pIL2-mcherry can indicate the activation state of CAR-T after receiving antigens, and is an effective method for real-time monitoring of the activation state of CAR-T.
[0082] In summary, the present application provides a method for real-time monitoring of the activity of chimeric antigen receptor T cells, which utilizes a promoter of cytokine IL2 produced during the CAR-T activation process, and utilizes the expression of downstream fluorescent genes to indicate the activation of T cells. The activation of T cells can be observed in time by fluorescence observation; the method utilizes a CAR and EGFP co-expression system, uses EGFP to indicate the expression of CAR, and the fluorescent gene is used to display the activation state of T cells. The dual fluorescence system can accurately and real-time describe the activation state of CAR-T cells.
[0083] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present application should be included in the protection scope of the present application.
Claims
1. A method for real-time monitoring of chimeric antigen receptor T cell activity, characterized in that: The method comprises the following steps: cloning a CAR sequence, an EGFP sequence, an IL2 promoter sequence and a fluorescent protein sequence into a vector to obtain a recombinant plasmid; The recombinant plasmid is packaged using a lentivirus to obtain a lentivirus precipitate containing the recombinant plasmid; Providing a T cell suspension, mixing and incubating the lentiviral precipitate containing the recombinant plasmid with the T cell suspension to obtain CAR-T cells; The CAR-T cells are co-cultured with tumor cells, and the activity of chimeric antigen receptor T cells is monitored in real time using a flow cytometer.
2. The method for real-time monitoring of chimeric antigen receptor T cell activity according to claim 1, characterized in that: The fluorescent protein sequence is selected from mcherry fluorescent protein.
3. The method for real-time monitoring of chimeric antigen receptor T cell activity according to claim 1, characterized in that: The step of using a lentivirus to package the recombinant plasmid to obtain a lentivirus precipitate containing the recombinant plasmid includes: providing an auxiliary plasmid, and mixing the auxiliary plasmid with the recombinant plasmid to obtain a mixed plasmid; Providing 293T cells to be used, and adding the mixed plasmid dropwise into the 293T cells to be used for transfection to obtain a supernatant; The supernatant is concentrated using a lentivirus concentrate and centrifuged to obtain a lentivirus precipitate containing the recombinant plasmid.
4. The method for real-time monitoring of chimeric antigen receptor T cell activity according to claim 3, characterized in that: The auxiliary plasmid is selected from PSPAX plasmid and PMD2G plasmid, and the mass ratio of the recombinant plasmid to the PSPAX plasmid and the PMD2G plasmid is 4:3:2; And / or, the step of mixing the auxiliary plasmid with the recombinant plasmid to obtain a mixed plasmid also includes: providing a PEI transfection agent, and the ratio of the mass of the PEI transfection agent to the total mass of the auxiliary plasmid and the recombinant plasmid is 3:1; mixing the PEI transfection agent, the auxiliary plasmid and the recombinant plasmid evenly, and standing for 15 to 20 minutes to obtain a mixed plasmid.
5. The method for real-time monitoring of chimeric antigen receptor T cell activity according to claim 3, characterized in that: The 293T cells to be used are selected from 293T cells with a confluence of 80% to 90%; and / or, The step of adding the mixed plasmid dropwise to the standby 293T cells for transfection treatment to obtain a supernatant includes: adding the mixed plasmid dropwise to the standby 293T cells for mixing treatment for 8 to 9 hours, changing the solution, and then performing transfection treatment for 48 hours to obtain a supernatant.
6. The method for real-time monitoring of chimeric antigen receptor T cell activity according to claim 3, characterized in that: The step of concentrating the supernatant with a lentivirus concentrate and centrifuging to obtain a lentivirus precipitate containing the recombinant plasmid comprises: concentrating the supernatant with a 4-fold lentivirus concentrate at 4° C. overnight, and then centrifuging at 4° C. and 2000 g / min for 30 minutes to obtain a lentivirus precipitate containing the recombinant plasmid.
7. The method for real-time monitoring of chimeric antigen receptor T cell activity according to claim 1, characterized in that: The concentration of the T cell suspension is 1×10 6 cells / mL, and the volume ratio of the T cell suspension to the lentiviral precipitate containing the recombinant plasmid is 2mL:100μL.
8. The method for real-time monitoring of chimeric antigen receptor T cell activity according to claim 1, characterized in that: The step of mixing and incubating the lentiviral precipitate containing the recombinant plasmid with the T cell suspension includes: mixing and incubating the lentiviral precipitate containing the recombinant plasmid with the T cell suspension for 24 to 25 hours.
9. The method for real-time monitoring of chimeric antigen receptor T cell activity according to claim 1, characterized in that: The tumor cells are selected from HCT116 tumor cells.
10. The method for real-time monitoring of chimeric antigen receptor T cell activity according to claim 1, characterized in that: The step of co-culturing the CAR-T cells with tumor cells and monitoring the activity of chimeric antigen receptor T cells in real time using a flow cytometer includes: harvesting the co-cultured cells after 16 hours and 48 hours of co-culture, incubating the cells in the dark for 30 minutes using a CD3 antibody, harvesting the cells, and monitoring in real time using a flow cytometer.