Application of lipoxygenase Lipoxygenase in preparation of medicine for resisting novel bunyavirus

Abstract

The invention discloses an application of lipoxygenase (Lipoxygenase) in preparation of a medicine for resisting a novel bunyavirus (Bunyavirus). In-vivo and in-vitro experiments find that lipoxygenase can destroy the structure of the novel bunyavirus and reduce the infection rate of the novel bunyavirus, so that multi-tissue organ injury caused by infection of the novel bunyavirus is relieved, and the novel bunyavirus is inhibited. Therefore, the lipoxygenase can be used for preparing the medicine for preventing and / or treating the novel bunyavirus disease.

Description

Technical Field

[0001] The invention relates to the technical field of biomedicine, and in particular to the application of lipoxygenase in the preparation of drugs against novel bunyaviruses. Background Art

[0002] The new Bunyavirus disease (fever with thrombocytopnia syndrome) was first reported in 2009. Cases are mainly distributed in rural areas in mountainous and hilly areas. The cases are highly sporadic, but relatively concentrated in geographical distribution. The new Bunyavirus, Sever fever with thrombocytopnia syndrome virus (SFTSV), is mainly transmitted through the bite of infected ticks (mainly long-horned ticks). The virus can also be transmitted through direct contact with the patient's blood or its contaminants, thereby causing infection to medical staff, visitors or funeral personnel. People are generally susceptible to this disease. People who participate in agricultural planting activities or tea picking, farmers living in rural hilly or forested areas, and people who travel to such areas are at high risk of infection with the new Bunyavirus, and the incidence rate shows an upward trend with increasing age.

[0003] The incubation period of the new Bunyavirus infecting humans is not very clear, but it may be 1-2 weeks. In cases of human-to-human transmission, the incubation period is mostly 6 to 9 days. Clinical symptoms include low platelets, low white blood cell count, fever, fatigue, general discomfort, muscle aches, poor appetite, nausea, vomiting, diarrhea and other digestive symptoms. Critically ill patients also have skin ecchymoses, involuntary movements of the mandible, limbs and other parts accompanied by increased muscle tension and neurological symptoms such as drowsiness, confusion or lethargy, combined with lung infection, bleeding in the digestive tract, lungs, uterus and other cavities, and even multiple organ failure leading to death.

[0004] In the mouse model infected with the new Bunyavirus, early histopathological changes mainly occurred in the spleen and bone marrow, with an increase in the number of monocytes and a decrease in the number of lymphocytes, which then gradually recovered after 2 weeks. In the later stages of infection, a large number of liver and kidney cells underwent degeneration and necrosis, showing pathological changes and damage.

[0005] Lipoxygenases (LOXs) are lipid oxidases that are widely present in animals, plants, and fungi. Lipoxygenases can catalyze the oxidation of polyunsaturated fatty acids containing a series of cis double bonds (such as arachidonic acid and linoleic acid). Lipoxygenases can produce a series of biologically active products that participate in regulating cell physiological functions and the occurrence and development of diseases.

[0006] There are no reports on the research of lipoxygenase in fighting against new bunyaviruses. Summary of the invention

[0007] The purpose of the present invention is to provide a new medicinal use of lipoxygenase.

[0008] The new pharmaceutical use of lipoxygenase provided by the present invention is the use of lipoxygenase or a pharmaceutically acceptable salt thereof in the preparation of the following products:

[0009] 1) Drugs against novel bunyaviruses;

[0010] 2) Drugs for preventing and / or treating diseases caused by novel bunyavirus infection;

[0011] 3) Drugs that inhibit new bunyaviruses;

[0012] 4) New Bunyavirus quencher.

[0013] In vivo and in vitro pharmacodynamic experiments confirmed that lipoxygenase can effectively inhibit the new Bunyavirus in both in vitro cell models and animal models, and has the potential to be used in the preparation of drugs against the new Bunyavirus.

[0014] In the above applications, any of the above products may be a drug or a drug preparation.

[0015] In the above application, the disease caused by the novel Bunyavirus infection is novel Bunyavirus disease or fever with thrombocytopenia syndrome.

[0016] The pharmaceutically acceptable salt of lipoxygenase refers to a salt that is suitable for contact with tissues of humans and lower animals without excessive toxicity, irritation, allergic reaction, etc., and is commensurate with a reasonable effect / risk ratio within the scope of reliable medical judgment.

[0017] The pharmaceutically acceptable salts of the lipoxygenase are well known in the art, including but not limited to sodium salt, potassium salt, calcium salt, hydrochloride, nitrate, sulfate, bisulfate, phosphate, hydrogen phosphate, acetate, oxalate, lactate, citrate, tartrate and maleate, etc.

[0018] In the above application, when preparing medicine or pharmaceutical preparation, the lipoxygenase can be used as one of the effective ingredients or as the only effective ingredient.

[0019] In the above application, when preparing drugs or pharmaceutical preparations, the pharmaceutically acceptable salt of the lipoxygenase can be used as one of the active ingredients or as the only active ingredient.

[0020] In the above applications, carrier materials may also be added when preparing drugs or drug preparations.

[0021] The carrier material includes, but is not limited to, water-soluble carrier materials (such as polyethylene glycol, polyvinyl pyrrolidone, organic acid, etc.), poorly soluble carrier materials (such as ethyl cellulose, cholesterol stearate, etc.), enteric carrier materials (such as cellulose acetate phthalate and carboxymethyl ethyl cellulose, etc.). These materials can be used to make a variety of dosage forms, including but not limited to tablets, capsules, dripping pills, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal agents, buccal tablets, suppositories, freeze-dried powder injections, etc. It can be a common preparation, a sustained-release preparation, a controlled-release preparation, and various microparticle delivery systems. In order to make a unit dosage form into a tablet, various carriers known in the art can be widely used. Examples of carriers include diluents and absorbents, such as starch, dextrin, calcium sulfate, lactose, mannitol, sucrose, sodium chloride, glucose, urea, calcium carbonate, kaolin, microcrystalline cellulose, aluminum silicate, etc.; wetting agents and binders, such as water, glycerol, polyethylene glycol, ethanol, propanol, starch paste, dextrin, syrup, honey, glucose solution, acacia paste, gelatin paste, sodium carboxymethylcellulose, shellac, methylcellulose, potassium phosphate, polyvinyl pyrrolidone, etc.; disintegrants. , such as dry starch, alginate, agar powder, brown algae starch, sodium bicarbonate and citric acid, calcium carbonate, polyoxyethylene, sorbitan fatty acid esters, sodium lauryl sulfate, methyl cellulose, ethyl cellulose, etc.; disintegration inhibitors, such as sucrose, tristearate, cocoa butter, hydrogenated oil, etc.; absorption promoters, such as quaternary ammonium salts, sodium lauryl sulfate, etc.; lubricants, such as talc, silicon dioxide, corn starch, stearate, boric acid, liquid paraffin, polyethylene glycol, etc. The tablets can also be further made into coated tablets, such as sugar-coated tablets, film-coated tablets, enteric-coated tablets, or double-layer tablets and multi-layer tablets. In order to make the unit dosage form into a pill, various carriers known in the art can be widely used. Examples of carriers include diluents and absorbents, such as glucose, lactose, starch, cocoa butter, hydrogenated vegetable oil, polyvinyl pyrrolidone, kaolin, talc, etc.; binders such as gum arabic, tragacanth, gelatin, ethanol, honey, liquid sugar, rice paste or flour paste, etc.; disintegrants such as agar powder, dry starch, alginate, sodium dodecyl sulfate, methyl cellulose, ethyl cellulose, etc. In order to prepare the unit dosage form into a suppository, various carriers known in the art can be widely used. Examples of carriers include, for example, polyethylene glycol, lecithin, cocoa butter, higher alcohols, esters of higher alcohols, gelatin, semi-synthetic glycerides, etc. In order to prepare the unit dosage form into an injectable preparation, such as a solution, emulsion, freeze-dried powder injection and suspension, all diluents commonly used in the art can be used, for example, water, ethanol, polyethylene glycol, 1,3-propylene glycol, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol fatty acid esters, etc. In addition, in order to prepare an isotonic injection, an appropriate amount of sodium chloride, glucose or glycerol may be added to the injection preparation. In addition, conventional solubilizers, buffers, pH adjusters, etc. may also be added.In addition, if necessary, colorants, preservatives, flavors, flavoring agents, sweeteners or other materials may be added to the pharmaceutical preparations. The above dosage forms can be administered by injection, including subcutaneous injection, intravenous injection, intramuscular injection and intracavitary injection, etc.; cavity administration, such as rectal and vaginal administration; respiratory tract administration, such as nasal cavity; mucosal administration.

[0022] The present invention also provides a medicine or a medicine preparation.

[0023] The active ingredient of the medicine or pharmaceutical preparation provided by the present invention is lipoxygenase or a pharmaceutically acceptable salt thereof.

[0024] The medicine or pharmaceutical preparation provided by the present invention can be used to prevent and / or treat diseases caused by novel Bunyavirus infection (novel Bunyavirus disease or fever with thrombocytopenia syndrome).

[0025] The medicine or pharmaceutical preparation provided by the present invention can be used to inhibit the novel Bunyavirus.

[0026] The drug or drug preparation provided by the present invention can be a novel bunyavirus quencher.

[0027] The drugs or pharmaceutical preparations provided by the present invention can be prepared into dosage forms such as solutions, tablets, granules, suspensions, capsules, injections, etc. according to conventional methods known to those skilled in the art.

[0028] When the lipoxygenase or its pharmaceutically acceptable salt provided by the present invention is used to prevent and / or treat diseases caused by novel bunyavirus infection (novel bunyavirus disease or fever with thrombocytopenia syndrome), an effective amount of lipoxygenase or its pharmaceutically acceptable salt is administered to the subject.

[0029] The dosage and method of use of the lipoxygenase or its pharmaceutically acceptable salt depend on many factors, including the patient's age, weight, gender, natural health status, nutritional status, activity strength of the compound, time of administration, metabolic rate, severity of the disease and the subjective judgment of the treating physician.

[0030] In the present invention, the term "effective amount" refers to a dose that can achieve treatment, prevention, alleviation and / or relief of the diseases or conditions described in the present invention in a subject.

[0031] In the present invention, the term "subject" may refer to a patient or other animal that receives the composition of the present invention to treat, prevent, alleviate and / or relieve the diseases or conditions described in the present invention, particularly mammals, such as humans, dogs, monkeys, cows, horses, etc.

[0032] In one embodiment of the present invention, the lipoxygenase is a Lipoxygenase having a structural formula as shown in formula (I):

[0033]

[0034] In the present invention, the lipoxygenase oxidatively destroys the viral envelope structure, thereby reducing the increase in viral load in tissues and cells caused by novel Bunyavirus infection, thereby alleviating multiple tissue and organ damage caused by novel Bunyavirus infection and inhibiting novel Bunyavirus infection, which is specifically embodied in any one of the following a1)-a5):

[0035] a1) Inhibit the replication of new Bunyaviruses;

[0036] a2) destroy the structure of the new bunyavirus;

[0037] a3) improve the survival rate of subjects infected with the new bunyavirus;

[0038] a4) Inhibit the ability of the virus to infect subjects and reduce the viral load in subjects infected with the new Bunyavirus;

[0039] a5) Alleviate damage to tissues and organs (such as lungs, liver, and spleen) in subjects infected with the novel Bunyavirus.

[0040] Any of the novel Bunyaviruses described above may specifically be the novel Bunyavirus HBMC16 strain.

[0041] The present invention has found through in vitro and in vivo experiments that lipoxygenase can destroy the structure of the new bunyavirus, reduce the infection rate of the new bunyavirus, and then alleviate the multi-tissue and organ damage caused by the infection of the new bunyavirus, thereby inhibiting the new bunyavirus. Therefore, lipoxygenase can be used to prepare drugs for preventing and / or treating new bunyavirus diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 It shows that lipoxygenase inhibits the replication of the new bunyavirus in a dose-dependent manner, wherein A is a schematic diagram of the action of lipoxygenase in Example 1 on the entire stage of cell infection, B is the effect of different concentrations of lipoxygenase on the transcription level of SFTSV in Huh 7 cells, and C is the effect of different concentrations of lipoxygenase on the transcription level of SFTSV in the supernatant of Huh 7 cells.

[0043] Figure 2 This indicates that lipoxygenase can destroy the structure of the new bunyavirus. A is a graph showing the changes in the morphology of virus particles after incubation of lipoxygenase with SFTSV, and B is a graph showing the changes in the content of virus GP and NP proteins after incubation of lipoxygenase with SFTSV.

[0044] Figure 3 It shows that lipoxygenase can improve the survival rate of mice infected with the new bunyavirus.

[0045] Figure 4 This indicates that lipoxygenase can reduce the viral load in mice infected with the new bunyavirus. Wherein, A is the viral load in the serum of mice infected with the new bunyavirus after lipoxygenase (2 mg / mL) was used to treat the new bunyavirus in Example 4, B is the viral load in the spleen of mice, C is the viral load in the lungs of mice, and D is the viral load in the liver of mice.

[0046] Figure 5 It shows that lipoxygenase can alleviate multi-organ damage in mice infected with the new Bunyavirus. DETAILED DESCRIPTION

[0047] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0048] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0049] The lipoxygenase in the following examples is a product of Sigma (lipoxygenase is derived from soybeans), with a product number of L7395 and a CAS number of 9029-60-1; the structural formula is shown in formula (I).

[0050]

[0051] The novel Bunyavirus HBMC16 strain in the following example is recorded in the document “Calcium channel blockers reduce severe fever with thrombocytopenia syndrome virus (SFTSV) related fatality”, isolated from the Wuhan Institute of Virology, Chinese Academy of Sciences (Wuhan, Hubei), and its virus titer was measured on Vero cells by plaque assay.

[0052] The wild-type C57BL / 6 mice in the following examples are products of Beijing Weitonglihua Experimental Animal Technology Co., Ltd.

[0053] The Vero cells in the following examples are products of ATCC (Cat. No.: CCL-81) and were cultured in DMEM medium (Cat. No.: C11995500BT, Gibco) containing 10% fetal bovine serum (FBS, Cat. No.: 10099-141C, Gibco) and 1% double antibody (Penicillin-Streptomycin, Cat. No.: 15140163, Gibco).

[0054] The Huh-7 cells in the following examples are products of CTCC (Cat. No. GDC0134) and were cultured in DMEM (Cat. No. C11995500BT, Gibco) medium containing 10% fetal bovine serum (FBS, Gibco) and 1% double antibody (Penicillin-Streptomycin, Cat. No. 15140163, Gibco).

[0055] Example 1: Lipoxygenase dose-dependently inhibits the replication of a novel bunyavirus

[0056] 1. Pre-treat Huh-7 cells with lipoxygenase at a specified concentration for 2 h, add lipoxygenase at a specified concentration and incubate with DMEM medium containing the novel bunyavirus HBMC16 strain (MOI = 1) for 2 h, discard the medium, replace it with DMEM medium containing lipoxygenase at a specified concentration, and collect cells for detection after 24 h (e.g. Figure 1 According to the different dosages of lipoxygenase added, the patients were divided into the following groups:

[0057] Group 1: DMEM medium containing the novel Bunyavirus HBMC16 strain (MOI=1) and solvent PBS (Cat. No.: C10010500BT, Gibco) were added to the Huh-7 cell culture system (DMEM medium containing Huh-7 cells). The concentration of lipoxygenase in the Huh-7 cell culture system was 0 mg / mL.

[0058] Group 2: DMEM medium containing the novel Bunyavirus HBMC16 strain (MOI=1) and lipoxygenase solution (solvent: PBS) were added to the Huh-7 cell culture system (DMEM medium containing Huh-7 cells). The concentration of lipoxygenase in the Huh-7 cell culture system was 0.25 mg / mL.

[0059] Group 3: DMEM medium containing the novel Bunyavirus HBMC16 strain (MOI=1) and lipoxygenase solution (solvent: PBS) were added to the Huh-7 cell culture system (DMEM medium containing Huh-7 cells). The concentration of lipoxygenase in the Huh-7 cell culture system was 0.5 mg / mL.

[0060] Group 4: DMEM medium containing the novel Bunyavirus HBMC16 strain (MOI=1) and lipoxygenase solution (solvent: PBS) were added to the Huh-7 cell culture system (DMEM medium containing Huh-7 cells). The concentration of lipoxygenase in the Huh-7 cell culture system was 1 mg / mL.

[0061] Group 5: DMEM medium containing the novel Bunyavirus HBMC16 strain (MOI=1) and lipoxygenase solution (solvent: PBS) were added to the Huh-7 cell culture system (DMEM medium containing Huh-7 cells). The concentration of lipoxygenase in the Huh-7 cell culture system was 2 mg / mL.

[0062] Each group of cell culture systems was cultured under 5% CO2 and 37°C for 24 hours, and the cells of each group were collected for detection after 24 hours.

[0063] 2. qPCR detection of intracellular viral load

[0064] This study used RNAprep Pure Cell / Bacteria Kit (Cat. No. DP430, Nanjing Novozyme Biotech Co., Ltd.) to extract viral nucleic acids from cells. The specific steps are as follows:

[0065] ① For adherent cells, remove the original culture medium, wash once with PBS, and add 350 μL of lysis solution RL to lyse the cells.

[0066] ② Transfer all the solution to the filter column CS, collect the filtrate after centrifugation at 13,400×g for 2 minutes, add 1 volume of 70% ethanol to the filtrate, mix well and transfer the liquid to the adsorption column CR3, centrifuge at 13,400×g for 1 minute, pour out the waste liquid in the collection tube, and transfer the adsorption column CR3 to the collection tube.

[0067] ③ Add 350 μL of deproteinized solution RW1 to CR3, centrifuge at 13,400×g for 1 min, discard the waste liquid in the collection tube, transfer the adsorption column CR3 to the collection tube, and repeat this step.

[0068] ④ Add 500 μL of rinsing solution RW to the adsorption column CR3, let it stand at room temperature for 2 minutes, centrifuge at 13,400×g for 1 minute, pour out the waste liquid in the collection tube, transfer the adsorption column CR3 to the collection tube, and repeat this step.

[0069] ⑤ Centrifuge at 13,400×g for 2 minutes, discard the remaining waste liquid in the centrifuge tube, and place the adsorption column CR3 at room temperature for several minutes to completely dry the residual rinse liquid in the adsorption material.

[0070] ⑥ Transfer the adsorption column CR3 into a new RNase-Free centrifuge tube, add 50 μL RNase-Free ddH2O, incubate at room temperature for 2 minutes, and centrifuge at 13,400×g for 2 minutes to obtain RNA solution.

[0071] The reagent used was HiScript II one Step qRT-PCR SYBR Kit (Nanjing Novozyme Biotechnology Co., Ltd., catalog number Q221-01). The SYBRGreen method was used to detect changes in intracellular gene expression levels. The Ct values ​​of GAPDH and target genes in the experimental and control groups were determined. The double Δ method and GAPDH level normalization were used to calculate the degree of change of the target gene.

[0072] The reaction system is as follows:

[0073] Table 1SYBR Green method system configuration

[0074] Components volume 2X One Step SYBR Green Mix 5μL One Step SYBR Green Enzyme Mix 0.5μL Upstream primer F 0.2μL Downstream primer R 0.2μL <![CDATA[Rnase-free ddH2O]]> 3.1μL RNA 1μL

[0075] The reaction conditions are as follows:

[0076] Table 2SYBR Green method reaction conditions

[0077]

[0078] 3. qPCR detection of viral load in supernatant

[0079] This study used the TIANamp Virus RNA Kit (Cat. No. DP315-R, Nanjing Novozyme Biotechnology Co., Ltd.) to extract viral nucleic acids from the supernatant. The specific steps are as follows:

[0080] ① Add 560 μL (a mixture of lysis buffer RL and carrier RNA solution) and 140 μL of cell supernatant to a clean 1.5 mL centrifuge tube, vortex for 15 seconds to mix, and let stand at room temperature (15-25°C) for 10 minutes.

[0081] ② Briefly centrifuge to collect the liquid attached to the tube wall and tube cap.

[0082] ③ Add 560 μL of anhydrous ethanol, cover the tube and vortex for 15 seconds, and briefly centrifuge to collect all the liquid at the bottom of the tube.

[0083] ④ Carefully transfer 630 μL of liquid in the centrifuge tube to the RNase-Free adsorption column CR2 (the adsorption column is placed in the collection tube), cover the tube, centrifuge at 6000×g for 1 min, discard the waste liquid, put the adsorption column back into the collection tube, and pass the remaining liquid in the tube through the column again.

[0084] ⑤ Carefully open the cover of the adsorption column, add 500 μL of solution GD (please check whether anhydrous ethanol has been added before use), cover the tube, centrifuge at 6000×g for 1 min, discard the waste liquid, and put the adsorption column back into the collection tube.

[0085] ⑥ Carefully open the cover of the adsorption column, add 500 μL of solution RW (please check whether anhydrous ethanol has been added before use), cover the tube, centrifuge at 6000×g for 1 min, discard the waste liquid, and put the adsorption column back into the collection tube.

[0086] ⑦Repeat step ⑥.

[0087] ⑧Put the adsorption column back into the collection tube, centrifuge at 13,400×g for 3 min to completely dry the adsorption membrane, and discard the waste liquid.

[0088] ⑨ Place the adsorption column in an RNase-Free centrifuge tube (1.5 ml), carefully open the cover of the adsorption column, drop 50 μL RNase-Free ddH2O (after equilibration at room temperature before use) into the middle of the adsorption membrane, cover the cover, and leave at room temperature for 5 minutes. Centrifuge at 6000×g for 1 minute.

[0089] The reagent used was HiScript III U+One Step qRT-PCR Probe Kit (Cat. No. Q225-01, Nanjing Novozymes Biotech Co., Ltd.) to detect changes in gene expression levels in the supernatant, determine the Ct values ​​of the target genes in the experimental group and the control group, and quantitatively compare the changes in the target genes.

[0090] The reaction system is as follows:

[0091] Table 3 Probe method system configuration

[0092] Components volume 5×One Step U+Mix 10μL One Step U+Enzyme Mix 1μL Upstream primer F 0.4μL Downstream primer R 0.4μL Probe 0.8μL <![CDATA[Rnase-free ddH2O]]> 5.4μL RNA 2μL

[0093] The reaction conditions are as follows:

[0094] Table 4 Probe method reaction conditions

[0095]

[0096] Primer synthesis service is provided by Sangon Biotech (Shanghai) Co., Ltd. The primer probe sequences are as follows:

[0097] Table 5 SFTSV PCR detection primers and probe sequences

[0098] Primer name Primer sequence (5'-3') HUMAN-GAPDH-F GTCGAAGGTGAAGGTCGGA HUMAN-GAPDH-R GAAGATGGTGATGGGATTTC SF-Qpcr-L-F1 CTCACTCATGCCCTCAACGA SF-Qpcr-L-R1 GATGAACTCACCAGCCCTGC BNY-F1 AGCCTAATTGGATATGTCAAATTGC BNY-R1 CGGGTGAAGTGGCTGAAGG BNY-P FAM-AGCAGCAGCAGCAACCTCAGCAGC-BHQ1

[0099] The results are as follows Figure 1As shown, the results showed that when Huh-7 cells infected with the new Bunyavirus were treated with lipoxygenase, the viral load in the cells and supernatant was significantly reduced in a dose-dependent manner.

[0100] Example 2: Lipoxygenase can destroy the structure of the new Bunyavirus

[0101] 1. Transmission electron microscopy to observe cell morphology

[0102] (1) When the confluence of Vero cells reaches 40-50%, SFTSV infection and virus expansion are performed.

[0103] (2) Take an appropriate amount of SFTSV HBMC strain stored in the laboratory and dilute it with DMEM medium containing 2% FBS and 1% double antibody at a ratio of 1:5000. Discard the medium in T75, wash twice with PBS, then add 2mL of SFTSV HBMC strain dilution, shake slowly until the virus dilution fully infiltrates the cells at the bottom of the bottle, and place it in a 37℃ carbon dioxide incubator for infection for 2h.

[0104] (3) After incubation for 2 h, the volume was replenished to 10 mL using DMEM medium containing 2% FBS and 1% dual antibody, and the cell culture flask was placed in a 37° C. carbon dioxide incubator for further culturing for 96 h.

[0105] (4) Observe the cell status every day. Repeatedly freeze and thaw the cells cultured for 96 h until the cells fall off. Collect the suspension in the bottle and transfer it to a centrifuge tube. Place it in a horizontal centrifuge and centrifuge it at 12,000 × g at 4°C for 5 min. Discard the precipitate and collect the supernatant.

[0106] (5) The supernatant was concentrated by ultrafiltration using a 50 KDa ultrafiltration concentrator, and centrifuged at 12,000 × g for 30 min at 4°C.

[0107] (6) The concentrated virus was incubated with PBS or lipoxygenase (2 mg / mL) at 37°C for 2 h and sent to the electron microscope room for preparation and observation.

[0108] 2. Western blot detection of viral membrane protein

[0109] (1) When the confluence of Vero cells reaches 40-50%, SFTSV infection and virus expansion are performed.

[0110] (2) Take an appropriate amount of SFTSV HBMC strain stored in the laboratory and dilute it with DMEM medium containing 2% FBS and 1% double antibody at a ratio of 1:5000. Discard the medium in T75, wash twice with PBS, then add 2mL of SFTSV HBMC strain dilution, shake slowly until the virus dilution fully infiltrates the cells at the bottom of the bottle, and place it in a 37℃ carbon dioxide incubator for infection for 2h.

[0111] (3) After incubation for 2 h, the volume was replenished to 10 mL using DMEM medium containing 2% FBS and 1% dual antibody, and the cell culture flask was placed in a 37° C. carbon dioxide incubator for further culturing for 96 h.

[0112] (4) After 3-4 days of culture, the cells will develop obvious pathological changes or even fall off. At this time, place the culture bottle in a -80℃ refrigerator and freeze and thaw repeatedly until the cells fall off. Use a pipette to transfer the cell suspension in the bottle to a 50mL centrifuge tube and repeat centrifugation twice at 5000r / min for 20min each time to remove the bottom precipitate in the virus solution to the greatest extent. The precipitate contains dead cells and debris.

[0113] (5) The supernatant was concentrated by ultrafiltration using a 50 KDa ultrafiltration concentrator, and centrifuged at 12,000 × g for 30 min at 4°C. The concentrated virus solution was incubated with different concentrations of lipoxygenase or PBS for 2 h.

[0114] (6) Add 10 μL of Loding Buffer, incubate at 100°C for 10 min to denature the protein, place on an ice plate for 1-2 min, centrifuge and flick to mix, place in a centrifuge, centrifuge at 13,000 × g at 4°C for 3 min, and collect the supernatant.

[0115] (7) Select separation gel (10% / 12 wells) according to the size of the protein, remove the seal at the bottom of the gel plate, put it into the electrophoresis tank, and blow and suck the sample tank before adding the sample. After pouring an appropriate amount of electrophoresis solution into the electrophoresis tank, use a micro-oxygenator to slowly add the sample to the wall. The electrophoresis experiment is 120V electrophoresis for 40 minutes, and the electrophoresis time can be appropriately extended according to the electrophoresis of the bands.

[0116] (8) According to the protein molecular weight, select a 0.45 μm PVDF membrane and activate it by immersion in methanol. Cut the PVDF membrane according to the length of the protein separation gel.

[0117] (9) Preparation of sandwich: Place the sponge, filter paper, gel, nitrocellulose membrane, filter paper, and sponge pre-soaked in transfer buffer in the transfer clip (white side facing down) in order, ensuring that there are no bubbles between each layer. Assembly order: white side of transfer clip - sponge pad - filter paper - gel - membrane - filter paper - sponge pad - red side (positive electrode)

[0118] (10) Transfer: Place the transfer clip into the transfer tank, add -20℃ pre-cooled transfer buffer, connect the gel surface to the negative electrode, connect the nitrocellulose membrane to the positive electrode, and maintain a constant voltage of 100V. The transfer time is adjusted according to the molecular weight of the protein, which is about 1 hour. Add ice packs to the internal transfer buffer and cover the outer layer of the transfer box with ice to prevent overheating during the transfer process and cause the gel to melt.

[0119] (11) Blocking: Use 0.05% TBST (Tween-20) to prepare a blocking solution containing 5% milk, place the PVDF membrane in the blocking solution, and block on a horizontal shaker for 1.5 h. After blocking, wash with TBST three times.

[0120] (12) Incubate with primary antibody: Cut the membrane according to the molecular weight of the marker to obtain the target protein band. Then put each band into 5 mL of diluted antibody and shake at 4°C overnight.

[0121] (13) After the primary antibody incubation is completed, the membrane is removed and equilibrated at room temperature for 30 min. TBST is added and washed three times on a horizontal shaker, each time for 10 min.

[0122] (14) The secondary antibody was prepared with blocking solution at a dilution of 1:10,000 and incubated at room temperature for 1.5 h. After the secondary antibody incubation was completed, TBST was added and washed three times on a horizontal shaker, each time for 10 min (to completely remove nonspecific binding).

[0123] (15) Mix the color developing solution A and solution B in a ratio of 1:1. Take the PVDF membrane out of TBST, place the membrane in a tray, and wet the membrane surface with the color developing solution. Place the PVDF membrane into the instrument and analyze the target band position using a gel imaging system.

[0124] The results are as follows Figure 2 As shown in the figure, the structural morphology of SFTSV was observed by transmission electron microscopy after co-incubation of lipoxygenase and SFTSV. The results showed that the integrity of the virus was destroyed by lipoxygenase incubation, the lipid membrane of the virus was damaged, and the structure of the virus was changed. The GP protein complex on the surface of the virus was detected by Western blotting, and the results showed that lipoxygenase treatment could destroy the viral GP protein complex, but the NP protein was not affected.

[0125] Example 3: Lipoxygenase improves the survival rate of mice infected with a novel bunyavirus

[0126] 1. Construction of a novel Bunyavirus-lethal mouse model

[0127] Six-week-old female C57BL / 6 mice were selected and housed in a specific pathogen-free (SPF) facility with temperature and humidity controlled at 22±2°C and 50±10%. Mice were intraperitoneally injected with 300 μg IFNAR1 antibody (Bio X Cell, Cat. BE0241) one day in advance and 2×10 5 A new Bunyavirus-lethal mouse model was constructed by using PFU units of the new Bunyavirus HBMC16 strain.

[0128] 2. Effect of lipoxygenase on the survival rate of mice infected with novel bunyavirus

[0129] First, 2 mg / mL lipoxygenase or PBS was mixed with 100 μL virus solution (2×10 5 FFU / mL) were incubated at 37°C for 2 h. On day 0, mice were challenged with virus solution by intraperitoneal injection. The status of mice was observed every day after injection. When the weight of mice decreased by 25%, they were judged dead and the survival curve was calculated. Figure 3 As shown, the results showed that after the novel bunyavirus infected mice, the mortality rate of the treatment group was significantly reduced compared with the PBS incubation group (71.4% vs 14.3%), indicating that lipoxygenase can significantly improve the survival rate of mice infected with the novel bunyavirus.

[0130] Example 4: The ability of the virus to infect in vivo is reduced after lipoxygenase quenching

[0131] Take the mouse tissue sample injected with the novel bunyavirus on the fifth day in Example 3, and use RNA Easy Fast Animal Tissue / Cell Total RNA Extraction Kit (Cat. No. DP451, Nanjing Novozyme Biotech Co., Ltd.) to extract RNA. The specific steps are as follows:

[0132] (1) Take 10 mg of liver, lung and spleen specimens after dissection, add 350 μL of lysis buffer RLA, add 3-5 steel beads, and use a grinder to grind the tissue. Then add 10 μL of proteinase K, mix well, and place at room temperature for 5 minutes to fully lyse. Centrifuge at 13,400×g for 5 minutes and take the supernatant.

[0133] (2) Place the obtained supernatant into a DNA removal column, centrifuge at 13,400 × g for 30 seconds, and retain the filtrate.

[0134] (3) Add 350 μL of 70% ethanol to the filtrate, mix well, and transfer the liquid to the RNase-Free adsorption column CR4. Centrifuge at 13,400 × g for 30 seconds, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0135] (4) Add 700 μL of deproteinized solution RW3 to the adsorption column, centrifuge at 13,400 × g for 30 sec, discard the waste liquid, and return the adsorption column to the collection tube.

[0136] (5) Add 500 μL of rinse solution RW to the adsorption column, let it stand at room temperature for 2 min, centrifuge at 13,400 × g for 60 sec, and discard the waste liquid.

[0137] (6) Repeat step (5). Centrifuge at 13,400×g for 2 min and discard the waste liquid. Place the adsorption column at room temperature for 2 min to completely dry the residual rinse liquid in the adsorption material. Transfer to a new RNase-Free centrifuge tube, add 50μL RNase-Free ddH2O in the air, place at room temperature for 2 min, and centrifuge at 12000 rpm for 2 min to obtain RNA solution.

[0138] The viral nucleic acid in serum was extracted using the TIANamp Virus RNA Kit (Product No. DP315-R). The copy number of the novel Bunyavirus was detected by qPCR.

[0139] The results are as follows Figure 4 As shown, the results showed that after the novel Bunyavirus was treated with lipoxygenase (2 mg / mL) and then infected with mice, the viral load of the novel Bunyavirus in the mouse serum, spleen, lungs and liver was significantly downregulated, and lipoxygenase has an inhibitory effect on the virus in vivo.

[0140] Example 5: Lipoxygenase alleviates multiple organ damage in mice infected with a novel bunyavirus

[0141] The lung, liver and spleen tissues of the mice injected with the virus on the fifth day in Example 3 were taken and the tissue lesions and infection conditions were observed using conventional HE and IHC staining.

[0142] The results are as follows Figure 5 As shown, the results showed that compared with the infection group, the ballooning degeneration induced by SFTSV in the hepatocytes of virus-infected mice pre-incubated with lipoxygenase was attenuated. Generally speaking, the infection of mouse lung tissue is mainly manifested as severe pneumonia characterized by inflammatory cell infiltration and edema and thickening of alveolar walls, while cells treated with lipoxygenase alleviated the pathological damage of lung tissue. SFTSV infection induced an increase in the number of megakaryocytes in the splenic red pulp, while no obvious increase was seen in the spleen tissue of mice in the lipoxygenase incubation group. Similar results were observed by immunohistochemical staining to detect the expression of SFTSV antigen in the spleen. Although the expression of viral antigens could still be detected, the number and range of cell foci in SFTSV-infected mice pre-incubated with lipoxygenase were reduced.

[0143] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Use of lipoxygenase or its pharmaceutically acceptable salt in the preparation of drugs against novel bunyaviruses.

2. Use of lipoxygenase or a pharmaceutically acceptable salt thereof in the preparation of a drug for preventing and / or treating diseases caused by novel bunyavirus infection.

3. The use according to claim 2, characterized in that: The disease caused by the novel Bunyavirus infection is novel Bunyavirus disease or fever with thrombocytopenia syndrome.

4. Use of lipoxygenase or its pharmaceutically acceptable salt in the preparation of a drug for inhibiting a novel bunyavirus.

5. Use of lipoxygenase or its pharmaceutically acceptable salt in the preparation of a novel bunyavirus quencher.

6. The use according to any one of claims 1 to 5, characterized in that: In the application, lipoxygenase or a pharmaceutically acceptable salt thereof is used in any one of the following a1)-a5): a1) Inhibit the replication of new Bunyaviruses; a2) destroy the structure of the new bunyavirus; a3) improve the survival rate of subjects infected with the new bunyavirus; a4) Inhibit the ability of the virus to infect subjects and reduce the viral load in subjects infected with the new Bunyavirus; a5) Alleviate tissue and organ damage in subjects infected with the novel Bunyavirus.

7. A drug or a pharmaceutical preparation, wherein the active ingredient of the drug or the pharmaceutical preparation is lipoxygenase or a pharmaceutically acceptable salt thereof.

Images