Sequencing kit containing sulfydryl blocking reagent and application thereof
Patent Information
- Application Number
- CN202380045977.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-06-16
- Filing Date
- 2023-06-16
- Publication Date
- 2025-01-21
AI Technical Summary
In the existing technology, non-specific adsorption of phi29 DNA polymerase during DNA second-strand sequencing results in residual fluorescent dye, causing an increase in background signal and affecting sequencing quality. Existing cleaning methods are inefficient and cannot completely remove non-specific adsorbed substances.
Use sulfhydryl blocking reagents to open and irreversibly block the disulfide bonds in the enzyme protein, releasing and clearing the entangled fluorescent dye and reducing the background signal. Thiol blocking reagents include N-ethylmaleimide and iodoacetamide, combined with disulfide bond reducing agents such as TCEP or β-mercaptoethanol, to destroy the three-dimensional structure of the enzyme protein and perform blocking treatment.
Effectively reduce sequencing background signals, improve signal-to-noise ratio and sequencing quality, avoid the impact of non-specific adsorption, and improve the efficiency and accuracy of the sequencing process.
Smart Images
Figure 00000016_0000 
Figure 00000016_0001 
Figure 00000017_0000
Abstract
Description
A sequencing kit containing a thiol blocking reagent and its application
[0001] This application claims priority to Chinese patent application PCT / CN2022 / 099258, filed on June 16, 2022. This application incorporates the entire text of the aforementioned Chinese patent application. Technical Field
[0002] The present invention belongs to the field of nucleic acid sequencing, and in particular relates to a kit containing a thiol blocking reagent, a method for reducing sequencing background signals based on the thiol blocking reagent, and applications thereof. Background Art
[0003] DNA sequencing involves single-strand sequencing and double-strand sequencing. After single-strand sequencing, multiple displacement amplification (MDA) is performed using the single-strand as a template to generate a double-strand, which is then sequenced. The double-strand generation process uses the enzyme phi29 DNA polymerase, which is easily nonspecifically adsorbed to the sequencing chip and difficult to remove, resulting in residual phi29 DNA polymerase. At the beginning of double-strand sequencing, residual phi29 DNA polymerase can entangle with chemically modified deoxyribonucleotides (dNTPs). Because the modified dNTPs contain fluorescent dyes, the entanglement of the nonspecifically bound enzyme and dNTPs increases the sequencing background signal, resulting in a decrease in the signal-to-noise ratio and thus affecting sequencing quality.
[0004] In existing technologies, the commonly used method to reduce the adsorption of nonspecific fluorescent substances is to elute with an elution solvent. In order to effectively remove nonspecifically bound fluorescent substances, the concentration of the elution solution must be increased and the elution time must be extended. However, it is not possible to effectively remove nonspecific adsorption. Both of the above are detrimental to efficient sequencing.
[0005] Summary of the Invention
[0006] In order to solve the technical problem in the prior art of poor sequencing quality caused by incomplete cleaning of fluorescent dyes, the present invention provides a thiol blocking reagent and a method for reducing sequencing background signals based on the thiol blocking reagent and its application.
[0007] The steps of the present invention include: first, opening the disulfide bonds in the enzyme protein structure so that the disulfide bonds become naked sulfhydryl groups. Then, the naked sulfhydryl groups in the enzyme protein are blocked by two optional methods: one is a halogen substitution reaction, commonly using iodoacetamide as shown in reaction (1) in Figure 1. The other is an addition reaction, commonly using N-ethylmaleimide (NEM) as shown in reaction (2) in Figure 1. The Michael Addition reaction is a conjugate addition reaction between a compound that can provide a nucleophilic carbon anion and an electrophilic conjugated system under base catalysis.
[0008] During the sequencing process, the present invention uses a disulfide bond reducing agent to open the disulfide bonds in the enzyme protein structure, and a blocking reagent to irreversibly block all disulfide bonds, releasing the fluorescent dye and completely removing it, thereby reducing background signals and improving sequencing quality. The thiol blocking reagents described in the present invention include N-ethylmaleimide and / or iodoacetamide, which are commonly used as protein markers for protein structures and are important means for protein detection. This is the first application of thiol blocking reagents in sequencing technology as a means of reducing disulfide background. It can effectively block the polymerase during the MDA process, facilitate thorough cleaning, avoid its impact on disulfide sequencing, and help improve sequencing quality.
[0009] In order to solve the above technical problems, the first aspect of the present invention provides a sequencing kit, which includes a thiol blocking reagent, and the thiol blocking reagent includes iodoacetamide and / or N-ethylmaleimide.
[0010] In certain technical solutions, the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution containing 50-100 mM N-ethylmaleimide. Preferably, the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution containing 100 mM N-ethylmaleimide.
[0011] In certain technical solutions, the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution containing 50-100 mM iodoacetamide. Preferably, the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution containing 100 mM iodoacetamide.
[0012] In some technical solutions, the sequencing kit further includes a disulfide bond reducing agent, which is preferably tris(hydroxymethyl)aminomethane phosphine solution (TCEP) or a thiol such as β-mercaptoethanol (β-ME) or dithiothreitol (DTT).
[0013] In certain technical solutions, the disulfide bond reducing agent is dithiothreitol, and its working solution concentration is 1-10 mM.
[0014] In some technical solutions, the sequencing kit further comprises one or more of a DNA polymerase, an MDA polymerase, a sequencing slide, and a mixture of fluorescently modified and reversibly blocked nucleotides. Preferably, the MDA polymerase is phi29 DNA polymerase.
[0015] A second aspect of the present invention provides a method for reducing background signals in nucleic acid sequencing, the method comprising the following steps:
[0016] (1) Destroy the three-dimensional structure of the enzyme protein during nucleic acid sequencing and expose the active groups;
[0017] (2) blocking the exposed active groups with the thiol blocking reagent in the sequencing kit according to the first aspect of the present invention, wherein the blocking is irreversible;
[0018] (3) Release fluorescent substances;
[0019] (4) Optionally, clean.
[0020] In certain technical solutions, in step (1), the three-dimensional structure is destroyed by destroying disulfide bonds, and the exposed active groups are sulfhydryl groups; and / or,
[0021] In step (2), the blocking is performed using a separate thiol blocking reagent or a thiol blocking reagent in the sequencing kit described in the first aspect; and / or,
[0022] In step (3), the fluorescent substance may be a nucleotide individually labeled with a marker, and the marker may be, for example, Cy5 fluorescence, ROX fluorescence, Cy3 fluorescence or EF700 fluorescence.
[0023] In the present invention, "separate" means that the reagent is not from the sequencing kit described in the first aspect, but can be a separately prepared identical reagent.
[0024] In step (3), the fluorescent substance can be a nucleotide labeled with a marker combination, so that different luciferases can be connected to the labeled nucleotide. As used herein, the molecular marker for labeling the nucleotide and the marker specifically bound thereto can be any molecular pairing that can specifically bind to each other. The specific binding between the pairing members realizes the connection between the nucleotide and the luciferase. Exemplary pairing members include, but are not limited to: (a) a hapten or antigenic compound combined with a corresponding antibody or its binding portion or fragment, such as digoxin-digoxin antibody, N3G-N3G antibody, FITC-FITC antibody; (b) nucleic acid aptamers and proteins; (c) non-immune binding pairs (such as biotin-avidin, biotin-streptavidin, biotin-neutravidin); (d) hormone-hormone binding protein; (e) receptor-receptor agonist or antagonist; (f) lectin-carbohydrate; (g) enzyme-enzyme cofactor; (h) enzyme-enzyme inhibitor; and (i) complementary oligonucleotide or polynucleotide pairs capable of forming a nucleic acid duplex.
[0025] In step (4), the washing is performed using an elution reagent, preferably the elution reagent in the sequencing kit described in the first aspect of the present invention.
[0026] In certain technical solutions, in step (1), the disulfide bond reducing agent, either alone or in the sequencing kit of the first aspect, can be tris(hydroxymethyl)aminomethane phosphine solution (TCEP) or a thiol such as β-mercaptoethanol (β-ME) or dithiothreitol (DTT) to reduce the disulfide bonds, thereby breaking the disulfide bonds and opening the three-dimensional space. Preferably, the working solution concentration of the disulfide bond reducing agent ranges from 1 to 50 mM, preferably from 1 to 10 mM.
[0027] In certain technical solutions, in step (2), the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution containing 50-100 mM N-ethylmaleimide, either alone or in the sequencing kit of the first aspect. Preferably, the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution containing 100 mM N-ethylmaleimide.
[0028] In certain technical solutions, in step (2), the thiol blocking reagent is a 50 mM ammonium bicarbonate solution containing 50-100 mM iodoacetamide, alone or in the sequencing kit of the first aspect. Preferably, the thiol blocking reagent is a 50 mM ammonium bicarbonate solution containing 100 mM iodoacetamide.
[0029] In certain technical solutions, in step (1), after the sequencing reagent containing the disulfide bond reducing agent is loaded on the chip, the sequencing reagent is eluted; and / or, in step (2), after the thiol blocking reagent is added for reaction, a second elution is performed.
[0030] In certain technical solutions, the elution reagents used in the elution and secondary elution are the elution reagents in the sequencing reagent tank of the MGISEQ-2000RS high-throughput sequencing kit; and / or, the enzyme protein is MDA polymerase, such as phi29 DNA polymerase.
[0031] A third aspect of the present invention provides a nucleic acid sequencing method, comprising the following steps:
[0032] (1) Loading the nucleic acid to be tested onto the sequencing slide;
[0033] (2) contacting the nucleic acid to be tested with sequencing reagents, such as dNTP molecules and DNA polymerase, to perform single-strand sequencing;
[0034] (3) After the first strand is sequenced, polymerase is added to amplify the second strand.
[0035] (4) optionally, eluting;
[0036] (5) blocking the exposed active groups using the sequencing kit described in the first aspect of the present invention or the method described in the second aspect of the present invention;
[0037] (6) optionally, eluting;
[0038] (7) Perform second-strand sequencing.
[0039] Specifically, the nucleic acid sequencing comprises the following steps:
[0040] (1) Using the MGISEQ-2000RS high-throughput sequencing kit, DNA nanoballs were loaded onto the sequencing slide;
[0041] (2) pumping the dNTP molecule mixture into the sequencing slide, polymerizing the dNTP molecules onto the sequencing strand of DNA using DNA polymerase, and performing single-strand sequencing;
[0042] (3) After the first strand is sequenced, MDA polymerase is added to amplify the second strand, and the excess MDA polymerase and polymerization reagent are eluted with an elution reagent;
[0043] (4) Using the method described in the second aspect of the present invention, the three-dimensional structure of the residual MDA enzyme on the sequencing chip is opened and the exposed groups are blocked. After the reaction for, for example, 30 minutes, the elution is performed using the elution reagent, and double-strand sequencing is performed.
[0044] Preferably, the nucleic acid sequencing is performed in a gene sequencer MGISEQ-2000RS; the cycles are performed 50-400 times, for example 50, 100, 150, 200 or 400 times; and / or the polynucleotide is DNA or RNA.
[0045] The fourth aspect of the present invention provides use of the sequencing kit described in the first aspect in nucleic acid sequencing or in preparing reagents for nucleic acid sequencing.
[0046] The positive and progressive effects of the present invention:
[0047] This invention is the first to utilize a sequencing kit containing a thiol-blocking reagent. This strategy, based on opening the disulfide bonds of the enzyme protein and then irreversibly blocking them to better release the entangled dye, reduces background signal during sequencing, improves the signal-to-noise ratio, and enhances sequencing quality. This approach and reagent components, when used in sequencing scripts and sequencing kits, will enhance sequencing quality, increasing product value and market share. BRIEF DESCRIPTION OF THE DRAWINGS
[0048] FIG1 shows the mechanism of irreversible blocking of sulfhydryl groups of DNA polymerase according to the present invention.
[0049] Figure 2 shows the effects of different blocking reagents on the number of test cycles and the 0.1% error rate; control: 50 mM ammonium bicarbonate solution without any blocking reagent; iodoacetamide: 50 mM ammonium bicarbonate solution containing 100 mM iodoacetamide; N-ethylmaleimide: 50 mM ammonium bicarbonate solution containing 50 mM N-ethylmaleimide.
[0050] Figure 3 shows the results of different blocking reagents reducing the background signal of sequencing; control group: 50mM ammonium bicarbonate solution without any blocking reagent; iodoacetamide: 50mM ammonium bicarbonate solution containing 100mM iodoacetamide was added; N-ethylmaleimide: 50mM ammonium bicarbonate solution containing 50mM N-ethylmaleimide was added.
[0051] Figure 4 shows the results of different blocking reagents improving the signal-to-noise ratio of sequencing; control group: 50 mM ammonium bicarbonate solution without any blocking reagent; iodoacetamide: 50 mM ammonium bicarbonate solution containing 100 mM iodoacetamide was added; N-ethylmaleimide: 50 mM ammonium bicarbonate solution containing 50 mM N-ethylmaleimide was added.
[0052] FIG5 shows the Q30 results of N-ethylmaleimide at different concentrations.
[0053] FIG6 shows the background of A at different concentrations of N-ethylmaleimide.
[0054] FIG7 shows the background of T at different concentrations of N-ethylmaleimide.
[0055] FIG8 shows the background of C at different concentrations of N-ethylmaleimide.
[0056] FIG9 shows the background of G at different concentrations of N-ethylmaleimide. DETAILED DESCRIPTION
[0057] The present invention is further illustrated by way of examples below, but the present invention is not limited to the scope of the examples. Experimental methods in the following examples where specific conditions are not specified were performed according to conventional methods and conditions, or selected according to the product specifications.
[0058] The mechanism of irreversibly blocking the sulfhydryl group of DNA polymerase according to the present invention is shown in FIG1 .
[0059] Equipment, reagents and raw materials used in the examples
[0060] Experimental equipment:
[0061] MGISEQ-2000RS sequencer, MGIDL-200H loader, MGISEQ-2000RS sequencing slide, the excitation wavelengths of the instruments are 532 and 650 nm, respectively.
[0062] Reagents and raw materials used in the experiment (see Table 1):
[0063] Table 1 Reagents and raw materials used in the experiment
[0064] Ammonium bicarbonate (analytical grade), N-ethylmaleimide (NEM, analytical grade), ultrapure water, and Escherichia coli single-stranded circular DNA as the template (Standard Library Reagent V3.0) primer sequence: CAACTCCTTGGCTCACAGAACATGGCTACGATCCGACTT (SEQ ID NO: 1). DNA polymerase and MDA enzyme were from BGI, and DNA nanospheres were also from BGI. The following experiments all used E. coli single-stranded circular DNA as the template, and the MGISEQ-2000RS High-Throughput Sequencing Reagent Set (FCL PE150, Catalog No. 1000012555, MGI) was used to prepare DNA nanospheres and load them onto a chip (MGI, Catalog No. 1000008403) for subsequent sequencing. The fluorescently modified and reversibly blocked nucleotide mixture mentioned in this example includes: dATP-1, which refers to an adenine nucleotide modified with a reversible blocking group and a Cy5 fluorescent modification; dTTP-1, which refers to a thymine nucleotide modified with a reversible blocking group and a ROX fluorescent modification; dGTP-1, which refers to a guanine nucleotide modified with a reversible blocking group and a Cy3 fluorescent modification; and dCTP-1, which refers to a cytosine nucleotide modified with a reversible blocking group and an EF700 fluorescent modification. The above dATP-1, dTTP-1, dGTP-1, and dCTP-1 are all from the MGISEQ-2000RS high-throughput sequencing kit manufactured by MGI. Different platforms can have different nucleotide mixtures with fluorescent modifications and reversible blocking. For example, a simple reversible blocking group nucleotide or other modification types can be mixed into this nucleotide mixture.
[0065] Experimental methods and steps
[0066] (a) Preparation of thiol blocking reagent:
[0067] Accurately weigh ammonium bicarbonate and dissolve it in ultrapure water to prepare a 50 mM ammonium bicarbonate solution. Also accurately weigh N-ethylmaleimide and iodoacetamide to prepare a 50 mM ammonium bicarbonate solution containing 100 mM iodoacetamide and a 50 mM ammonium bicarbonate solution containing 50 mM N-ethylmaleimide.
[0068] (b) Nucleic acid sequencing method, which is carried out according to the instructions, is briefly described as follows:
[0069] Step 1: Load the DNA nanospheres onto the prepared chip (i.e., sequencing slide);
[0070] Step 2: Pump the prepared dNTP molecule mixture (from the MGISEQ-2000RS High-Throughput Sequencing Reagent Set) into the chip, and use DNA polymerase to add dNTP molecules to the parent strand of DNA for single-strand sequencing;
[0071] Step 3: After the first-strand sequencing is completed, the MDA process is entered to allow the second strand to grow. After the second-strand growth is completed, the excess MDA enzyme (from the above-mentioned MGISEQ-2000RS High-Throughput Sequencing Reagent Set) is eluted with the elution reagent (from the MGISEQ-2000RS High-Throughput Sequencing Reagent Set);
[0072] Step 4: Pump in 10mM DTT reagent to open the disulfide bonds in the enzyme protein, and then elute the DTT reagent cleanly; pump in a thiol blocking reagent, i.e., ammonium bicarbonate solution containing N-ethylmaleimide, and react for 30 minutes. The solution is then eluted again with the above-mentioned elution reagent for double-strand sequencing.
[0073] Example 1
[0074] The MGISEQ-2000RS high-throughput sequencing kit was used. Well #13 in the kit contained a 50mM ammonium bicarbonate solution containing 100mM iodoacetamide. A mixture of fluorescently modified and reversibly blocked nucleotides was sequentially polymerized on the MGISEQ-2000RS sequencing platform. The free nucleotides were then eluted using the above-mentioned elution reagent. This allows for simultaneous polymerization and leveling of the nucleotides. At this point, the polymerized nucleotide mixture is a reversibly blocked modified nucleotide.
[0075] SE50 sequencing was performed on the MGISEQ-2000RS sequencing platform according to the experimental process. Briefly, a mixture of fluorescently modified and reversibly blocked nucleotides was sequentially polymerized on the MGISEQ-2000RS sequencing platform. Free nucleotides were then eluted using an elution reagent, signal acquisition was performed in a camera solution, protecting groups were removed using an excision reagent, and washing was performed using an elution reagent. Sequencing quality was then assessed by calculating the decrease in Q30 at each cycle and the sequencing error rate curve for each cycle.
[0076] Example 2
[0077] The MGISEQ-2000RS high-throughput sequencing kit was used. Well #13 in the kit contained a 50 mM ammonium bicarbonate solution containing 50 mM N-ethylmaleimide. A mixture of fluorescently modified and reversibly blocked nucleotides was sequentially polymerized on the MGISEQ-2000RS sequencing platform. The free nucleotides were then eluted using an elution reagent. This allows for polymerization and leveling while signal acquisition is performed. At this point, the polymerized nucleotide mixture is a reversibly blocked modified nucleotide. SE50 sequencing was performed on the MGISEQ-2000RS sequencing platform according to the same experimental procedure as in Example 1. The Q30 decrease in each cycle and the sequencing error rate curve of each cycle were then used to evaluate the sequencing quality.
[0078] Comparative Example 1
[0079] The MGISEQ-2000RS high-throughput sequencing kit was used, with well #13 containing a 50 mM ammonium bicarbonate solution. SE50 sequencing was performed on the MGISEQ-2000RS sequencing platform following the same experimental procedure as in Example 1. Sequencing quality was assessed by calculating the decrease in Q30 at each cycle and analyzing the sequencing error rate curve for each cycle.
[0080] Effect Example 1
[0081] Result analysis:
[0082] As shown in Figure 2, different blocking reagents have different base error rates during test cycles, with the higher the base error rate, the better. Specifically, the highest error rate was achieved with a 50mM ammonium bicarbonate solution containing 50mM N-ethylmaleimide, followed by a 50mM ammonium bicarbonate solution containing 100mM iodoacetamide. The lowest error rate was achieved with a 50mM ammonium bicarbonate solution without any blocking reagent. This indicates that a 50mM ammonium bicarbonate solution containing 50mM N-ethylmaleimide is the most effective.
[0083] As shown in Figure 3, in cycles A, G, and T, the background signal value was lowest when a 50 mM ammonium bicarbonate solution containing 50 mM N-ethylmaleimide was added, followed by a 50 mM ammonium bicarbonate solution containing 100 mM iodoacetamide. The background signal value of a 50 mM ammonium bicarbonate solution without any blocking reagent was highest. In cycle C, the background signal value of a 50 mM ammonium bicarbonate solution containing 100 mM iodoacetamide was comparable to that of a 50 mM ammonium bicarbonate solution containing 50 mM N-ethylmaleimide, but both were still lower than the background signal value of a 50 mM ammonium bicarbonate solution without any blocking reagent.
[0084] As shown in Figure 4, in cycles A, C, G, and T, the signal-to-noise ratio was the highest when 50 mM ammonium bicarbonate solution containing 50 mM N-ethylmaleimide was added, followed by 50 mM ammonium bicarbonate solution containing 100 mM iodoacetamide. The signal-to-noise ratio was the lowest when 50 mM ammonium bicarbonate solution without any blocking reagent was added.
[0085] Effect Example 2
[0086] The MGISEQ-2000RS high-throughput sequencing kit was used. Well #13 in the kit contained a 50 mM ammonium bicarbonate solution containing 100 mM N-ethylmaleimide and a 50 mM ammonium bicarbonate solution containing 50 mM N-ethylmaleimide, respectively. A mixture of fluorescently modified and reversibly blocked nucleotides was sequentially polymerized on the MGISEQ-2000RS sequencing platform. The free nucleotides were then eluted using an elution reagent. SE50 sequencing was performed on the MGISEQ-2000RS sequencing platform according to the same experimental procedure as in Example 1. The Q30 decrease in each cycle and the sequencing error rate curve of each cycle were then used to evaluate the sequencing quality.
[0087] Results: As shown in Figure 5, sequencing quality (Q30) was higher when using a blocking reagent containing 100 mM N-ethylmaleimide in ammonium bicarbonate than when using 50 mM N-ethylmaleimide. As shown in Figures 6-9, the Q30 (%) of sequencing results with a 100 mM blocking reagent concentration was significantly higher than when using a 50 mM blocking reagent component. The background for A, G, C, and T was also significantly lower than that of the 50 mM blocking reagent component. In summary, increasing the concentration of the blocking reagent components can improve sequencing quality.
[0088] Although the above describes specific embodiments of the present invention, it should be understood by those skilled in the art that these are merely illustrative and that various changes or modifications may be made to these embodiments without departing from the principles and essence of the present invention. Therefore, the scope of protection of the present invention is defined by the appended claims.
Claims
1. A sequencing kit, characterized in that: The kit includes a sulfhydryl blocking reagent.
2. The sequencing kit according to claim 1, wherein The sulfhydryl blocking reagent includes iodoacetamide and / or N-ethylmaleimide, and / or the concentration of the sulfhydryl blocking reagent is 50-100 mM; Preferably, the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution containing 50-100 mM N-ethylmaleimide, and / or the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution containing 50-100 mM iodoacetamide.
3. The sequencing kit according to claim 1 or 2, characterized in that The sequencing kit further comprises a disulfide bond reducing agent; the disulfide bond reducing agent is preferably tris(hydroxymethylaminomethane)phosphine solution or a thiol such as β-mercaptoethanol or dithiothreitol.
4. The sequencing kit according to claim 3, characterized in that The disulfide bond reducing agent is dithiothreitol, and its working solution concentration is 1-10 mM.
5. A method for reducing background signals in nucleic acid sequencing, characterized in that: The method comprises the following steps: (1) Destroy the three-dimensional structure of the enzyme protein during nucleic acid sequencing and expose the active groups; (2) blocking the exposed active groups with a thiol blocking reagent as defined in any one of claims 1 to 4, wherein the blocking is irreversible; (3) Release fluorescent substances; (4) Optionally, clean.
6. The method according to claim 5, wherein In step (1), the three-dimensional structure is opened by destroying disulfide bonds, and the exposed active groups are sulfhydryl groups; and / or, In step (2), the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution containing 50-100 mM N-ethylmaleimide, and / or the sulfhydryl blocking reagent is a 50 mM ammonium bicarbonate solution containing 50-100 mM iodoacetamide; and / or, In step (3), the fluorescent substance is a nucleotide labeled with a single marker, such as Cy5 fluorescence, ROX fluorescence, Cy3 fluorescence or EF700 fluorescence; and / or the fluorescent substance is a nucleotide labeled with a combination of markers; and / or, In step (4), the washing is performed using an elution reagent.
7. The method according to claim 6, wherein In step (1), disulfide bonds are reduced by using a disulfide bond reducing agent such as tris(hydroxymethyl)aminomethane phosphine (TCEP) or thiols such as β-mercaptoethanol (β-ME) and dithiothreitol (DTT) to destroy the disulfide bonds and open the three-dimensional space.
8. The method according to claim 3 or 7, wherein: In step (1), after the sequencing reagent containing the disulfide bond reducing agent is loaded on the chip, the disulfide bond reducing agent is eluted; and / or, in step (2), after the thiol blocking reagent is added for reaction, a second elution is performed.
9. The method according to claim 5, wherein The enzyme protein is MDA polymerase, such as phi29 DNA polymerase.
10. A nucleic acid sequencing method, characterized in that: The method comprises the following steps: (1) Loading the nucleic acid to be tested onto the sequencing slide; (2) contacting the nucleic acid to be tested with sequencing reagents, such as dNTP molecules and DNA polymerase, to perform single-strand sequencing; (3) After the first strand is sequenced, polymerase is added to amplify the second strand. (4) optionally, eluting; (5) blocking the exposed active groups using the sequencing kit according to any one of claims 1 to 4 or the method according to any one of claims 5 to 9; (6) optionally, eluting; (7) Perform second-strand sequencing.
11. Use of the sequencing kit according to any one of claims 1 to 4 in nucleic acid sequencing or in preparing reagents for nucleic acid sequencing.