EBER1 / 2 metal tag probe suitable for imaging mass spectrometry flow technology, preparation method and kit

Abstract

The invention discloses an EBER1 / 2 metal tag probe suitable for an imaging mass spectrometry flow technology, a preparation method and a kit. The method comprises the following steps: modifying an EBER1 / 2 detection probe, and then marking a metal tag. The metal-labeled detection probe is used for simultaneously detecting the expression of EBER1 / 2 for the first time, so that the metal-labeled detection probe can be applied to imaging mass spectrum flow type detection, and a result is completely consistent with a clinical diagnosis report. The method can help to accurately locate the position of the EBER positive cell, and is convenient and fast.

Description

Technical Field

[0001] The present invention relates to the field of probes, and in particular to an EBER1 / 2 metal label probe suitable for imaging mass spectrometry flow technology, a preparation method and a kit. Background Art

[0002] Epstein-Barr virus (EBV) belongs to human herpesvirus type 4 and is a lymphotropic virus that infects more than 90% of the world's population. EB virus has been classified as a Class I carcinogen by the International Agency for Research on Cancer because of its high infection and carcinogenicity rates. EB virus encodes two small non-polyadenylated RNAs (EBER1 and EBER2), which have 167 and 172 nucleotides respectively. They are RNAs encoded by EB virus that are not translated into proteins. Their main function is to inhibit interferon-mediated antiviral effects and apoptosis. EBERs are present in large numbers in cells latently infected with EB virus, with up to 10 per cell. 6 ~10 7 Copies are the best marker for latent EB virus infection.

[0003] The histological detection technology of EBER in situ hybridization on tissue biopsy sections is currently the gold standard for diagnosing EB virus infection. The general process of this technology is to heat the paraffin sections in antigen repair solution, and then sequentially undergo EBER probe hybridization, primary antibody, amplifier, secondary antibody, color development, hematoxylin and other reagents. The current color development methods mainly include enzyme labeling and immunofluorescence: the enzyme labeling method cannot be co-stained with other antigens; the immunofluorescence method is limited by the types of fluorescent dyes and the cross-color caused by fluorescence leakage, which easily leads to false positive results. Imaging mass spectrometry technology uses forty rare metal labeled antibodies to simultaneously detect dozens of proteins and RNAs on a tissue section and determine the spatial expression level at the single cell level. Therefore, the EBER1 / 2 metal label probe suitable for imaging mass spectrometry technology can help accurately locate the position of EBER positive cells, facilitate further research on their cell types, and more comprehensively and efficiently identify their biomarkers. The present invention is specially proposed. Summary of the invention

[0004] The purpose of the present invention is to provide an EBER1 / 2 metal label probe suitable for imaging mass spectrometry flow technology, which can help accurately locate the position of EBER positive cells, facilitate further research on their cell types, and identify their biomarkers more comprehensively and efficiently. Convenient and fast.

[0005] To achieve the above object, the present invention provides an EBER1 / 2 metal label probe suitable for imaging mass spectrometry flow technology, characterized in that the EBER1 / 2 detection probe is modified and then labeled with a metal label.

[0006] Furthermore, the nucleic acid sequence of the EBER1 detection probe is shown in SEQ ID NO:1, and the nucleic acid sequence of the EBER2 detection probe is shown in SEQ ID NO:2.

[0007] Further, the modification is 5'Thiol-Modifier C6 SS, and / or the metal tag is 141Pr, 142Nd, 143Nd, 144Nd, 145Nd, 146Nd, 147Sm, 148Nd, 149Sm, 150Nd, 151Eu, 152Sm, 153Eu, 154Sm, 155Gd, 156Gd, 157Gb, 158Gd, 159Tb, 160Gd, 161Dy, 162Dy, 163Dy, 164Dy, 165Ho, 166Er, 167Er, 168Er, 169Tm, 170Er, 171Yb, 172Yb, 173Yb, 174Yb, 175Lu or 176Yb.

[0008] Further, the preparation method comprises:

[0009] A1. Thiol reduction of nucleic acids: Prepare a 250±20μM solution of the modified EBER1 / 2 detection probe with 50±5mM TCEP-DEPC water and place at room temperature for 30±5min; then add pre-cooled ethanol and mix thoroughly. Preferably, the volume of pre-cooled ethanol is 2±0.5 times the volume of TCEP-DEPC water; place at 4±1℃ for 30±5min; remove the supernatant after the first centrifugation, add 70±5% ethanol, remove the supernatant after the second centrifugation; resuspend the precipitate in Maxpar C-Buffer;

[0010] Preferably, the thiol reduction of nucleic acid is as follows: after centrifuging the FISH-DP-EBER1 / 2 probe at 2000r / 2min, 100μL of 50mM TCEP-DEPC water is added to prepare a 250μM solution, and the mixture is reacted at room temperature for 30min; then 2 times the volume (200μL) of pre-cooled ethanol is added to mix well, and the mixture is placed at 4°C for 30min; the mixture is centrifuged at 12,000g for 10min again, 500μL of 70% ethanol is added after the supernatant is removed, and the mixture is centrifuged at 12000g for 2min, and the supernatant is removed again; after the residual liquid evaporates to dryness, the dried oligonucleotide is resuspended in 50μL Maxpar C-Buffer;

[0011] A2. Preload 154Sm element in the polymer: Resuspend Maxpar Polymer with Maxpar L-Buffer, then add Maxpar 154Sm solution and mix well to make the final concentration of Maxpar 154Sm 2.5±0.5mM; incubate at 37±5℃ for 30-40 minutes;

[0012] The A1 and A2 steps can be performed in reverse order or simultaneously.

[0013] A3. Purify the polymer loaded with 154Sm: Add Maxpar L-Buffer and the product obtained in step A2 to a 3 kDa filter; centrifuge at room temperature; discard the waste liquid, add Maxpar C-Buffer to the filter, and centrifuge to obtain a precipitate;

[0014] Preferably, the polymer loaded with 154Sm is purified by: adding Maxpar L-Buffer and the product obtained in step A2 to a 3kDa filter; preferably, the volume ratio of Maxpar L-Buffer to the product obtained in step A2 is 1:19; centrifuging at 12,000±500g for 25±5 minutes at room temperature; discarding the waste liquid, adding Maxpar C-Buffer to the filter, and centrifuging at 12,000±500g for 30±10 minutes at room temperature to obtain a precipitate of the polymer loaded with 154Sm;

[0015] A4. Conjugation of nucleic acid and lanthanide polymer: resuspend the polymer loaded with 154Sm obtained in A3 in Maxpar C-Buffer; mix it with an equal volume obtained in A1 and incubate at room temperature; then add 0.5±0.1M TCEP to a final concentration of 5±0.5mM and incubate to reduce unconjugated oligonucleotides; then add DEPC water and centrifuge in a 30kda centrifugal filter device to discard the supernatant, and then dissolve it with DEPC water;

[0016] Preferably, the coupling of nucleic acid and lanthanide polymer is as follows: resuspending the polymer loaded with 154Sm obtained in A3 in MaxparC-Buffer; mixing it with an equal volume obtained in A1, and incubating at room temperature for 2±0.5h; then adding 0.5±0.1M TCEP to a final concentration of 5±0.5mM, incubating for 30±10min to reduce unconjugated oligonucleotides; then adding DEPC water and centrifuging in a 30kda centrifugal filter device, 14000±200g for 12±5 minutes, repeating 2±1 times, and then dissolving with DEPC water.

[0017] The present invention also protects a kit, characterized in that it contains the EBER1 / 2 metal label probe.

[0018] The present invention also protects a method for accurately locating the position of EBER-positive cells, characterized in that the EBER1 / 2 metal label probe or the kit is used.

[0019] The present invention also protects a pre-treatment method for accurately locating the position of EBER positive cells using an imaging mass spectrometer, characterized in that it comprises the following steps:

[0020] B1. Pre-treatment of formalin-fixed stone-embedded tissue sections:

[0021] The paraffin tissue sections to be tested were dried at room temperature, and then baked in an oven at 65±5℃ for 30-60min; the sections were taken out and immersed in xylene at room temperature for dewaxing for 15±1min and 10±1min respectively, and the sections were moved up and down from time to time to ensure sufficient dewaxing; the sections were slowly taken out, immersed in ultrapure water, and allowed to stand at room temperature for 10±1sec; immediately immersed in 100% alcohol after taking out, allowed to stand for 2±1min, and then taken out; the sections were slowly immersed in preheated 1X target repair solution, maintained at 90±5℃, and repaired for 15±3min; after the sections were dried, a hydrophobic circle was drawn around the tissue with an immunohistochemistry pen; after the hydrophobic circle was dried, WashBuffer was added, allowed to stand for 10±1sec, and then the liquid was discarded, and this was repeated several times; 4±1% PFA was added to the hydrophobic circle, allowed to stand for 10±1min, the liquid in the hydrophobic circle was aspirated, and then WashBuffer was added, allowed to stand for 10±1sec, and then the liquid was discarded, and this was repeated several times, and the last WashBuffer was retained; the Wash in the hydrophobic circle was aspirated Add 0.3±0.1mg / mL pepsin solution diluted with 0.7±0.1MHCL to the buffer; place in a wet box and permeabilize in a constant temperature incubator at 42±2℃ for 30-60min; after permeabilization, aspirate the liquid in the hydrophobic circle, add WashBuffer, let stand for 10±1sec and then discard the liquid, repeat several times, and keep the last WashBuffer;

[0022] B2. Probe hybridization:

[0023] Aspirate the liquid in the hydrophobic circle, then immediately add the first reaction solution, place in a wet box, and hybridize in a 42±2℃ constant temperature incubator for 4h; after the reaction is completed, aspirate the liquid in the hydrophobic circle, then immediately add Wash Buffer, let it stand for 10±1sec and then discard the liquid, repeat the washing several times, and keep the last Wash Buffer;

[0024] The first reaction solution is prepared as follows: based on a 50 μL system, 15 μL of Nuclease-free Water, 25 μL of Hyb Buffer 1, 5 μL of PG, 2.5 μL of FISH Probe-Hsa-EBER1, and 2.5 μL of FISH Probe-Hsa-EBER2;

[0025] B3. Post-hybridization cleaning:

[0026] Vortex and centrifuge the Hyb Wash Buffer, aspirate the liquid in the hydrophobic circle, immediately add Hyb Wash Buffer, place in a wet box, incubate in a constant temperature incubator at 42±2℃ for 5±1min, and repeat the wash several times; after the reaction is completed, aspirate the liquid in the hydrophobic circle, immediately add Wash Buffer, let it stand for 10±1sec, then discard the liquid, repeat the wash several times, and keep the last Wash Buffer; B4. Probe ringing:

[0027] Vortex and mix well, centrifuge; aspirate the liquid in the hydrophobic circle and immediately add the second reaction solution, place in a wet box, and react in a 42±2℃ constant temperature incubator for 0.5±0.1h; after the reaction, aspirate the liquid in the hydrophobic circle and immediately add Wash Buffer, let it stand for 10±1sec and then discard the liquid, repeat the washing several times, and keep the last Wash Buffer;

[0028] The second reaction solution was prepared as follows: based on a 50 μL system, 12.5 μL of Nuclease-free Water, 25 μL of B1, 5 μL of PG, 2.5 μL of ST, and 5 μL of E1;

[0029] B5. Rolling circle amplification:

[0030] Vortex and mix well, centrifuge; aspirate the liquid in the hydrophobic circle and immediately add the third reaction solution, place in a wet box, and react in a 42±2℃ constant temperature incubator for 2±0.5h; after the reaction, aspirate the liquid in the hydrophobic circle and immediately add Wash Buffer, let it stand for 10±1sec, then discard the liquid, repeat the washing several times, and keep the last Wash Buffer;

[0031] The third reaction solution is prepared as follows: based on a 50 μL system, 23 μL of Nuclease-free Water, 25 μL of B2, and 2 μL of E2;

[0032] B6. Metal tag probe hybridization:

[0033] Vortex and mix well, centrifuge; suck out the liquid in the hydrophobic circle and immediately add the fourth reaction solution, place in a wet box, and react in a 42±2℃ constant temperature incubator for 0.5±0.1h; after the reaction, suck out the liquid in the hydrophobic circle and immediately add WashBuffer, let it stand for 10±1sec, then discard the liquid, and repeat the washing several times;

[0034] The fourth reaction solution is prepared as follows: based on a 50 μL system, 22.5 μL of Nuclease-free Water, 25 μL of Hyb Buffer 2, and 2.5 μL of EBER1 / 2 metal label probe; the EBER1 / 2 metal label probe is obtained by modifying the EBER1 / 2 detection probe and then labeling it with a metal label; preferably, the metal label is 141Pr, 142Nd, 143Nd, 144Nd, 145Nd, 146Nd, 147Sm, 148Nd, 149Sm, 150Nd, 151Eu, 15 2Sm, 153Eu, 154Sm, 155Gd, 156Gd, 157Gb, 158Gd, 159Tb, 160Gd, 161Dy, 162Dy, 163Dy, 164D y, 165Ho, 166Er, 167Er, 168Er, 169Tm, 170Er, 171Yb, 172Yb, 173Yb, 174Yb, 175Lu or 176Yb;

[0035] B7.DNA markers:

[0036] After the liquid in the hydrophobic circle is sucked out, the fifth reaction solution is immediately added, and the mixture is placed in a wet box and reacted at room temperature for 0.5±0.1 hours; the mixture is rinsed with ddH20 for 5±1 minutes, and the slide is air-dried at room temperature and then detected by an imaging mass spectrometer to determine the location of EBER-positive cells; preferably, the mixture is dried for at least 20 minutes;

[0037] Preparation of the fifth reaction solution: Dilute Ir-Intercalator 1:400 with DPBS buffer at room temperature, vortex and centrifuge.

[0038] One of the innovations of the present invention is that: for the first time, metal-labeled detection probes are used to simultaneously detect the expression of EBER1 / 2, so that it can be applied to imaging mass spectrometry flow detection.

[0039] The metal label probe kit suitable for detecting EBER gene by imaging mass spectrometry flow cytometry of the present invention comprises:

[0040] Ir-Intercalator (Fluidigm, 201192A);

[0041] Deyun Kangrui FISH RNA Fluorescence in situ hybridization kit (SP1003-T):

[0042] EBER1 detection probe (FISH Prob-Hsa-EBER1), the sequence is:

[0043] TGCCGTCTTCGGTCAAGTACCAGCTGGTGGTC SEQ ID NO: 1;

[0044] EBER2 detection probe (FISH Prob-Hsa-EBER2), the sequence is:

[0045] CCTAGAGCATTTGCAAGTCAGGATTCTCTAAT SEQ ID NO:2;

[0046] EBER1 / 2 labeled probe (i.e., FISH-DP-EBER1 / 2 probe, or, FISH-DP-EBER1 or FISH-DP-EBER2 probe): obtained by modifying the above-mentioned EBER1 / 2 detection probe, wherein the modification method is 5' Thiol-Modifier C6 SS;

[0047] EBER1 / 2 metal-labeled probe (FISH DP-154Sm-EBER1 / 2): The above-mentioned EBER1 / 2 labeled probe is labeled with 154Sm. The metal label of the EBER1 / 2 belt of the present invention can also be other metals, not limited to 141Pr, 142Nd, 143Nd, 144Nd, 145Nd, 146Nd, 147Sm, 148Nd, 149Sm, 150Nd, 151Eu, 152Sm, 153Eu, 154Sm, 155Gd, 156Gd, 157Gb, 158Gd, 159Tb, 160Gd, 161Dy, 162Dy, 163Dy, 164Dy, 165Ho, 166Er, 167Er, 168Er, 169Tm, 170Er, 171Yb, 172Yb, 173Yb, 174Yb, 175Lu or 176Yb.

[0048] The rest of the reagents were from Deyun Kangrui Products in FISH RNA Fluorescence in situ hybridization kit.

[0049] The preparation method of FISH DP-154Sm-EBER1 / 2 is as follows:

[0050] The main reagents and consumables required are:

[0051] 1. Metal label kit: X8Antibody Labeling Kit,154Sm—4Rxn (Fluidigm, 201154A);

[0052] 2. Centrifugal filter: ULtra filter, 3 kDa MWCO (Merck Millipore, UFC5003);

[0053] 3. Centrifugal filter: Centrifugal ultrafiltration tube, NMWCO 30 kDa (Merck Millipore, MRCF0R030);

[0054] 4.0.5 M TCEP: Bond-Breaker TM TCEP solution (Pierce Cat#77720).

[0055] The first step is the reduction of thiol of nucleic acid: after centrifuging the FISH-DP-EBER1 / 2 probe at 2000r / 2min, add 100μL of 50mM TCEP-DEPC water to make a 250μM solution, and react at room temperature for 30min; then add 2 times the volume (200μL) of pre-cooled ethanol to mix thoroughly, and place at 4℃ for 30min; centrifuge again at 12,000g for 10min, remove the supernatant, add 500μL of 70% ethanol, centrifuge at 12000g for 2min, and remove the supernatant again; after the residual liquid evaporates to dryness, resuspend the dried oligonucleotide in 50μL Maxpar C-Buffer. The specific operation steps can be:

[0056] Required reagents: Preparation of 250 μM TCEP-DEPC water: Add 20 μL 0.5 M TCEP to 180 μL DEPC water.

[0057] 1. After centrifugation at 2000r / 2min, add 100μL of 50mM TCEP-DEPC water (10μL 0.5MTCEP added to 90μL DEPC water) to detect the concentration, prepare a 250μM solution, and react at room temperature for 30min;

[0058] 2. Add 2 times the volume (200 μL) of pre-cooled ethanol, mix thoroughly, and place at 4°C for 30 min;

[0059] 3. Centrifuge at 12,000 g for 10 min, carefully remove the supernatant, and remove all droplets on the tube wall;

[0060] 4. Add 500 μL of 70% ethanol to the precipitate, centrifuge at 12000 g for 2 min, carefully remove the supernatant, and remove all droplets on the tube wall;

[0061] 5. Place the opened centrifuge tube on the laboratory table at room temperature to allow the remaining liquid to evaporate to dryness;

[0062] 6. Resuspend the dried oligonucleotide in 50 μL Maxpar C-Buffer and measure the concentration.

[0063] The second step is to preload the polymer with 154Sm element: use 95 μL Maxpar L-Buffer (see X8Antibody Labeling Kit) to resuspend Maxpar Polymer and mix well; then add 5μL Maxpar 154Sm (see X8 Antibody Labeling Kit) solution (final concentration is 2.5mM), mix well; incubate at 37℃ for 30-40 minutes; the specific operation steps can be:

[0064] 1. Spin the Maxpar Polymer in a microcentrifuge (see X8Antibody Labeling Kit) tube for 10 seconds to ensure that the reagent is at the bottom of the tube;

[0065] 2. Resuspend Maxpar Polymer with 95 μL Maxpar L-Buffer and mix well with a pipette;

[0066] 3. Add 5 μL of Maxpar 154Sm solution (final concentration 2.5 mM) to the test tube and mix well with a pipette;

[0067] Incubate at 437°C for 30-40 min.

[0068] The third step is to purify the polymer loaded with 154Sm: add 200μL Maxpar L-Buffer to the 3kDa filter; then continue to add the polymer mixture loaded with 154Sm; centrifuge at 12,000g for 25 minutes at room temperature; add 300μL Maxpar C-Buffer to the filter, and centrifuge at 12,000g for 30 minutes at room temperature. The specific operation steps can be:

[0069] 1. Add 200 μL Maxpar L-Buffer to the 3 kDa filter;

[0070] 2. Add the 154Sm-loaded polymer mixture obtained in the second step to the filter containing Maxpar L-Buffer;

[0071] 3. Centrifuge at 12,000 g for 25 minutes at room temperature and discard the waste liquid in the collection tube;

[0072] 4. Add 300 μL Maxpar C-Buffer (see X8 Antibody Labeling Kit), centrifuge at 12,000g for 30 minutes at room temperature.

[0073] Step 4: Couple nucleic acid with lanthanide polymer: Resuspend the polymer loaded with 154Sm in 50μL Maxpar C-Buffer; transfer it to the oligonucleotide resuspended in 50μL Maxpar C-Buffer in the first step, mix well, and incubate at room temperature for 2h; then add 1μL 0.5M TCEP to a final concentration of 5mM, incubate for 30min to reduce unconjugated oligonucleotides; then add 500μL DEPC water and centrifuge in a 30kda centrifugal filter device, 14000g for 12 minutes, repeat twice. Dissolve it with DEPC water, adjust the concentration to 1μM and store at 4 degrees. The specific operation steps can be:

[0074] 1. Use a pipette to resuspend the 154Sm-loaded polymer in 50 μL Maxpar C-Buffer;

[0075] 2. Transfer the resuspended 154Sm polymer to the oligonucleotide resuspended in 50ul Maxpar C-Buffer in the first step;

[0076] 3. Pipette mix well and incubate at room temperature for 2 hours;

[0077] 4. Add 1 μL 0.5 M TCEP to a final concentration of 5 mM and incubate for 30 min to reduce unconjugated oligonucleotides;

[0078] 5. Add 100 μL of the incubated conjugate to a 30 kDa centrifugal filter device, add 500 μL of DEPC water, centrifuge at 14000 g for 12 minutes, and repeat twice;

[0079] 6. Dissolve in DEPC water, adjust the concentration to 1uM and store at 4 degrees. BRIEF DESCRIPTION OF THE DRAWINGS

[0080] Figure 1 This is a diagram of the experimental results of Example 2.

[0081] Figure 2 This is a diagram of the experimental results of Example 3.

[0082] Figure 3 This is a diagram of the experimental results of Example 4. DETAILED DESCRIPTION

[0083] Embodiments of the present invention are described in detail below, and the examples of the embodiments are shown in the accompanying drawings, wherein the same or similar reference numerals represent the same or similar elements or elements with the same or similar functions from beginning to end. The embodiments described below by reference to the accompanying drawings are exemplary, are intended to be used to explain the present invention, and are not to be construed as limitations of the present invention. Those who do not indicate specific techniques or conditions in the embodiments are carried out according to the techniques or conditions described in the documents in this area or according to the product specification. Those who do not indicate the manufacturer of reagents or instruments used are all conventional products that can be obtained commercially.

[0084] The method for using the EBER1 / 2 metal label probe kit for simultaneous detection of EBER1 / 2 genes by imaging mass spectrometry flow cytometry comprises the following steps:

[0085] S1. Pretreatment of Formalin-Fixed Stone Embedded Tissue Sections

[0086] 1. Baking: restore the paraffin tissue sections to room temperature and dry them, then bake them in a 65°C oven for 30-60 minutes;

[0087] 2. Preheat 1x target repair solution: Preheat 1x target repair solution (see Deyun Kangrui Company FISH RNA Fluorescence in situ hybridization kit) into a plastic vertical staining bottle, the height must be completely covered with tissue; set the water bath to 90℃, and place the vertical staining bottle in it to preheat for use;

[0088] 3. Dewaxing: Take out the slices and immerse them in two cylinders of xylene at room temperature for 15 minutes and 10 minutes respectively. Move the slices up and down from time to time to ensure sufficient dewaxing.

[0089] 4. Drying: Slowly take out the slices, immerse them in ultrapure water, and let them stand at room temperature for 10 seconds; immediately immerse them in 100% alcohol and let them stand for 2 minutes before taking them out;

[0090] 5. Repair: Slowly immerse the slices in preheated 1X target repair wave, maintain 90°C, and repair for 15 minutes;

[0091] 6. Draw a hydrophobic circle: After the slices are dried, use an immunohistochemistry pen (Bikman (BKMAM 130410116)) to draw a hydrophobic circle around the tissue;

[0092] 7. Preheat hydrochloric acid: add 900 μL 0.1 M HCL into a 15 mL centrifuge tube and preheat in a 42°C constant temperature incubator for later use;

[0093] 8. Washing: After the hydrophobic ring is dry, add 50L Wash Buffer (see Deyun Kangrui Company FISH RNA fluorescence in situ hybridization kit), let it stand for 10 seconds and then discard the solution, repeat 3 times;

[0094] 9. Fixation: Add 50μL 4% PFA to the hydrophobic circle, let stand for 10 minutes, aspirate the liquid in the hydrophobic circle and add 50μL Wash Buffer, let stand for 10 seconds and then discard the liquid, repeat 3 times, and keep the last Wash Buffer;

[0095] 10. Permeabilization: Add 100 μL of 3 mg / mL pepsin stock solution (Aladdin P651994-25g) to 900 μL of preheated 0.7 M HCL to make the final concentration of pepsin 0.3 mg / mL, vortex and centrifuge; aspirate the Wash Buffer in the hydrophobic circle and add the diluted pepsin solution; place in a wet box (covered) and permeabilize in a 42°C constant temperature incubator for 30-60 minutes; (Due to tissue heterogeneity, the pepsin treatment time varies and can be adjusted according to actual conditions, but too long / too short digestion time may cause problems such as changes in cell morphology or reduction of signal points. 30 minutes is recommended for initial experiments.)

[0096] 11. Washing: After permeabilization, aspirate the liquid in the hydrophobic circle, add 50 μL Wash Buffer, let it stand for 10 seconds and then discard the liquid. Repeat 3 times and keep the last Wash Buffer.

[0097] S2. Probe Hybridization

[0098] Preparation of the first reaction solution of the 50 μL system: Nuclease-free Water (15 μL), Hyb Buffer 1 (vortex and centrifuge, 25 μL), PG (vortex and centrifuge after full thawing, 5 μL), FISH Probe-Hsa-EBER1 (vortex and centrifuge after full thawing, 2.5 μL), FISH Probe-Hsa-EBER2 (vortex and centrifuge after full thawing, 2.5 μL); (all from Deyun Kangrui Company FISH RNA fluorescence in situ hybridization kit).

[0099] 1. Vortex and mix thoroughly, centrifuge; aspirate the liquid in the hydrophobic circle, then immediately add the first reaction solution, place in a wet box (close the lid tightly), and hybridize in a 42°C constant temperature incubator for 4 hours;

[0100] 2. After the reaction is completed, aspirate the liquid in the hydrophobic circle and immediately add 50μL Wash Buffer. Let it stand for 10 seconds and then discard the liquid. Wash 3 times in total and keep the last Wash Buffer.

[0101] S3. Post-hybridization washing

[0102] 1. Add Hyb Wash Buffer (see Deyun Kangrui Company's FISH RNA Fluorescence in situ hybridization kit) was vortexed and centrifuged, the liquid in the hydrophobic circle was aspirated, and 50 μL Hyb Wash Buffer was immediately added, and the sample was placed in a wet box (with a cover, no need to cover tightly), and incubated in a 42°C constant temperature incubator for 5 minutes, and washed 3 times in total;

[0103] 2. After the reaction is completed, aspirate the liquid in the hydrophobic circle and immediately add 50μL Wash Buffer. Let it stand for 10 seconds and then discard the liquid. Wash 3 times in total and keep the last Wash Buffer.

[0104] S4. Probe Circling

[0105] Preparation of the second reaction solution of the 50 μL system: Nuclease-free Water (12.5 μL), B1 (vortexed and centrifuged after full thawing, 25 μL), PG (vortexed and centrifuged after full thawing, 5 μL), ST (vortexed and centrifuged after full thawing, 2.5 μL), E1 (flash centrifuged after full thawing, 5 μL), (the ingredients are all from Deyun Kangrui Company FISH RNA Fluorescence in situ hybridization kit).

[0106] 1. Vortex and mix thoroughly; add the second reaction solution immediately after aspirating the liquid in the hydrophobic circle, place in a wet box (close the lid tightly), and react in a 42℃ constant temperature incubator for 0.5h

[0107] 2. After the reaction is completed, aspirate the liquid in the hydrophobic circle and immediately add 50μL Wash Buffer. Let it stand for 10 seconds and then discard the liquid. Wash 3 times in total and keep the last Wash Buffer.

[0108] S5. Rolling Circle Amplification

[0109] Configuration of the third reaction solution of the 50μL system: Nuclease-free Water (23μL), B2 (vortexed and centrifuged after full thawing, 25μL), E2 (flash centrifuged after full thawing, 2μL), (the ingredients are all from Deyun Kangrui Company FISH RNA fluorescence in situ hybridization kit).

[0110] 1. Vortex and mix thoroughly by centrifugation; aspirate the liquid in the hydrophobic circle and add the third reaction solution immediately, place in a wet box (close the lid tightly), and react in a 42℃ constant temperature incubator for 2 hours

[0111] 2. After the reaction is completed, aspirate the liquid in the hydrophobic circle and immediately add 50μL Wash Buffer. Let it stand for 10 seconds and then discard the liquid. Wash 3 times in total and keep the last Wash Buffer.

[0112] This can be used as a pause point for the experiment. While retaining the Wash Buffer in the hydrophobic circle, the slices can be placed in a humidified box (with the lid tightly closed) and stored at 4°C for about a week.

[0113] S6. Metal-labeled probe hybridization

[0114] Configuration of the fourth reaction solution of the 50 μL system: Nuclease-free Water (22.5 μL), Hyb Buffer 2 (vortex shaking centrifugation, 25 μL) (see Deyun Kangrui Company FISH RNA fluorescence in situ hybridization kit), EBER1 / 2 metal label probe (vortex shaking centrifugation, 2.5μL); the EBER1 / 2 metal label probe is the EBER1 / 2 detection probe modified and then labeled with a metal label; preferably, the metal label is 141Pr, 142Nd, 143Nd, 144Nd, 145Nd, 146Nd, 147Sm, 148Nd, 149Sm, 150Nd, 1 51Eu, 152Sm, 153Eu, 154Sm, 155Gd, 156Gd, 157Gb, 158Gd, 159Tb, 160Gd, 161Dy, 162Dy, 163Dy, 164Dy, 165Ho, 166Er, 167Er, 168Er, 169Tm, 170Er, 171Yb, 172Yb, 173Yb, 174Yb, 175Lu or 176Yb;

[0115] 1. Vortex and mix thoroughly by centrifugation; immediately add the fourth reaction solution after aspirating the liquid in the hydrophobic circle, place in a wet box (close the lid tightly), and react in a 42°C constant temperature incubator for 0.5h;

[0116] 2. After the reaction is completed, aspirate the liquid in the hydrophobic circle and immediately add 50μL Wash Buffer. Let it stand for 10 seconds and then discard the liquid. Wash 3 times in total;

[0117] S7. DNA labeling

[0118] Preparation of the fifth reaction solution: dilute Ir-Intercalator (Flμidigm, 201192A) with DPBS buffer at 1:400 at room temperature, vortex and centrifuge;

[0119] 1. After sucking out the liquid in the hydrophobic circle, add the fifth reaction solution immediately, place it in a wet box (close the lid tightly), and react at room temperature for 0.5 hours;

[0120] 2. Rinse in ddH20 for 5 min and air dry the slides at room temperature for at least 20 min.

[0121] Afterwards, the EBER and DNA signals can be detected using imaging mass cytometry.

[0122] Example 1: Preparation of EBER1 / 2 metal label probe (FISH DP-154Sm-EBER1 / 2)

[0123] The EBER1 / 2 metal label probe kit suitable for detecting the EBER gene by an imaging mass spectrometer of the present invention comprises:

[0124] Ir-Intercalator (Fluidigm, 201192A);

[0125] Deyun Kangrui FISH RNA Fluorescence in situ hybridization kit (SP1003-T):

[0126] EBER1 detection probe (FISH Prob-Hsa-EBER1), the sequence is:

[0127] TGCCGTCTTCGGTCAAGTACCAGCTGGTGGTC SEQ ID NO: 1;

[0128] EBER2 detection probe (FISH Prob-Hsa-EBER2), the sequence is:

[0129] CCTAGAGCATTTGCAAGTCAGGATTCTCTAAT SEQ ID NO:2;

[0130] EBER1 / 2 labeled probe (FISH-DP-EBER1 / 2 probe): obtained by modifying the above EBER1 / 2 detection probe, and the modification method is 5'Thiol-Modifier C6 SS;

[0131] EBER1 / 2 metal-labeled probe (FISH DP-154Sm-EBER1 / 2): The above-mentioned EBER1 / 2 labeled probe is labeled with 154Sm. The metal label of the EBER1 / 2 belt of the present invention can also be other metals, not limited to 141Pr, 142Nd, 143Nd, 144Nd, 145Nd, 146Nd, 147Sm, 148Nd, 149Sm, 150Nd, 151Eu, 152Sm, 153Eu, 154Sm, 155Gd, 156Gd, 157Gb, 158Gd, 159Tb, 160Gd, 161Dy, 162Dy, 163Dy, 164Dy, 165Ho, 166Er, 167Er, 168Er, 169Tm, 170Er, 171Yb, 172Yb, 173Yb, 174Yb, 175Lu or 176Yb.

[0132] The rest of the reagents were from Deyun Kangrui Products in FISH RNA Fluorescence in situ hybridization kit.

[0133] The preparation method of FISH DP-154Sm-EBER1 / 2 is as follows:

[0134] The main reagents and consumables required are:

[0135] 1. Metal label kit: X8Antibody Labeling Kit,154Sm—4Rxn (Fluidigm, 201154A);

[0136] 2. Centrifugal filter: ULtra filter, 3 kDa MWCO (Merck Millipore, UFC5003);

[0137] 3. Centrifugal filter: Centrifugal ultrafiltration tube, NMWCO 30 kDa (Merck Millipore, MRCF0R030);

[0138] 4.0.5 M TCEP: Bond-Breaker TM TCEP solution (Pierce Cat#77720).

[0139] Step 1. Thiol reduction of nucleic acids: After centrifuging the FISH-DP-EBER1 / 2 probe at 2000r / 2min, add 100μL of 50mM TCEP-DEPC water to make a 250μM solution and react at room temperature for 30min; then add 2 times the volume (200μL) of pre-cooled ethanol to mix thoroughly and place at 4°C for 30min; centrifuge again at 12,000g for 10min, remove the supernatant and add 500μL of 70% ethanol, centrifuge at 12000g for 2min, remove the supernatant again; after the residual liquid evaporates to dryness, resuspend the dried oligonucleotide in 50μL Maxpar C-Buffer. The specific operation steps can be:

[0140] Required reagents: Preparation of 250 μM TCEP-DEPC water: Add 20 μL 0.5 M TCEP to 180 μL DEPC water.

[0141] 1. After centrifugation at 2000r / 2min, add 100μL of 50mM TCEP-DEPC water (10μL 0.5MTCEP added to 90μL DEPC water) to detect the concentration, prepare a 250μM solution, and react at room temperature for 30min;

[0142] 2. Add 2 times the volume (200 μL) of pre-cooled ethanol, mix thoroughly, and place at 4°C for 30 min;

[0143] 3. Centrifuge at 12,000 g for 10 min, carefully remove the supernatant, and remove all droplets on the tube wall;

[0144] 4. Add 500 μL of 70% ethanol to the precipitate, centrifuge at 12000 g for 2 min, carefully remove the supernatant, and remove all droplets on the tube wall;

[0145] 5. Place the opened centrifuge tube on the laboratory table at room temperature to allow the remaining liquid to evaporate to dryness;

[0146] 6. Resuspend the dried oligonucleotide in 50 μL Maxpar C-Buffer and measure the concentration.

[0147] Step 2. Preload the polymer with 154Sm element: Use 95 μL Maxpar L-Buffer (see X8Antibody Labeling Kit) to resuspend Maxpar Polymer and mix well; then add 5μL Maxpar 154Sm (see X8 Antibody Labeling Kit) solution (final concentration is 2.5mM), mix well; incubate at 37℃ for 30-40 minutes; the specific operation steps can be:

[0148] 1. Spin the Maxpar Polymer in a microcentrifuge (see X8Antibody Labeling Kit) tube for 10 seconds to ensure that the reagent is at the bottom of the tube;

[0149] 2. Resuspend Maxpar Polymer with 95 μL Maxpar L-Buffer and mix well with a pipette;

[0150] 3. Add 5 μL of Maxpar 154Sm solution (final concentration 2.5 mM) to the test tube and mix well with a pipette;

[0151] Incubate at 37°C for 30-40 min.

[0152] Step 3. Purify the polymer loaded with 154Sm: Add 200μL Maxpar L-Buffer to the 3kDa filter; then continue to add the polymer mixture loaded with 154Sm; centrifuge at 12,000g for 25 minutes at room temperature; add 300μL Maxpar C-Buffer to the filter, and centrifuge at 12,000g for 30 minutes at room temperature. The specific operation steps can be:

[0153] 1. Add 200 μL Maxpar L-Buffer to the 3 kDa filter;

[0154] 2. Add the 154Sm-loaded polymer mixture obtained in the second step to the filter containing Maxpar L-Buffer;

[0155] 3. Centrifuge at 12,000 g for 25 minutes at room temperature and discard the waste liquid in the collection tube;

[0156] 4. Add 300 μL Maxpar C-Buffer (see X8 Antibody Labeling Kit), centrifuge at 12,000g for 30 minutes at room temperature.

[0157] Step 4. Coupling nucleic acid and lanthanide polymer: Resuspend the polymer loaded with 154Sm in 50μL Maxpar C-Buffer; transfer it to the oligonucleotide resuspended in 50μL Maxpar C-Buffer in the first step, mix well, and incubate at room temperature for 2h; then add 1μL 0.5M TCEP to a final concentration of 5mM, incubate for 30min to reduce unconjugated oligonucleotides; then add 500μL DEPC water and centrifuge in a 30kda centrifugal filter device, 14000g for 12 minutes, repeat twice. Dissolve it with DEPC water again, adjust the concentration to 1μM and store at 4 degrees. The specific operation steps can be:

[0158] 1. Use a pipette to resuspend the 154Sm-loaded polymer in 50 μL Maxpar C-Buffer;

[0159] 2. Transfer the resuspended 154Sm polymer to the oligonucleotide resuspended in 50ul Maxpar C-Buffer in the first step;

[0160] 3. Pipette mix well and incubate at room temperature for 2 hours;

[0161] 4. Add 1 μL 0.5 M TCEP to a final concentration of 5 mM and incubate for 30 min to reduce unconjugated oligonucleotides;

[0162] 5. Add 100 μL of the incubated conjugate to a 30 kDa centrifugal filter device, add 500 μL of DEPC water, centrifuge at 14000 g for 12 minutes, and repeat twice;

[0163] 6. Dissolve in DEPC water, adjust the concentration to 1uM and store at 4 degrees.

[0164] Embodiment 2:

[0165] Samples: Lymph nodes from a patient with Epstein-Barr virus-positive diffuse large B-cell lymphoma (P1, male, 55 years old, EBER positive approximately 90%) were collected and prepared into paraffin tissue sections.

[0166] Detection method: Pretreatment of formalin-fixed stone embedded tissue sections, probe hybridization, post-hybridization cleaning, probe circularization, rolling circle amplification, metal tag probe hybridization, and DNA labeling are performed in sequence.

[0167] Result analysis:

[0168] Use MCDviewer software to give 154Sm-EBER green pseudo color and 191Ir-DNA red pseudo color to the test results. Figure 1 , Figure 1The results of imaging mass spectrometry flow cytometry of paraffin sections of lymph nodes of patient (P1) are shown in the figure. The scanning area is 1000μm*1000μm. Figure 1 It can be seen that the green fluorescence accounts for about 90% of the red fluorescence, indicating that EBER is about 90% positive, which is completely consistent with the clinical diagnosis report of EBER being about 90% positive.

[0169] Embodiment 3:

[0170] Samples: Lymph nodes from patients with Epstein-Barr virus-positive diffuse large B-cell lymphoma (P2, female, 62 years old, EBER positive approximately 10%) were collected and prepared into paraffin tissue sections.

[0171] Detection method: Pretreatment of formalin-fixed stone embedded tissue sections, probe hybridization, post-hybridization cleaning, probe circularization, rolling circle amplification, metal tag probe hybridization, and DNA labeling are performed in sequence.

[0172] Result analysis:

[0173] Use MCDviewer software to give 154Sm-EBER green pseudo color and 191Ir-DNA red pseudo color to the test results. Figure 2 , Figure 2 The results of imaging mass spectrometry flow cytometry of paraffin sections of lymph nodes of patient (P2) are shown in the figure. The scanning area is 1000μm*1000μm. Figure 2 It can be seen that the green fluorescence accounts for about 10% of the red fluorescence, indicating that EBER is about 10% positive, which is completely consistent with the clinical diagnosis report of EBER being about 10% positive.

[0174] Embodiment 4:

[0175] Samples: Lymph node samples from a patient with diffuse large B-cell lymphoma (P3, male, 68 years old, EBER negative) were collected and prepared into paraffin tissue sections.

[0176] Detection method: Pretreatment of formalin-fixed stone embedded tissue sections, probe hybridization, post-hybridization cleaning, probe circularization, rolling circle amplification, metal tag probe hybridization, and DNA labeling are performed in sequence.

[0177] Result analysis:

[0178] Use MCDviewer software to give 154Sm-EBER green pseudo color and 191Ir-DNA red pseudo color to the test results. Figure 3 , Figure 3 The results of imaging mass spectrometry flow cytometry of paraffin sections of lymph nodes of patient (P3) are shown in the figure. The scanning area is 1000μm*1000μm. Figure 3It can be seen that there is no green fluorescence, indicating that EBER is negative, which is consistent with the clinical diagnosis report of EBER negative.

[0179] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention without departing from the principles and intent of the present invention.

Claims

1. An EBER1 / 2 metal label probe suitable for imaging mass spectrometry flow technology, characterized in that: The EBER1 / 2 detection probe is modified and then labeled with a metal tag.

2. The EBER1 / 2 metal tag probe according to claim 1, characterized in that: The nucleic acid sequence of the EBER1 detection probe is shown in SEQ ID NO:1, and the nucleic acid sequence of the EBER2 detection probe is shown in SEQ ID NO:

2.

3. The EBER1 / 2 metal tag probe as claimed in claim 1, characterized in that: The modification is 5'Thiol-Modifier C6 SS, and / or the metal tag is 141Pr, 142Nd, 143Nd, 144Nd, 145Nd, 146Nd, 147Sm, 148Nd, 149Sm, 150Nd, 151Eu, 152Sm, 153Eu, 154Sm, 155Gd, 156Gd, 157Gb, 158Gd, 159Tb, 160Gd, 161Dy, 162Dy, 163Dy, 164Dy, 165Ho, 166Er, 167Er, 168Er, 169Tm, 170Er, 171Yb, 172Yb, 173Yb, 174Yb, 175Lu or 176Yb.

4. The EBER1 / 2 metal-tagged probe according to any one of claims 1 to 3, characterized in that: The preparation method comprises: A1. Thiol reduction of nucleic acids: Prepare a 250±20μM solution of the modified EBER1 / 2 detection probe with 50±5mM TCEP-DEPC water and place at room temperature for 30±5min; then add pre-cooled ethanol and mix thoroughly. Preferably, the volume of pre-cooled ethanol is 2±0.5 times the volume of TCEP-DEPC water; place at 4±1℃ for 30±5min; remove the supernatant after the first centrifugation, add 70±5% ethanol, remove the supernatant after the second centrifugation; resuspend the precipitate in Maxpar C-Buffer; Preferably, the thiol reduction of nucleic acid is as follows: after centrifuging the FISH-DP-EBER1 / 2 probe at 2000r / 2min, 100μL of 50mM TCEP-DEPC water is added to prepare a 250μM solution, and the mixture is reacted at room temperature for 30min; then 2 times the volume (200μL) of pre-cooled ethanol is added to mix well, and the mixture is placed at 4°C for 30min; the mixture is centrifuged at 12,000g for 10min again, 500μL of 70% ethanol is added after the supernatant is removed, and the mixture is centrifuged at 12000g for 2min, and the supernatant is removed again; after the residual liquid evaporates to dryness, the dried oligonucleotide is resuspended in 50μL Maxpar C-Buffer; A2. Preload 154Sm element in the polymer: Resuspend Maxpar Polymer with Maxpar L-Buffer, then add Maxpar 154Sm solution and mix well to make the final concentration of Maxpar 154Sm 2.5±0.5mM; incubate at 37±5℃ for 30-40 minutes; The A1 and A2 steps can be performed in reverse order or simultaneously. A3. Purify the polymer loaded with 154Sm: Add Maxpar L-Buffer and the product obtained in step A2 to a 3 kDa filter; centrifuge at room temperature; discard the waste liquid, add Maxpar C-Buffer to the filter, and centrifuge to obtain a precipitate; Preferably, the polymer loaded with 154Sm is purified by: adding Maxpar L-Buffer and the product obtained in step A2 to a 3kDa filter; preferably, the volume ratio of Maxpar L-Buffer to the product obtained in step A2 is 1:19; centrifuging at 12,000±500g for 25±5 minutes at room temperature; discarding the waste liquid, adding Maxpar C-Buffer to the filter, and centrifuging at 12,000±500g for 30±10 minutes at room temperature to obtain a precipitate of the polymer loaded with 154Sm; A4. Conjugation of nucleic acid and lanthanide polymer: resuspend the polymer loaded with 154Sm obtained in A3 in Maxpar C-Buffer; mix it with an equal volume obtained in A1 and incubate at room temperature; then add 0.5±0.1M TCEP to a final concentration of 5±0.5mM and incubate to reduce unconjugated oligonucleotides; then add DEPC water and centrifuge in a 30kda centrifugal filter device to discard the supernatant, and then dissolve it with DEPC water; Preferably, the coupling of nucleic acid and lanthanide polymer is as follows: resuspending the polymer loaded with 154Sm obtained in A3 in MaxparC-Buffer; mixing it with an equal volume obtained in A1, and incubating at room temperature for 2±0.5h; then adding 0.5±0.1M TCEP to a final concentration of 5±0.5mM, incubating for 30±10min to reduce unconjugated oligonucleotides; then adding DEPC water and centrifuging in a 30kda centrifugal filter device, 14000±200g for 12±5 minutes, repeating 2±1 times, and then dissolving with DEPC water.

5. A kit, characterized in that: Contains the EBER1 / 2 metal-tagged probe described in any one of claims 1-3.

6. A method for accurately locating the position of EBER-positive cells, characterized in that: The EBER1 / 2 metal tag probe according to any one of claims 1 to 4 or the kit according to claim 5 is used.

7. A pre-treatment method for accurately locating the position of EBER-positive cells using an imaging mass spectrometer, characterized in that: The following steps are included: B1. Pre-treatment of formalin-fixed stone-embedded tissue sections: The paraffin tissue sections to be tested were dried at room temperature, and then baked in an oven at 65±5℃ for 30-60min; the sections were taken out and immersed in xylene at room temperature for dewaxing for 15±1min and 10±1min respectively, and the sections were moved up and down from time to time to ensure sufficient dewaxing; the sections were slowly taken out, immersed in ultrapure water, and allowed to stand at room temperature for 10±1sec; immediately immersed in 100% alcohol after taking out, allowed to stand for 2±1min, and then taken out; the sections were slowly immersed in preheated 1X target repair solution, maintained at 90±5℃, and repaired for 15±3min; after the sections were dried, a hydrophobic circle was drawn around the tissue with an immunohistochemistry pen; after the hydrophobic circle was dried, Wash Buffer was added, allowed to stand for 10±1sec, and then the liquid was discarded, and this was repeated several times; 4±1% PFA was added to the hydrophobic circle, allowed to stand for 10±1min, the liquid in the hydrophobic circle was aspirated, and then Wash Buffer was added, allowed to stand for 10±1sec, and then the liquid was discarded, and this was repeated several times, and the last Wash Buffer was retained; the Wash in the hydrophobic circle was aspirated Add 0.3±0.1mg / mL pepsin solution diluted with 0.7±0.1M HCL to the buffer; Place in a wet box and permeabilize in a 42±2℃ constant temperature incubator for 30-60 minutes. After permeabilization, aspirate the liquid in the hydrophobic circle, add Wash Buffer, let it stand for 10±1sec and then discard the liquid. Repeat several times and keep the last Wash Buffer. B2. Probe hybridization: Aspirate the liquid in the hydrophobic circle, then immediately add the first reaction solution, place in a wet box, and hybridize in a 42±2℃ constant temperature incubator for 4h; after the reaction is completed, aspirate the liquid in the hydrophobic circle, then immediately add Wash Buffer, let it stand for 10±1sec and then discard the liquid, repeat the washing several times, and keep the last Wash Buffer; The first reaction solution is prepared as follows: based on a 50 μL system, 15 μL of Nuclease-free Water, 25 μL of HybBuffer 1, 5 μL of PG, 2.5 μL of FISH Probe-Hsa-EBER1, and 2.5 μL of FISH Probe-Hsa-EBER2; B3. Post-hybridization cleaning: Vortex and centrifuge the Hyb Wash Buffer, aspirate the liquid in the hydrophobic circle, immediately add Hyb Wash Buffer, place in a wet box, incubate in a constant temperature incubator at 42±2℃ for 5±1min, and repeat the wash several times; after the reaction is completed, aspirate the liquid in the hydrophobic circle, immediately add Wash Buffer, let it stand for 10±1sec, then discard the liquid, repeat the wash several times, and keep the last Wash Buffer; B4. Probe circularization: Vortex and mix well, centrifuge; aspirate the liquid in the hydrophobic circle and immediately add the second reaction solution, place in a wet box, and react in a 42±2℃ constant temperature incubator for 0.5±0.1h; after the reaction, aspirate the liquid in the hydrophobic circle and immediately add Wash Buffer, let it stand for 10±1sec and then discard the liquid, repeat the washing several times, and keep the last Wash Buffer; The second reaction solution was prepared as follows: based on a 50 μL system, 12.5 μL of Nuclease-free Water, 25 μL of B1, 5 μL of PG, 2.5 μL of ST, and 5 μL of E1; B5. Rolling circle amplification: Vortex and mix well, centrifuge; aspirate the liquid in the hydrophobic circle and immediately add the third reaction solution, place in a wet box, and react in a 42±2℃ constant temperature incubator for 2±0.5h; after the reaction, aspirate the liquid in the hydrophobic circle and immediately add Wash Buffer, let it stand for 10±1sec, then discard the liquid, repeat the washing several times, and keep the last Wash Buffer; The third reaction solution is prepared as follows: based on a 50 μL system, 23 μL of Nuclease-free Water, 25 μL of B2, and 2 μL of E2; B6. Metal tag probe hybridization: Vortex and mix well, centrifuge; suck out the liquid in the hydrophobic circle and immediately add the fourth reaction solution, place in a wet box, and react in a 42±2℃ constant temperature incubator for 0.5±0.1h; after the reaction, suck out the liquid in the hydrophobic circle and immediately add Wash Buffer, let it stand for 10±1sec, then discard the liquid, and repeat the washing several times; The fourth reaction solution is prepared as follows: based on a 50 μL system, 22.5 μL of Nuclease-free Water, 25 μL of HybBuffer2, and 2.5 μL of EBER1 / 2 metal label probe; the EBER1 / 2 metal label probe is obtained by modifying the EBER1 / 2 detection probe and then labeling it with a metal label; preferably, the metal label is 141Pr, 142Nd, 143Nd, 144Nd, 145Nd, 146Nd, 147Sm, 148Nd, 149Sm, 150Nd, 151Nd, 152Nd, 153Sm, 154Sm, 155Nd, 156Sm, 157Sm, 158Sm, 159Sm, 160Sm, 161Sm, 162Sm, 163Sm, 164Sm, 165Sm, 166Sm, 167Sm, 168Sm, 169Sm, 170Sm, 171Sm, 172Sm, 173Sm, 174Sm, 175Sm, 176Sm, 177Sm, 178Sm, 179Sm, 180Sm, 181Sm, 182Sm, 183Sm, 184Sm, 185Sm, 186Sm, 187Sm, 188Sm, 189Sm, 190Sm, 191Sm, 192Sm, 193Sm, 194Sm, 195Sm, 196Sm, 197 51Eu, 152Sm, 153Eu, 154Sm, 155Gd, 156Gd, 157Gb, 158Gd, 159Tb, 160Gd, 161Dy, 162Dy, 163Dy, 164Dy, 165Ho, 166Er, 167Er, 168Er, 169Tm, 170Er, 171Yb, 172Yb, 173Yb, 174Yb, 175Lu or 176Yb; B7.DNA markers: After the liquid in the hydrophobic circle is sucked out, the fifth reaction solution is immediately added, and the mixture is placed in a wet box and reacted at room temperature for 0.5±0.1 hours; the mixture is rinsed with ddH20 for 5±1 minutes, and the slide is air-dried at room temperature and then detected by an imaging mass spectrometer to determine the location of EBER-positive cells; preferably, the mixture is dried for at least 20 minutes; Preparation of the fifth reaction solution: Dilute Ir-Intercalator 1:400 with DPBS buffer at room temperature, vortex and centrifuge.

Images