Leukemia targeted therapy preparation as well as preparation method and application thereof

By introducing nucleic acid aptamer SGC8 sequence into DNA nanoflowers and modifying disulfide bonds to support benzene arsenic oxide, a DNA nanoflower therapeutic preparation targeting leukemia cells is formed, which solves the problems of insufficient targeting and major toxic and side effects in the prior art, and achieves efficient targeting and safety enhancement of leukemia cells.

CN120131981APending Publication Date: 2025-06-13HUNAN UNIV +1
0 Cites 2 Cited by

Patent Information

Application Number
CN202510370774.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-27
Publication Date
2025-06-13

Smart Images

  • Figure CN120131981A_ABST
    Figure CN120131981A_ABST
Patent Text Reader

Abstract

The invention discloses a leukemia targeted therapy preparation as well as a preparation method and application thereof. Comprising a DNA nanoflower carrier targeting leukemia cells through a PTK7 receptor and benzene arsenic oxide loaded on the carrier. The DNA nanoflower carrier is obtained by rolling circle amplification, and a nucleic acid aptamer complementary sequence of targeted binding leukemia cells is introduced into a template chain subjected to rolling circle amplification. The preparation method comprises the following steps: modifying sulfydryl onto a DNA nanoflower by using DNA-Dithiol, then breaking a disulfide bond by using reduced glutathione to expose the sulfydryl, and loading benzene arsenic oxide onto the DNA nanoflower through a reaction between trivalent arsenic and the sulfydryl. The structure of the DNA nanoflower has a high surface area and high porosity, and can load a large amount of PAO, so that the killing performance on cancer cells is enhanced; the aptamer sgc8 sequence is introduced into the DNA nanoflower, so that the targeting of the DNA nanoflower to cancer cells is effectively realized; the preparation also has the advantages of being good in thermodynamic stability, easy to store, excellent in biocompatibility and the like, and has a very good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to a leukemia targeted therapeutic agent, a preparation method thereof, and an application thereof. Background Art

[0002] Organic arsenic compounds are a class of arsenicals containing carbon-arsenic bonds. Compared with inorganic arsenic, they have better bioavailability and lower toxicity. Currently, the organic arsenic compounds under research include some arsenic saccharides, arsenic lipids, and arsine benzenes. The anti-tumor activities of these compounds are still in the experimental stage. It is expected that through specific modifications, the targeting to leukemia cells can be increased, and the toxicity to normal cells can be reduced. Among them, phenylarsine oxide (PAO) is one of the widely used organic arsenics.

[0003] However, arsenicals have certain toxicity to the heart, liver, and kidneys. Especially under high-dose treatment, they may cause adverse reactions such as liver damage, which limits the use of their dosage and treatment course. Nucleic acid aptamers are a class of single-stranded nucleic acid molecules composed of DNA or RNA, which can specifically bind to target molecules (such as proteins, cell surface receptors, etc.). They have significant advantages in terms of targeting, reducing organ side effects, and low immunogenicity. However, how to efficiently combine organic arsenic and nucleic acid aptamers to maximize functions such as enhanced targeting, increased efficacy, improved loading rate, reduced side effects, and reduced immunogenicity still requires in-depth research.

[0004] DNA nanoflowers (NF) are flower-shaped nanostructures formed by self-assembly of long-chain DNA, which have a high surface area and high porosity. Their unique properties make them have broad application prospects in the biomedical field, such as drug delivery, cell imaging, and biosensing. The synthesis of DNA nanoflowers is mainly based on the rolling circle amplification (RCA) technology. It includes: ① Preparation of circular DNA template: First, linear single-stranded DNA is ligated into a circular DNA template using a ligase. ② Rolling circle amplification: On the circular DNA template, phi29 DNA polymerase is used for amplification. Phi29 DNA polymerase can synthesize long-chain DNA products under the guidance of the template. The DNA strands are repeatedly replicated with the circular template to generate highly repetitive sequences. ③ Formation of nanoflowers: Due to the natural negative charge of DNA and the non-covalent interaction between strands, the amplification products will spontaneously curl to form flower-shaped nanoparticles. These DNA strands wind and crosslink with each other to form a three-dimensional nanoflower structure.

[0005] During rolling circle replication, by introducing the nucleic acid aptamer sgc8 sequence into the DNA nanoflowers, the targeting of DNA nanoflowers to leukemia cells can be effectively achieved. In addition, for the first time in this invention, it is found that by introducing disulfide bonds, the loading efficiency of organic arsenic in DNA nanoflowers can be greatly increased.

[0006] Therefore, combining the many advantages of the above-mentioned organic arsenic, nucleic acid aptamer, and DNA nanoflowers, this invention synthesizes a DNA nanoflower (DNA nanoflowers) that effectively loads phenylarsine oxide (PAO), an arsenic agent, and targets leukemia cells through the nucleic acid aptamer sgc8, providing a new strategy for the treatment of leukemia. Summary of the Invention

[0007] The primary object of this invention is to provide a leukemia-targeted therapeutic agent, which enhances the targeting of organic arsenic, increases the curative effect, improves the loading rate, and reduces both the toxic side effects and immunogenicity.

[0008] The described leukemia-targeted therapeutic agent includes a DNA nanoflower carrier with the property of targeting leukemia cells and phenylarsine oxide loaded on the carrier.

[0009] Furthermore,

[0010] The DNA nanoflower carrier is obtained by rolling circle amplification, and a complementary sequence of a nucleic acid aptamer that targets and binds to leukemia cells is introduced into the template strand during rolling circle amplification.

[0011] At the same time, DNA-Dithiol is used to modify disulfide bonds onto the DNA nanoflowers, and then reduced glutathione (GSH) is used to break the disulfide bonds to expose sulfhydryl groups. Phenylarsine oxide reacts with the sulfhydryl groups and is loaded onto the DNA nanoflowers.

[0012] Even further,

[0013] The DNA nanoflowers are labeled with at least one of a fluorescent substance, a radioactive substance, a therapeutic substance, and biotin; derivatives with the same functions as the DNA nanoflowers can be obtained.

[0014] The second object of this invention is to provide a preparation method for the described leukemia-targeted therapeutic agent, including the following steps:

[0015] (1) Design the template and primers for rolling circle amplification, introduce a complementary sequence of a nucleic acid aptamer that targets and binds to leukemia cells into the template strand, and then perform rolling circle amplification to obtain DNA nanoflowers with the function of targeting and binding to leukemia cells;

[0016] (2) Modify disulfide bonds onto DNA nanoflowers using DNA-Dithiol, and then use reduced glutathione to break the disulfide bonds to expose sulfhydryl groups. Phenylarsine oxide reacts with sulfhydryl groups to be loaded onto the DNA nanoflowers.

[0017] The purpose of the third aspect of the present invention is to provide the following applications of the leukemia-targeted therapeutic agent:

[0018] (1) For preparing drugs for treating leukemia;

[0019] (2) For preparing leukemia-targeted diagnostic reagents;

[0020] (3) For preparing reagents targeting leukemia cells.

[0021] The present invention has the following remarkable advantages:

[0022] 1) It can effectively control the size of DNA nanoflowers by controlling the time of rolling circle amplification (RCA);

[0023] 2) Disulfide bonds can be modified onto the nanoflowers. Reduced glutathione breaks the disulfide bonds to expose sulfhydryl groups, and PAO spontaneously reacts with sulfhydryl groups, enabling PAO to be loaded onto the DNA nanoflowers without additional treatment;

[0024] 3) The structure of DNA nanoflowers has a high surface area and high porosity, and can be used as an efficient carrier for drugs. Therefore, DNA nanoflowers can load a large amount of PAO, enhancing the killing effect on cancer cells;

[0025] 4) By introducing the nucleic acid aptamer sgc8 sequence into DNA nanoflowers, effective targeting of cancer cells by DNA nanoflowers is achieved;

[0026] 5) Due to the highly repetitive sequences and ultra-long chains of DNA, DNA nanoflowers exhibit strong thermodynamic stability in vivo and in vitro environments and are easy to store;

[0027] 6) DNA nanomaterials have excellent biocompatibility and do not cause significant immune responses in biomedical applications;

[0028] 7) By chemical modification or introducing functional oligonucleotides, DNA nanoflowers can carry specific bioactive molecules (such as drugs, fluorescent labels, probes, etc.), endowing them with multifunctional application potential. Brief Description of the Drawings

[0029] Figure 1 Schematic diagram of the synthesis and drug loading of nanoflowers and their action in vivo;

[0030] Figure 2, Verify the synthesis of nanoflowers by agarose gel electrophoresis;

[0031] Figure 3 , Characterize the morphology of DNA nanoflowers synthesized at different rolling circle amplification times by SEM;

[0032] Figure 4 , Measure the size of DNA nanoflowers at different rolling circle amplification times by DLS;

[0033] Figure 4 A. Measure the size of empty DNA nanoflowers with RCA for 4 h by DLS;

[0034] Figure 4 B. Measure the size of empty DNA nanoflowers with RCA for 8 h by DLS;

[0035] Figure 4 C. Measure the size of empty DNA nanoflowers with RCA for 24 h by DLS;

[0036] Figure 4 D. Measure the Zeta potential of empty DNA nanoflowers with RCA for 8 h by DLS;

[0037] Figure 5 , Verify the successful loading of PAO on DNA nanoflowers by SEM and EDS elemental analysis;

[0038] Figure 5 A. Characterize the morphology of PAO@NF by SEM;

[0039] Figure 5 B. Determine the elements in the scanning area by EDS;

[0040] Figure 5 C. Determine the elemental distribution in the scanning area by EDS;

[0041] Figure 6 , Measure the size and Zeta potential of nanoflowers before and after drug loading by DLS;

[0042] Figure 6 A. Measure the size of arsenic-loaded DNA nanoflowers with RCA for 8 h by DLS;

[0043] Figure 6 B. Measure the Zeta potential of arsenic-loaded DNA nanoflowers with RCA for 8 h by DLS;

[0044] Figure 7 , Measure the drug loading concentration of nanoflowers after drug loading by icp-oes;

[0045] Figure 8 , Verify the specific binding of NF to CEM cells by confocal microscopy;

[0046] Figure 9, Flow cytometry was used to verify the targeting of DNA nanoflowers to CEM cells;

[0047] Figure 9 A. Flow cytometry was used to verify the specific binding of NF flowers to CEM cells;

[0048] Figure 9 B. Flow cytometry was used to verify that NF does not bind to Ramos cells;

[0049] Figure 10 , Flow cytometry was used to verify the internalization of DNA nanoflowers into CEM cells;

[0050] Figure 11 , Flow cytometry was used to explore the internalization pathway of DNA nanoflowers;

[0051] Figure 11 A. Treatment with Amiloricle inhibitor;

[0052] Figure 11 B. Treatment with MβCD inhibitor;

[0053] Figure 11 C. Treatment with Chlorpromazine HCL inhibitor;

[0054] Figure 12 , SEM was used to explore the serum stability of PAO@NF;

[0055] Figure 13 , The cytotoxicity of PAO and PAO@NF to CEM / Ramos;

[0056] Figure 13 A - C. The cytotoxicity of PAO diluted 100 / 200 / 300 - fold to CEM cells;

[0057] Figure 13 D - F. The cytotoxicity of PAO diluted 100 / 200 / 300 - fold to Ramos cells;

[0058] Figure 13 G - I. The cytotoxicity of PAO@NF diluted 100 / 200 / 300 - fold to CEM cells;

[0059] Figure 13 J - L. The cytotoxicity of PAO@NF diluted 100 / 200 / 300 - fold to Ramos cells;

[0060] Figure 14 , Confocal fluorescence microscopy was used to verify the cytotoxicity of PAO@NF to CEM cells;

[0061] Figure 15 , Flow cytometry was used to verify the apoptosis of CEM cells induced by PAO@NF

[0062] Figure 15 A. Treat CEM cells with 5 μL of PAO@NF;

[0063] Figure 15 B. Treat CEM cells with 10 μL of PAO@NF;

[0064] Figure 16 . Verify the induction of oxidative stress in CEM cells by PAO@NF using a confocal fluorescence microscope. Detailed implementation

[0065] The following examples are intended to further illustrate the present invention, rather than limiting it.

[0066] Reagents used in the present invention:

[0067] Template (Sangon Biotech), non-targeted Template (Sangon Biotech), Prime (Sangon Biotech), DNA-Dithiol (Sangon Biotech), Escherichia coli ligase (Takara), Escherichia coli ligase buffer (Takara), EXO I exonuclease (Takara), EXOⅢ exonuclease (Takara), 20bp DNA maker (Takara), phi29 DNA polymerase (GENE), phi29 DNA polymerase buffer (GENE), DNTP (GENE), Dutp-FITC (Thermo Fisher)

[0068] Reagents prepared in the present invention:

[0069] 1. Washing Buffer: Weigh 0.5082 g of magnesium chloride hexahydrate and 2.25 g of glucose, add to 30 mL of DPBS, dissolve, and add to the remaining 470 mL of DPBS, store at 4°C.

[0070] 2. Binding Buffer: Weigh 0.01 g of BSA, add to 10 mL of Washing Buffer, then add 100 μL of tRNA (100 mg / mL), vortex and shake well to dissolve completely, store at 4°C.

[0071] 3. 1640 complete medium: Add 50 mL of FBS and 5 mL of P / S to 500 mL of 1640 medium, store at 4°C.

[0072] 4. 60 μM GSH solution: Weigh 276.588 mg of GSH and place it in a 50 ml centrifuge tube, add 15 mL of ddH 2 O and shake well.

[0073] 5. 30 mM PAO solution: Weigh 75.609 mg of PAO and place it in a 50-ml centrifuge tube. Add 0.15 mL of DMSO and 14.85 mL of ddH 2 O and shake well.

[0074] 6. 18.78 mg / L PAO solution: Weigh 939 μg of PAO and place it in a 50-ml centrifuge tube. Add 0.5 mL of DMSO and 49.5 mL of ddH 2 O and shake well.

[0075] Instruments used in this invention:

[0076] DxP Athena TM Flow cytometer (Cytek), Nikon confocal two-photon microscope (Nikon), AL204 electronic balance (Mettler Toledo), Centrifuge 5418R tabletop centrifuge (Eppendorf), field emission scanning electron microscope (Regulus 8100), molecular weight analyzer (ZS90), 1300Series A2 biological safety cabinet (ThermoScientific), BB150 CO 2 Incubator (Thermo Scientific).

[0077] Example 1: Preparation of nanoflowers.

[0078] 1. Add the following reagents to a 1.5-ml centrifuge tube.

[0079] Component Volume (μL) Final concentration in 100 μL Ultra-pure water 84.2 10× DNA Ligation Buffer 14 1× Template (100 μM) 0.6 0.6 μM Primer (100 μM) 1.2 1.2 μM Total 100

[0080] 2. Vortex the tube and heat the mixture at 95 °C for 5 minutes. Slowly cool the mixture to room temperature over 3 hours.

[0081] Key step: Heating the DNA to 95 °C and then gradually cooling it to room temperature is an important step for complete cDNA hybridization.

[0082] 3. Add 7 μL of E. coli DNA Ligase (60 U / μL) to the annealing mixture obtained in step 2 and mix well with a pipette tip or by gentle vortexing.

[0083] 4. Incubate the mixture at room temperature for 4 h to form a circular template primer complex.

[0084] 5. Add the following reagents to a 1.5-ml centrifuge tube.

[0085]

[0086] Seal the tube tightly with parafilm to avoid loss of solution due to evaporation.

[0087] 6. Incubate the mixture at room temperature for more than 6 hours.

[0088] Key step: By adjusting the RCR reaction time, the size of NF can be easily adjusted.

[0089] 7. Inactivate phi29 DNA polymerase at 75 °C for 10 minutes to end the reaction.

[0090] 8. Centrifuge the product at 14,000 g for 10 minutes.

[0091] 9. Remove the supernatant with a pipette and resuspend with 200 μl of DPBS.

[0092] 10. Resuspend NF by pipetting the mixture up and down or gently vortexing.

[0093] The designed sequences are as follows:

[0094] Template (containing sgc8 sequence):

[0095] Phospate-CATATCCCTAGGGATATGTCTAACCGTACAGTATTTTCCCGGCGGCGCAGCAGTTAGATTTGTTGGTACG TTAATACGACGACTCACTAT

[0096] Template (non-targeted, control sequence):

[0097]

[0098] Primer: CATATCCCTAGGGATATGATAGTGAGTCGTATT

[0099] DNA-Dithiol: TTGTTGGTACGTTAATACGACTCACAAT-Dithiol

[0100] Sgc8: ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA

[0101] Since the Sgc8 nucleic acid aptamer specifically binds to the PTK7 protein, the preparation and characterization of DNA nanoflowers and targeting leukemia cells containing PTK7 expression are carried out to kill and treat cancer cells.

[0102] Example 2: Characterization of agarose after successful preparation of nanoflowers.

[0103] 1. Prepare 3% agarose gel

[0104] 2. Prepare the agarose electrophoresis samples as shown in the following table.

[0105]

[0106] 3. Load the samples into the wells and perform electrophoresis at 125 V for 35 minutes.

[0107] 4. Stop the electrophoresis and take out the gel. Image the DNA bands under ultraviolet light using a Bio-Rad molecular imager and imaging software.

[0108] Figure 2 The results showed the generation of DNA loops and nanoflowers. The generated DNA loops had the same molecular weight as the Template, but the loops and single strands migrated at different speeds on the agarose gel plate, so the bands of the loops deviated from the position of the Template. The molecular weight of the nanoflowers was extremely large after rolling circle amplification to form flowers, so a bright area appeared in the loading well of the nanoflowers.

[0109] Example 3: Successful preparation of nanoflowers and characterization by scanning electron microscopy after drug loading.

[0110] SEM imaging of NF:

[0111] ① Immerse the cut silicon wafer in absolute ethanol for half an hour.

[0112] ② Put the soaked silicon wafer into the oven and dry it.

[0113] ③ Add 10 μL of the NF stock solution to the clean silicon wafer and spread it evenly.

[0114] ④ Put it into the oven and dry it.

[0115] ⑤ Spray gold before SEM imaging.

[0116] ⑥ Observe the size and surface morphology of NF using SEM.

[0117] Key step: It is necessary to use SEM to check the morphology and size of NFs during the growth process. The self-assembly of NFs is a time-varying process, and by adjusting the RCR reaction time, NFs with a diameter ranging from ~200 nm to several micrometers can be prepared according to the needs of each application.

[0118] Figure 3 The results showed that the size of the nanoflowers gradually increased with the increase of the rolling circle amplification time. Therefore, the size of the synthesized nanoflowers can be controlled by regulating the rolling circle amplification time.

[0119] Example 4: DLS characterization of the size of nanoflowers after different RCA times.

[0120] 1. Prepare nanoflowers with different RCA times.

[0121] 2. Dilute the nanoflowers to meet the concentration requirements for DLS analysis.

[0122] 3. Ultrasonically treat the diluted nanoflower samples to increase the dispersion of the samples.

[0123] 4. Dilute or perform other treatments on the samples during loading to make the samples meet the loading requirements, and then detect the samples.

[0124] Figure 4 The results are the same as those of SEM, indicating that as the RCA time increases, the size of the nanoflowers gradually increases, and the size of the nanoflowers can be regulated by controlling the RCA time.

[0125] Example 5: Verification of the loading of phenylarsine oxide on nanoflowers by SEM and EDS elemental analysis.

[0126] Preparation of drug-loaded nanoflowers:

[0127] 1. Treat the prepared nanoflowers with 60 μM GSH for 30 min.

[0128] 2. Remove the supernatant by centrifugation at 14000 rpm for 10 min, resuspend with DPBS, add 30 mM PAO and treat for 2 h, remove the supernatant by centrifugation at 14000 rpm for 10 min, and repeat the operation twice.

[0129] 3. Add 10 μL of the NF solution to a clean silicon wafer and spread it evenly.

[0130] 4. Dry it in an oven.

[0131] 5. Spray gold before SEM imaging.

[0132] 6. Observe the size and surface morphology of the NF using SEM.

[0133] 7. Analyze the elements and their contents in the selected nanoflower region by EDS.

[0134] Figure 5 The results show that when elemental analysis is performed on the selected nanoflower region, it is found that the As content is high in the nanoflower region, while the As content is very low or absent in the region without nanoflowers. Therefore, the results indicate that PAO has been successfully loaded onto the nanoflowers.

[0135] Example 6: Measurement of the size and potential changes of nanoflowers before and after drug loading by DLS.

[0136] 1. Prepare nanoflowers with RCA of 8 h and divide them into two groups.

[0137] 2. Treat the drug-loaded group with 60 μM GSH for 30 min.

[0138] 3. Discard the supernatant at 14000 rpm for 10 min, resuspend with DPBS, add 30 mM PAO and treat for 2 h, discard the supernatant at 14000 rpm for 10 min, resuspend with DPBS, and repeat the operation twice.

[0139] 4. Dilute and ultrasonically treat the nanoflowers of both the drug-loaded group and the control group.

[0140] 5. Dilute or perform other treatments on the samples while loading to meet the loading requirements, and detect the samples.

[0141] Figure 6 The results show that the size of the nanoflowers increases after drug loading, and the zeta potential changes from near neutral to negatively charged, which also verifies the loading of PAO onto the nanoflowers.

[0142] Example 7: Determine the concentration of PAO in the nanoflower solution after drug loading by ICP-OES.

[0143] 1. Pipette 60 μL of the prepared nanoflower samples into five 15 mL centrifuge tubes respectively, and treat with 60 μM GSH for 30 min.

[0144] 2. Discard the supernatant at 14000 rpm for 10 min, resuspend with DPBS, add 18 / 15 / 12 / 12 / 12 μL of 30 mM PAO to the five tubes respectively and treat for 2 h, discard the supernatant at 14000 rpm for 10 min, resuspend with DPBS, and repeat the operation twice.

[0145] 3. Digest the samples in the centrifuge tubes with 5 mL of nitric acid respectively, and detect the As content by ICP-OES.

[0146] Figure 7 The results show that the volume of PAO added is positively correlated with the final concentration of the nanoflower samples. When the input ratio of nanoflowers to 30 mM PAO is 5:1 (such as adding 60 μL of NF and 12 μL of PAO), the arsenic concentration in PAO@NF is 18.78 mg / L.

[0147] Example 8: Verify that the nanoflowers can bind to CEM cells by confocal microscopy.

[0148] 1. Culture and pretreatment of CEM cells: The CEM medium is 1640, containing 10% FBS, and the culture conditions are 37 °C, 5% CO 2 .

[0149] 2. Collect CEM cells in the culture flask using a 15 mL sterile centrifuge tube, centrifuge at 300 g for 5 min at 25 °C, discard all the culture medium, wash once with DPBS, 5 - 8 mL DPBS each time. Centrifuge at 300 g for 5 min at 25 °C, discard all the supernatant, and count the cells.

[0150] 3. Add Binding Buffer to the CEM cell sample, gently shake and mix well to resuspend the cells, and set up sample groups with a 200 μL incubation system. Then add nanoflower NF (with sgc8 targeting sequence) and NNF (without sgc8 targeting sequence) respectively, and incubate at 37 °C for 1 h.

[0151] 4. After incubation, centrifuge at 300 g for 5 min at 25 °C, discard all the supernatant. Then add 200 μL Washing Buffer to wash the cells 3 times, and then add 200 μL Washing Buffer to resuspend the cells, transfer to an optical dish and observe and analyze by laser confocal microscope.

[0152] Figure 8 The results show that the nanoflower NF containing the sgc8 targeting sequence has a stronger binding ability to CEM cells than the nanoflower NNF without the sgc8 sequence.

[0153] Example 9: Verification of the targeting ability of nanoflowers to CEM cells by flow cytometry.

[0154] 1. Culture and pretreatment of CEM and Ramos cells (low or no PTK7 content, used as control cells for CEM): The culture media for CEM and Ramos are 1640 containing 10% FBS, and the culture conditions are 37 °C, 5% CO 2 。

[0155] 2. Collect CEM and Ramos cells in the culture flask using a 15 mL sterile centrifuge tube, centrifuge at 300 g for 5 min at 25 °C, discard all the culture medium, wash once with DPBS, 5 - 8 mL DPBS each time. Centrifuge at 300 g for 5 min at 25 °C, discard all the supernatant, and count the cells.

[0156] 3. Add Binding Buffer to the CEM and Ramos cell samples, gently shake and mix well to resuspend the cells, and set up sample groups with a 500 μL incubation system. Then add the targeted nanoflower NF and the non-targeted nanoflower NNF. Incubate at 37 °C for 1 h.

[0157] 4. After incubation, centrifuge at 300 g for 5 min at 25 °C, and discard all the supernatant. Then add 200 μL of Washing Buffer to wash the cells three times. After that, add 400 μL of Washing Buffer to resuspend the cells, transfer them to a flow cytometry tube for flow cytometry analysis.

[0158] Figure 9 The results showed that the nanoflowers NF containing the sgc8 sequence had targeting ability to CEM cells.

[0159] Example 10: Verification of the internalization of nanoflowers by flow cytometry.

[0160] 1. Culture and pretreatment of CEM cells: The CEM medium is 1640 containing 10% FBS, and the culture conditions are 37 °C and 5% CO 2 .

[0161] 2. Use a 15 mL sterile centrifuge tube to collect CEM cells in the culture flask, centrifuge at 300 g for 5 min at 25 °C, discard all the culture medium, then wash once with DPBS, 5 - 8 mL of DPBS each time. Centrifuge at 300 g for 5 min at 25 °C, discard all the supernatant, and count the cells.

[0162] 3. Add Binding Buffer to the CEM cell sample, gently shake and mix well to resuspend the cells, and set up sample groups with a 500 μL incubation system. Then add the targeted nanoflowers NF to two of the three experimental groups, and add the non-targeted nanoflowers NNF to the other group, and incubate at 37 °C for 3 h.

[0163] 4. After incubation, centrifuge at 300 g for 5 min at 25 °C, and discard all the supernatant. Then add 200 μL of Washing Buffer to wash the cells three times. Optionally, add trypsin to one of the two NF-treated groups and incubate for 15 minutes, then add 200 μL of Washing Buffer to wash the cells three times. Add 400 μL of Washing Buffer to resuspend the cells in all three groups, transfer them to a flow cytometry tube for flow cytometry analysis.

[0164] Figure 10 The results showed that the fluorescence intensity of the cells in the undigested sample was significantly shifted compared with the blank control group, that is, NF was significantly bound to the cells; after trypsin digestion, the fluorescence intensity decreased slightly and was still significantly higher than that of the control group. This application proves that DNA nanoflowers can be internalized.

[0165] The experimental principle is based on the following: If NF is only adsorbed on the cell membrane surface, the fluorescence signal it carries (such as FITC labeled on DNA nanoblooms) should be significantly weakened after treatment with trypsin; conversely, if NF has entered the cell through endocytosis, the fluorescence intensity can still remain stable after digestion. Specifically, CEM cells were co-incubated with FITC-labeled NF at 37 °C (normal endocytic activity) for 2 hours, and then treated with 0.25% trypsin-EDTA solution for 10 minutes to completely remove the NF bound to the membrane surface, and the dynamic changes in the fluorescence intensity of the cell population were quantitatively analyzed by flow cytometry.

[0166] Example 11: Exploring the internalization pathway of nanoblooms by flow cytometry.

[0167] 1. Cultivation and pretreatment of CEM cells: The CEM medium is 1640, containing 10% FBS, and the culture conditions are 37 °C, 5% CO 2 .

[0168] 2. Use a 15 mL sterile centrifuge tube to collect CEM cells in the culture flask, centrifuge at 300 g for 5 min at 25 °C, discard all the medium, then wash once with DPBS, 5 - 8 mL DPBS / time. Centrifuge at 300 g for 5 min at 25 °C, discard all the supernatant, and count.

[0169] 3. Add Binding Buffer to the CEM cell sample, gently shake and mix well to resuspend the cells, and divide the sample into five groups with a 500 μL incubation system. Take three samples and treat them with cell internalization inhibitors (Methyl-β-cyclodextrin, Chlorpromazine hydrochloride, 5-(N-Methyl-N-isopropyl)amiloride) respectively, and place them at 37 °C for incubation for 30 min.

[0170] 4. After the incubation, centrifuge at 300 g for 5 min at 25 °C, discard all the supernatant. Then add 200 μL Washing Buffer to wash the cells 3 times, and then add 500 μL Binding Buffer to resuspend the cells. Treat the other two untreated samples with 15 μL Binding Buffer (Control group) and 15 μL DNA nanoblooms containing the sgc8 sequence (NF group) respectively.

[0171] 5. Place the five samples at 37 °C for incubation for 2 h.

[0172] 6. Centrifuge at 1000 rpm for 5 min at 25 °C, discard all the supernatant, and digest with trypsin at 37 °C for 30 min.

[0173] Centrifuge at 1000 rpm for 5 min at 25 °C, discard the supernatant completely, and then wash twice with Washing Buffer. Resuspend the cells in 400 μL of Washing Buffer per tube and transfer to a flow cytometry tube for flow cytometry analysis.

[0174] Figure 11 The results showed that CEM cells were pretreated with chlorpromazine HCl (inhibiting clathrin-mediated endocytosis), amiloride (inhibiting macropinocytosis), and methyl-β-cyclodextrin (MβCD, inhibiting caveolin-mediated endocytosis) for 30 minutes, and then co-incubated with FITC-labeled DNA nanoflowers for 2 hours. After trypsin digestion to remove the membrane-bound particles, the intracellular fluorescence intensity was detected by flow cytometry. The results showed that the fluorescence intensity in the MβCD group decreased more than that in the control group but did not fully recover, indicating that caveolin-mediated endocytosis is the main internalization pathway; the fluorescence intensity in the Amiloride and Chlorpromazine HCl groups also decreased, suggesting that macropinocytosis and clathrin-mediated endocytosis are involved synergistically. It shows that cells may internalize substances through multiple pathways, and this redundancy enhances the efficiency or adaptability of endocytosis, especially maintaining partial functions when the main pathway is blocked. Nanoparticles or nucleic acid drugs targeting the caveolin pathway can avoid lysosomal degradation and improve drug delivery efficiency.

[0175] Example 12: Verify the serum stability of nanoflowers by SEM.

[0176] 1. Prepare nanoflower samples, divide the nanoflowers into three equal parts, and place them in a 10% fetal bovine serum solution.

[0177] 2. At 0 / 24 / 48 h, remove the supernatant from the nanoflower samples by centrifugation at 14000 rpm for 10 min, resuspend with DPBS, and repeat the operation twice.

[0178] 3. Add 10 μL of the DNA nanoflower solution treated with 10% fetal bovine serum for 0 / 24 / 48 h to three clean silicon wafers respectively, and spread evenly.

[0179] 4. Place in an oven to dry.

[0180] 5. Spray gold before SEM imaging.

[0181] 6. Observe the size and surface morphology of NF using SEM.

[0182] Figure 12 The results showed that the nanoflowers had good serum stability.

[0183] Example 13: Explore the killing effect of free and PAO@NF on CEM cells by cck-8

[0184] 1. Prepare a free PAO sample at 18.78 mg / L (solubilized with 1% DMSO).

[0185] 2. Prepare PAO@NF (add 2 μL of 30 mM PAO to every 10 μL of nanoflowers), centrifuge at 14,000 rpm for 10 min, discard the supernatant, and resuspend with DPBS or ultrapure water.

[0186] 3. Take a 96-well plate and add 80 μL of 1.5×10 5 CEM (target cells) / Ramos (non-target control) cells to each well of B4 - F10, and add 90 μL of complete 1640 medium to each well of B3 - F3.

[0187] 4. Add 1 μL of PAO@NF or free PAO diluted 100 / 200 / 300 times to each well of B5 - F5,

[0188] add 3 μL of PAO@NF or free PAO diluted 100 / 200 / 300 times to each well of B6 - F6,

[0189] add 5 μL of PAO@NF or free PAO diluted 100 / 200 / 300 times to each well of B7 - F7,

[0190] add 7 μL of PAO@NF or free PAO diluted 100 / 200 / 300 times to each well of B8 - F8,

[0191] add 9 μL of PAO@NF or free PAO diluted 100 / 200 / 300 times to each well of B9 - F9,

[0192] add 11 μL of PAO@NF or free PAO diluted 100 / 200 / 300 times to each well of B10 - F10, and make up the volume of each well loaded on B3 - F10 to 91 μL with complete 1640 medium to ensure the same volume for each loaded well.

[0193] Incubate in a 37°C, 5% CO 2 incubator for 48 h.

[0194] 5. Add 10 μL of cck-8 to each well of B3 - F10 loaded, and incubate in a 37°C, 5% CO 2 incubator for 1.5 h.

[0195] 6. Use a microplate reader to detect the absorbance to verify cytotoxicity.

[0196] Figure 13The results showed that the free PAO group had significant killing ability against both CEM and Ramos cells. And free PAO showed stronger cytotoxicity to Ramos cells than to CEM cells. In contrast, the PAO@NF group still had strong toxicity to CEM cells, while the toxicity to Ramos cells was significantly reduced. This result fully demonstrated that PAO@NF had a selective killing effect on CEM.

[0197] Example 14: Determine the cytotoxicity of PAO@NF to CEM cells.

[0198] 1. Take CEM cells in a 15 mL centrifuge tube in the laminar flow hood, remove the supernatant at 1000 rpm for 5 min, wash once with DPBS, resuspend with 1640 complete medium, and count the cells.

[0199] 2. Take a 6-well plate and add 1 mL of 4×106 CEM cells to two of the wells.

[0200] 3. Leave one well untreated, and add 20 μL of arsenic-loaded DNA nanoflowers diluted 50-fold to the other well, and place it in an incubator at 37°C and 5% CO 2 and incubate for 12 h.

[0201] 4. Aspirate the cells in the 6-well plate into different centrifuge tubes, centrifuge at 1000 rpm for 5 min, discard the supernatant, add 1 mL of Calcein AM / PI detection working solution to gently resuspend the cells, and at the same time add 0.5 μL of Calcein AM (1000X) and 0.5 μL of PI (1000X), and incubate at 37°C in the dark for 30 min.

[0202] 5. After the incubation, observe the staining effect under a fluorescence microscope (Calcein AM is green fluorescence, Ex / Em = 494 / 517 nm; PI is red fluorescence, Ex / Em = 535 / 617 nm).

[0203] Figure 14 The results showed that the two probes of the Calcein / PI Cell Viability and Cytotoxicity Detection Kit could detect the intracellular esterase activity and cell membrane integrity respectively, so as to reflect the cell viability and cytotoxicity. Among them, Calcein AM stained living cells and showed green fluorescence; while propidium iodide (PI) stained dead cells and showed red fluorescence. Thus, it was judged that PAO@NF had strong cytotoxicity to CEM through the fluorescence signal.

[0204] Example 15: Explore the cell damage pathway by flow cytometry.

[0205] 1. Take CEM cells in a 15 mL centrifuge tube in a laminar flow hood, remove the supernatant at 1000 rpm for 5 min, wash once with DPBS, resuspend with 1640 complete medium, and count the cells.

[0206] 2. Take a 6-well plate and add 1 mL of 4×10 6 CEM cells to four of the wells.

[0207] 3. Leave two wells untreated, and add 5 / 10 μL of arsenic-loaded DNA nanoflowers diluted 50-fold to the other two wells respectively. Incubate in an incubator at 37 °C and 5% CO 2 for 12 h.

[0208] 4. Aspirate the cells in each well of the 6-well plate into different centrifuge tubes, centrifuge at 1000 rpm for 5 min, discard the supernatant, and add 195 μL of Annexin V-FITC binding solution to gently resuspend the cells.

[0209] 5. Add 5 μL of Annexin V-FITC or 10 μL of propidium iodide staining solution to the two untreated tubes respectively, and mix gently. Add 5 μL of Annexin V-FITC and 10 μL of propidium iodide staining solution to the two tubes treated with apoptosis, and mix gently.

[0210] 6. Incubate in the dark at room temperature for 10 - 20 minutes, and then place on an ice box. Detect the apoptosis situation by flow cytometry.

[0211] Figure 15 The results show that the cells in the lower left quadrant (Q3) are live cells, the cells in the lower right quadrant (Q4) are early apoptotic cells, the cells in the upper right quadrant (Q2) are late apoptotic cells, and the cells in the upper left quadrant (Q1) are mechanically damaged cells. As Figure 15 shown in A, the early apoptosis rate (Annexin V + / PI - ) of CEM cells induced by PAO@NF reaches 13.9%, and the late apoptosis rate (Annexin V + / PI + ) is 15.1%. As Figure 15 shown in B, the early apoptosis rate (Annexin V + / PI - ) of CEM cells induced by PAO@NF reaches 31.1%, and the late apoptosis rate (Annexin V + / PI + ) is 35.7%. The results prove that NF-PAO has a significant effect on inducing apoptosis of CEM cells, and the degree of apoptosis is positively correlated with the dose of PAO@NF input.

[0212] Example 16: Determination of the intracellular reactive oxygen species level in CEM cells

[0213] 1. Dilute DCFH-DA with serum-free medium to a final concentration of 10 μM / L.

[0214] 2. Take CEM cells in a 15 mL centrifuge tube in the laminar flow hood, remove the supernatant at 1000 rpm for 5 min, wash once with DPBS, resuspend with 1640 complete medium, and count the cells.

[0215] 3. Take a 6-well plate and add 1 mL of 4×10 6 CEM cells to three of the wells.

[0216] 4. Leave one well untreated, and add 2.5 / 20 μL of arsenic-loaded DNA nanoflowers diluted 50-fold to the other two wells, and incubate in a 37°C, 5% CO 2 incubator for 12 h.

[0217] 5. Aspirate the cells in the 6-well plate into different centrifuge tubes, centrifuge at 1000 rpm for 5 min, discard the supernatant, and add 1 mL of diluted DCFH-DA to gently resuspend the cells.

[0218] 6. Incubate in the dark at room temperature for 20 minutes, and detect the ROS level in CEM cells with a confocal fluorescence microscope.

[0219] Figure 16 The results show that DCFH-DA itself has no fluorescence and can freely cross the cell membrane. After entering the cell, it can be hydrolyzed by intracellular esterase to generate DCFH. DCFH cannot penetrate the cell membrane, so the probe can be easily loaded into the cell. Intracellular reactive oxygen species can oxidize non-fluorescent DCFH to generate fluorescent DCF. Therefore, detecting the fluorescence of DCF can know the level of intracellular reactive oxygen species. Obviously, according to the results of the confocal fluorescence microscope, PAO@NF can increase the ROS level in CEM cells. And as the input amount of PAO@NF increases, the ROS level in CEM cells also increases significantly.

Claims

1. A leukemia targeted therapeutic preparation, characterized in that: It includes a DNA nanoflower carrier with the ability to target leukemia cells and phenylarsenic oxide loaded on the carrier.

2. The leukemia targeted therapeutic preparation according to claim 1, characterized in that: The DNA nanoflower vector is obtained by rolling circle amplification, and a nucleic acid aptamer complementary sequence targeting and binding to leukemia cells is introduced into the template chain of rolling circle amplification.

3. The leukemia targeted therapeutic preparation according to claim 1 or 2, characterized in that: DNA-Dithiol was used to modify the thiol groups on the DNA nanoflowers, and then reduced glutathione was used to break the disulfide bonds to expose the thiol groups. Phenylarsenic oxide reacted with the thiol groups and loaded them onto the DNA nanoflowers.

4. The leukemia targeted therapeutic preparation according to claim 1, 2 or 3, characterized in that: The DNA nanoflower is labeled with at least one of fluorescent substances, radioactive substances, therapeutic substances, and biotin.

5. The method for preparing the leukemia targeted therapeutic preparation according to any one of claims 1 to 4, characterized in that: The following steps are involved: (1) Designing templates and primers for rolling circle amplification, introducing complementary sequences of nucleic acid aptamers that target and bind to leukemia cells into the template chain, and then performing rolling circle amplification to obtain DNA nanoflowers with the function of targeting and binding to leukemia cells; (2) DNA-Dithiol is used to modify the thiol groups on the DNA nanoflowers, and then reduced glutathione is used to break the disulfide bonds to expose the thiol groups. Phenylarsenic oxide reacts with the thiol groups and loads them onto the DNA nanoflowers.

6. Use of the leukemia targeted therapeutic preparation according to any one of claims 1 to 4, characterized in that: Used to prepare drugs for treating leukemia.

7. Use of the leukemia targeted therapeutic preparation according to any one of claims 1 to 4, characterized in that: Used to prepare leukemia targeted diagnostic reagents.

8. Use of the leukemia targeted therapeutic preparation according to any one of claims 1 to 4, characterized in that: Used to prepare reagents targeting leukemia cells.

Citation Information

Cited By

  • Nano-drug for delivering siBCL11B to treat T-ALL by combining aptamer sgc8 as well as preparation method and application of nano-drug

    CN119015438A

  • Nanomedicine for treating t-all by delivering sgc8 binding aptamer-sibcl11b and preparation method and application thereof

    CN119015438B