Application of METTL3 gene or protein as target spot in screening medicines for inhibiting foot-and-mouth disease virus replication

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to application of an METTL3 gene / protein serving as a target spot in screening of drugs for inhibiting foot and mouth disease virus replication. The method specifically comprises the following steps: (1) firstly, constructing an METTL3 knockout cell line by utilizing a CRISPR / Cas9 system, wherein the cell line obviously inhibits the replication of FMDV; secondly, a lentivirus packaging system is utilized to construct an METTL3 stable expression cell line, and the cell line promotes the replication of FMDV. Therefore, the inhibition or silencing of the METTL3 gene / protein can inhibit the replication of the foot-and-mouth disease virus, can be used as a target spot for screening drugs for inhibiting the replication of the foot-and-mouth disease virus, provides some theoretical bases for preventing or inhibiting FMDV infection in the future, and has a wide application prospect.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and specifically relates to an application of a METTL3 gene or protein as a target in screening a drug for inhibiting the replication of foot-and-mouth disease virus. Background Art

[0002] Specific chemical modification of biological molecules is an effective way to regulate molecular functions. Modification of DNA and proteins regulates numerous downstream signal transductions in cells. Many research results have been achieved in terms of both the innovation of research technology and the explanation of the mechanism of action. In addition, it is recognized that RNA not only acts as an intermediate (mRNA) or effector molecule (tRNA and rRNA) for protein synthesis, but can also have a direct impact on gene expression, including through the action of multiple other types of non-coding RNA. RNA modification is gradually developing into a cutting-edge research hotspot in epitranscriptomics. Like histone and DNA modifications, RNA epigenetic marks are also mediated by three different types of proteins: writers, erasers, and readers. Analysis of the cellular epitranscriptome (defined as internal single nucleotide modifications that do not change the mRNA sequence) has identified at least ten different types of modifications, the most common of which is the addition of a methyl group at the N6 position of adenosine, called m6A. Studies have shown that m6A is one of the most abundant types of chemical modifications. This modification was only observed in viral genomes in the early 1970s. However, in recent years, the role of m6A modification has been gradually revealed through the newly developed m6A methylated RNA immunoprecipitation (MeRIP) and MeRIP sequencing (MeRIP-Seq) technologies.

[0003] METTL3 is one of the most important members of the m6A methyltransferase complex and is highly conserved in eukaryotes. It is an S-adenosylmethionine (SAM) binding protein that catalyzes the transfer of methyl groups from SAM to adenine bases in RNA. As a key catalytic member of m6A modification, METTL3 is responsible for coordinating the installation of m6A in target mRNAs. Studies have shown that METTL3 can promote translation independently of its methyltransferase activity. SUMOylation of METTL3 has been shown to inhibit m6A methyltransferase activity, while WTAP and METTL3 phosphorylation moderately increase methyltransferase activity. There are also differences in the effects of METTL3 on viral replication. It has been shown in literature that knocking down METTL3 promotes the replication of BVDV virus and Newcastle disease virus, and has no effect on the replication of SINV, but the function of this protein in FMDV infection remains unknown.

[0004] The CRISPR-Cas system is considered to be a prokaryotic immune system based on the capture and insertion of small DNA fragments produced by viral or plasmid invasion, and it is ubiquitous in nature. The CRISPR-Cas system consists of two genetic elements, the CRISPR array, and a series of Cas genes encoding Cas proteins. The CRISPR / Cas9 system belongs to the Class II CRISPR / Cas system, which is mainly composed of crRNA and Cas9 proteins and only requires a guide RNA (SgRNA) to accurately cut the target gene. After the complementary crRNA recognizes the target DNA region, the nuclease Cas9 induces a nick or double-strand break (DSB) at this site, and then activates the cell genome repair pathway. The insertion or deletion of nucleotides in the genome will cause frameshift mutations in mRNA during translation, resulting in a premature stop codon or a non-functional protein, which ultimately leads to the loss of function of the target protein. Using the CRISPR / Cas9 system to mediate gene knockout to establish a cell line is a relatively efficient gene editing technology for exploring the function and mechanism of cellular genes. More and more researchers are using this system to conduct whole-genome screening and identify host factors that are critical for viral replication to study the interaction between viruses and hosts.

[0005] FMDV is the pathogen that causes foot-and-mouth disease. It is a member of the genus Orthomavirus in the family Picornaviridae and is a single-stranded, positive-sense RNA virus. There are seven known serotypes of FMDV (A, O, Asia1, C, SAT1, SAT2, and SAT3). Currently, there is an epidemic of co-transmission of serotypes A, O, and SAT in Africa, which has a great impact on vaccination. The continued prevalence of foot-and-mouth disease may still bring new challenges in the future. At present, the infection and pathogenic mechanism of FMDV is not fully understood, and the interaction mechanism of the virus with various host restriction factors still needs to be further analyzed. Summary of the invention

[0006] In response to the above technical problems, the present invention firstly uses the CRISPR / Cas9 system to construct a METTL3 knockout cell line, which significantly inhibits the replication of FMDV; secondly, the present invention uses a lentiviral packaging system to construct a METTL3 stable expression cell line, which promotes the replication of FMDV. Therefore, the present invention found that inhibiting or silencing the METTL3 gene / protein can inhibit the replication of foot-and-mouth disease virus, and can be used as a target for screening drugs that inhibit the replication of foot-and-mouth disease virus, providing some theoretical basis for the future prevention or inhibition of FMDV infection, and has broad application prospects. Specifically including the following contents:

[0007] In a first aspect, the present invention provides an application of a METTL3 gene / protein as a target in the preparation or screening of a drug for preventing or treating foot-and-mouth disease virus infection; the drug targets the METTL3 gene / protein and inhibits or silences the expression of the METTL 3 gene / protein.

[0008] In a second aspect, the present invention provides a use of a METTL3 gene / protein expression inhibitor in the preparation of a medicament for preventing or treating foot-and-mouth disease virus infection.

[0009] Preferably, the drug comprises a small interfering RNA designed to target the METTL3 gene / protein; or the METTL3 gene / protein expression inhibitor comprises an sgRNA targeted to knock out the METTL3 gene / protein.

[0010] Preferably, the sgRNA is selected from hamMETTL3-KO-#1, hamMETTL3-KO-#2, hamMETTL3-KO-#3, hamMETTL3-KO-#4, hamMETTL3-KO-#5 or hamMETTL3-KO-#6; the sequence of the sgRNA is as follows:

[0011] hamMETTL3-KO-#1-F CACCGTATCCCAGATCAACATCGG,

[0012] hamMETTL3-KO-#1-RAAACCCGATGTTGATCTGGAGATAC;

[0013] hamMETTL3-KO-#2-F CACCGTCCATGTGAATATCCCAAGG,

[0014] hamMETTL3-KO-#2-R AAACCCTTGGGATATTCACATGGAC;

[0015] hamMETTL3-KO-#3-F CACCGTGGCCCTGCCTGTGACCAG,

[0016] hamMETTL3-KO-#3-R AAACCTGGGTCACAGGCAGGCCAC;

[0017] hamMETTL3-KO-#4-F CACCGAGAGCAGGACTTGACTACAG,

[0018] hamMETTL3-KO-#4-R AAACCTGTAGTCAAGTCCTGCTCTC;

[0019] hamMETTL3-KO-#5-F CACCGACAGGTCACTGGTTAAAACCA,

[0020] hamMETTL3-KO-#5-R AAACTGGTTTAACCAGTGACCTGTC;

[0021] hamMETTL3-KO-#6-F CACCGGGCGGACAAGAAAGGCCATG,

[0022] hamMETTL3-KO-#6-R AAACCATGGCCTTTCTTGTCCCGCCC.

[0023] In a third aspect, the present invention provides the use of a METTL3 gene / protein knockout cell line in breeding for resistance to foot-and-mouth disease virus.

[0024] Preferably, the method for constructing the METTL3 gene / protein knockout cell line comprises the following steps:

[0025] (1) Prepare sgRNA that specifically targets the METTL3 gene / protein;

[0026] (2) inserting the double-stranded fragment of the sgRNA oligonucleotide prepared in step (1) into the multiple cloning site of the lentiviral vector expressing Cas9, and transfecting cells to obtain a recombinant lentivirus that simultaneously expresses the Cas9 protein / gene and the targeting sgRNA sequence;

[0027] (3) Transducing the recombinant lentivirus prepared in step (2) into host cells, picking single cells, inoculating and culturing, and obtaining a METTL3 gene / protein knockout cell line.

[0028] In a fourth aspect, the present invention provides an application of a METTL3 gene / protein as a target in the preparation or screening of a foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production enhancer; the drug targets the METTL3 gene / protein and promotes the expression of the METTL3 gene / protein.

[0029] In a fifth aspect, the present invention provides an application of a METTL3 protein in the preparation of a foot-and-mouth disease virus or a foot-and-mouth disease virus vaccine production enhancer.

[0030] In a sixth aspect, the present invention provides an application of a METTL3 gene / protein overexpressing cell line in the preparation of a foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production cell line.

[0031] Preferably, the method for constructing the METTL3 gene / protein overexpression cell line comprises the following steps:

[0032] (1) Preparing METTL3 overexpression plasmid;

[0033] (2) constructing a recombinant lentivirus containing the METTL3 overexpression plasmid described in step (1);

[0034] (3) Transducing the recombinant lentivirus prepared in step (2) into host cells, picking out single cells, inoculating and culturing, and obtaining a METTL3 overexpressing cell line.

[0035] The beneficial effects of the present invention are as follows: ① The present invention finds that the replication of FMDV can be inhibited by inhibiting or silencing the host METTL3 gene / protein, which can be used as a target for preparing a drug for inhibiting the replication of FMDV; ② The present invention provides an sgRNA targeting the METTL3 gene, which can specifically target the METTL3 gene, and can achieve the knockout of the METTL3 gene in the host cell by combining the CRISPR-Cas9 technology, with accurate targeting and high knockout efficiency; ③ The present invention provides a method for constructing a cell with a loss of METTL3 gene / protein function by transfecting the sgRNA into the host cell through the CRISPR-Cas9 technology The method of cell line is to obtain a cell line with FMDV resistance phenotype by making the METTL3 gene / protein function ineffective, which can significantly inhibit the replication of FMDV, provide research tools and materials for further studying the molecular mechanism of METTL3 gene / protein regulating the replication of pathogenic microorganisms in cells, and can also be used for breeding animals resistant to FMDV, providing some theoretical basis for preventing or inhibiting FMDV infection in the future; ④ The present invention utilizes a lentiviral packaging system to construct a METTL3 stable expression cell line, which promotes the replication of FMDV, and is used as a production cell line for foot-and-mouth disease virus vaccine, and is used for the production of foot-and-mouth disease virus vaccine, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The results of constructing LentiCRISPR sgRNA and plov-METTL3 plasmid; A. LentiCRISPR sgRNA targeting position; B. plov-METTL3 recombinant plasmid pattern; C. Sequencing results of lentiCRISPR sgRNA and plov-METTL3 recombinant plasmid;

[0037] Figure 2 Western blotting was used to detect the protein level of METTL3 in METTL3 knockout cell lines;

[0038] Figure 3 Fluorescence quantitative PCR was used to detect the mRNA level of FMDV in the METTL3 knockout cell line;

[0039] Figure 4Western blotting was used to detect the protein level of FMDV in the METTL3 knockout cell line;

[0040] Figure 5 TCID 50 Detect the viral titer of FMDV in METTL3 knockout cell lines;

[0041] Figure 6 Western blotting was used to detect the protein level of METTL3 in METTL3 overexpressing cell lines;

[0042] Figure 7 Fluorescence quantitative PCR was used to detect the mRNA level of FMDV in METTL3 overexpressing cell lines;

[0043] Figure 8 TCID 50 The viral titer of FMDV was detected in the METTL3 overexpressing cell line. DETAILED DESCRIPTION

[0044] In order to make the purpose, technical scheme and advantages of the present invention clearer, the embodiments of the present invention will be described in detail below in conjunction with the accompanying drawings. However, it will be appreciated by those skilled in the art that in the embodiments of the present invention, many technical details are provided to enable the reader to better understand the present application. However, even without these technical details and various changes and modifications based on the following embodiments, the technical scheme claimed in the present application can be implemented.

[0045] The experimental methods in the following examples are conventional methods unless otherwise specified; the experimental materials used in the following examples are purchased from conventional biochemical reagent companies unless otherwise specified.

[0046] 293T, BHK-21 cells and vectors Plov and LentiCRISPR v2 were provided by our laboratory; FMDV / O / China99 was from the Foot-and-Mouth Disease and Emerging Disease Epidemiology Team of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences;

[0047] Escherichia coli competent DH5α was purchased from Kangti Life Science Company, ChamQ Universal qPCR MasterMix, 5×HiScriptⅡqPT Super MixⅡ, ExnaseⅡ, and 5×CEⅡBuffer were purchased from Novozyme Biotech Co., Ltd. Plasmid miniprep kit was purchased from Tiangen Biochemical Technology Co., Ltd. Gel recovery kit was purchased from Omega Therapeutics, USA. T4 DNA ligase was purchased from New England Biolabs. Protein pre-stained marker, endonuclease BamHI, and endonuclease NheⅠ were purchased from Thermo Fisher Scientific, USA. Trizol reagent and Prime STAR Max high-fidelity PCR enzyme were purchased from Baori Medical Biotechnology Co., Ltd. Puromycin powder was purchased from Beijing Solebao Biological Co., Ltd. DMEM cell culture medium was purchased from Invitrogen. Fetal bovine serum (FBS) was purchased from Biological Industries (BI). PBS (pH 7.4) and β-Actin rabbit polyclonal antibody were purchased from Sewell Biotech. 0.05% EDTA trypsin was purchased from Gibco. METTL3 rabbit antibody and HRP-labeled goat anti-rabbit polyclonal antibody were purchased from Ibotek Co., Ltd. Rabbit anti-O-type FMDV 2C polyclonal antibody was prepared and stored in our laboratory.

[0048] Example

[0049] 1. Primer design

[0050] The sequence of the METTL3 gene of hamster (Mesocricetus auratus) was obtained by querying NCBI (Gene ID: 101835295), and sgRNA was designed in the overlapping region of the first exon segment of different transcripts of the METTL3 gene. CACC was added to the 5' end of the coding strand of the sgRNA sequence, and AAAC was added to the 3' end of the template strand to form a sticky end. In order to promote the transcription of sgRNA, G was added after CACC at the 5' end of the coding strand, and C was added to the 5' end of the template strand. According to this method, 6 25bp sgRNAs were designed and named hamMETTL3-KO#1, hamMETTL3-KO#2, hamMETTL3-KO#3, hamMETTL3-KO#4, hamMETTL3-KO#5, and hamMETTL3-KO#6, and the detailed sequences are shown in Table 1. The primer design for overexpression of METTL3 was named Plov-METTL3, and the detailed sequence is shown in Table 2. All primers used in this experiment were synthesized by Qingke Biotechnology Co., Ltd.

[0051] Table 1 Hamster METTL3 sgRNA sequences

[0052]

[0053]

[0054] Table 2 Primer sequences for overexpression of hamster METTL3

[0055]

[0056] 2. Construction of lentiviral recombinant plasmid lentiCRISPR-METTL3-sgRNA and overexpression plov-METTL3 plasmid

[0057] Construction of lentiCRISPR-METTL3-sgRNA:

[0058] (1) Enzyme digestion of lentiCRISPR vector plasmid: Esp3I endonuclease digests lentiCRISPR V2 plasmid, and a total of 30 μl reaction system is prepared: Esp3I enzyme 1 μl; 10×Fast Buffer 3 μl; lentiCRISPR V2 1.5 μl; ddH2O 24.5 μl. After enzyme digestion at 37℃ for 2h, gel recovery and purification are carried out.

[0059] (2) Obtain the target fragment: Add 10ul ddH2O to the dry powder primer for dilution, and take 1μl of the upstream and downstream primers to 48ul ddH2O to prepare a total of 50μl reaction system. Annealing PCR program: 75℃5min, 65℃5min, 55℃5min, 45℃5min, 35℃5min, 25℃5min, so that the upstream and downstream primers form double strands to obtain the target fragment.

[0060] (3) Construction of lentiCRISPR recombinant plasmid: T4 DNA Ligase 1μl; 10×T4 Ligase Buffer, 1μl; lentiCRISPR v2 vector, 1μl; annealed sgRNA target fragment, 2μl; ddH2O 5μl, a total of 10μl system was prepared, mixed thoroughly and allowed to stand at room temperature for 1h.

[0061] Construction of plov-METTL3 overexpression plasmid:

[0062] (1) Enzyme digestion of plov-stop vector plasmid: The plov-stop vector plasmid was double-digested with nucleases BamHⅠ and NheⅠ. A total of 50 μl reaction system was prepared: BamHⅠ 2 μl; NheⅠ 2 μl; 10×Fast Buffer 5 μl; plov-stop vector 3.3 μl; ddH2O 37.7 μl. After enzyme digestion at 37℃ for 2 h, the gel was recovered and purified.

[0063] (2) Target fragment PCR: Take 2 μl of the diluted upstream and downstream primers from Qingke, 10 μl of template cDNA, 25 μl of 2× PrimeSTAR Max high-fidelity PCR enzyme, and 6 μl of ddH2O to prepare a 50 μl reaction system. PCR amplification program: 95℃5min; 95℃15s, 58℃15s, 72℃3min30s, 30 cycles in total; 72℃5min.

[0064] (3) Construction of plov-METTL3 recombinant plasmid: ExnaseⅡ1μl, 5×CEⅡBuffer 2μl, plov vector 2μl, METTL3 target fragment 2μl, ddH2O 3μl, a total of 10μl reaction system was prepared.

[0065] 3. Lentivirus packaging and infection of cells to be established

[0066] Use DMEM culture medium containing 10% FBS and 1% penicillin-streptomycin double antibody to revive one 293T cell and one BHK-21 cell to be established in a 10 cm large dish.

[0067] (1) 293T plating: When the 293T cells have been passaged 2-3 times and their properties are stable, digest the cells with 0.05% trypsin and plate them in a 6-well plate. When the cell density reaches 70%-80%, transfection begins.

[0068] (2) Lentiviral vector construction: plasmid and PEI (at a ratio of 1 μg: 2 μl) were added to Opti-MEM, mixed thoroughly, and then allowed to stand for 15 min before mixing again. The mixture was then slowly and evenly dripped into the corresponding cell well culture medium. After 12 h, the original culture medium was discarded and replaced with DMEM culture medium containing 10% FBS and without dual antibodies. After 48 h of the culture medium replacement, the cell supernatant was collected.

[0069] (3) Infecting BHK-21 cells to be established with lentivirus: The original BHK-21 cell culture medium was discarded and replaced with the collected cell supernatant. After 48 h, the cells were subjected to three consecutive generations of drug screening using DMEM culture medium containing puromycin (at a ratio of 1:250 to the total culture medium), 10% FBS serum, and 2% penicillin-streptomycin dual antibody.

[0070] 4. Cellular infection

[0071] After three generations of puromycin screening, wild-type and METTL3 knockout BHK-21 cells were digested and subcultured, counted, and plated in 12-well plates for infection (MOI = 1). 50 The transcription level, protein translation level and viral replication of FMDV in wild-type and knockout cells were detected.

[0072] 5. Real-time quantitative PCR (RT-qPCR)

[0073] BHK-21-METTL3-WT and BHK-21-METTL3-KO cells cultured in 12-well plates were cultured and the medium was discarded at 12h and 24h after infection, and total RNA was extracted by Trizol lysis method. After RNA was dissolved in DEPC water, 10μl was taken out, 4μl 5×HiScriptⅡqPT SuperMixⅡ and 6μl ddH2O were added, and a total of 20μl reverse transcription reaction system was prepared. RT-PCR program: 50℃20min, 85℃10s. Then 10μl qPCR reaction system was prepared: 4μl cDNA, 5μl 2×SYBR, 0.5μl of upstream and downstream primers. GAPDH was used as the internal reference gene to perform relative quantification of the mRNA levels of FMDV and METTL3. According to the CFX96TMreal-time system operation procedure, 95℃3min; 95℃3s, 60℃1s, a total of 55 cycles were performed for fluorescence quantitative PCR reaction. The sequences of golden hamster METTL3 qPCR primers are shown in Table 3.

[0074] Table 3 Hamster METTL3 qPCR primer sequences

[0075]

[0076] 6. Western blot detection

[0077] After infection, the supernatant of BHK21-METTL3-WT and BHK21-METTL3-KO cells was discarded and 2×SDS solution (1:100) containing β-mercaptoethanol was added to lyse the cells. The samples were boiled at 100℃ for 15min, and 10μl was loaded for SDS-PAGE gel electrophoresis. Then the protein was transferred to NC membrane and blocked with 5% skim milk powder for 1h. Rabbit anti-METTL3 antibody, rabbit anti-FMDV-2C antibody, and rabbit anti-β-Actin were used as primary antibodies for incubation at room temperature for 1h, and the NC membrane was washed 4 times with 1×TBST. Goat anti-rabbit IgG (IgG-HRP) was used as secondary antibody. After incubation at room temperature for 1h, the NC membrane was washed 4 times with 1×TBST and developed by film.

[0078] 7. TCID 50 Determination of virus titer

[0079] BHK21-METTL3-WT and BHK21-METTL3-KO cells plated in 12-well plates were infected with FMDV, and the viral supernatants were collected 24 h after infection. The collected viral fluids were cultured in DMEM medium for 10 min. -2 Up to 10 -8 First, add 100 μl of BHK-21 cell suspension to a 96-well cell culture plate, then add 100 μl of virus solution of different dilutions, inoculate 8 wells for each dilution, place in a 37°C incubator for 72 hours, and calculate TCID according to the Reed-Muench method. 50 .

[0080] 8. Results

[0081] (1) Construction and identification of sgRNA recombinant expression plasmid

[0082] The construction information and cloning locations of LentiCRISPR-sgRNA-METTL3 and Plov-METTL3 recombinant plasmids are as follows: Figure 1 After the construction is completed, transformation, plating, and single clones are picked, and then sent to Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with BioEdit software, and the results showed that the above recombinant plasmid was successfully constructed. The sequencing results are as follows Figure 1 As shown in C. Then, protein immunoblotting was used to detect the protein expression level of METTL3 in the cell line. The results are shown in Figure 2 As shown, no METTL3 protein expression was detected in the knockout cell line. The above results indicate that the METTL3 gene knockout BHK-21 cell line was successfully constructed.

[0083] (2) Knockout of METTL3 inhibits FMDV replication

[0084] METTL3 knockout and control cells were plated in 12-well plates, inoculated with FMDV (MOI = 1), and uninfected and infected cells were collected. Cell RNA was extracted, and the mRNA level of FMDV in the above two cells was detected by qPCR. The results showed that the mRNA level of FMDV in METTL3 knockout cells was significantly lower than that in control cells ( Figure 3 As shown). FMDV (MOI = 1) infected METTL3 knockout and control cells, respectively, collected cell samples at 0h, 8h, 16h, and 24h, and Western blot was used to detect the expression of FMDV non-structural protein 2C and METTL3 protein. The results showed that as the virus infection time prolonged, METTL3 knockout significantly inhibited the replication of FMDV ( Figure 4). Further, METTL knockout and control cells were plated in 12-well plates and inoculated with FMDV (MOI = 1). Uninfected and infected cells and supernatants were collected. After the samples were repeatedly frozen and thawed three times, TCID 50 The replication level of progeny viruses in the supernatant was measured, and the results showed that the replication level of progeny viruses in the supernatant of METTL3 knockout cells was significantly lower than that in control cells ( Figure 5 shown).

[0085] (3) Overexpression of METTL3 promotes FMDV replication

[0086] The construction strategy of METTL3 overexpression BHK-21 cell line is similar to that of its knockout cell line. Protein immunoblotting was used to detect the protein expression level of METTL3. The results are shown in Figure 6 As shown, the expression of exogenous METTL3 can be detected in the overexpression cell line. The above results show that the METTL3 gene overexpression BHK-21 cell line was successfully constructed. METTL3 overexpression and control cells were plated in 12-well plates and inoculated with FMDV (MOI = 1). Uninfected and infected cells and their supernatants were collected 24 hours after infection. qPCR and TCID 50 The experiment detected the replication level of FMDV in the above two cells. The results showed that overexpression of METTL3 promoted the replication of FMDV ( Figure 7 , as shown in 8).

[0087] The present invention aims to construct a METTL3 gene knockout cell line using CRISPR / Cas9 technology to explore the effect of METTL3 on FMDV replication. At the same time, a METTL3 overexpression cell line was constructed using a lentiviral packaging system to further verify the phenotypic function of the molecule. The results showed that when METTL3 in BHK-21 cells was knocked down, the FMDV virus titer decreased significantly; vice versa. The above data can mutually support that METTL3 has an important regulatory effect on the replication of FMDV, and this gene can be used as an important target for inhibiting FMDV infection of host cells. At the same time, in the process of knocking out and overexpressing cell lines of this gene, we explored the experimental methods and conditions such as the design of Chinese hamster sgRNA, the ratio of puromycin screening of BHK-21 cell lines, and the lentiviral packaging transfection dose, which can provide efficient technical support for the subsequent establishment of cell lines in this laboratory using CRISPR / Cas9 gene editing technology.

Claims

1. Use of METTL3 gene / protein as a target in the preparation or screening of drugs for preventing or treating foot-and-mouth disease virus infection; the drug targets METTL3 gene / protein and inhibits or silences the expression of METTL3 gene / protein.

2. Use of METTL3 gene / protein expression inhibitors in the preparation of drugs for preventing or treating foot-and-mouth disease virus infection.

3. The use according to claim 2, characterized in that The drug includes a small interfering RNA designed with the METTL3 gene / protein as a target; or the METTL3 gene / protein expression inhibitor includes an sgRNA targeted for knocking out the METTL3 gene / protein.

4. The use according to claim 3, characterized in that The sgRNA is selected from hamMETTL3-KO-#1, hamMETTL3-KO-#2, hamMETTL3-KO-#3, hamMETTL3-KO-#4, hamMETTL3-KO-#5 or ham METTL3-KO-#6; the sequence of the sgRNA is as follows: hamMETTL3-KO-#1-F CACCGTATCCCAGATCAACATCGG, hamMETTL3-KO-#1-RAAACCCGATGTTGATCTGGAGATAC; hamMETTL3-KO-#2-F CACCGTCCATGTGAATATCCCAAGG, hamMETTL3-KO-#2-R AAACCCTTGGGATATTCACATGGAC; hamMETTL3-KO-#3-F CACCGTGGCCCTGCCTGTGACCAG, hamMETTL3-KO-#3-R AAACCTGGGTCACAGGCAGGCCAC; hamMETTL3-KO-#4-F CACCGAGAGCAGGACTTGACTACAG, hamMETTL3-KO-#4-R AAACCTGTAGTCAAGTCCTGCTCTC; hamMETTL3-KO-#5-F CACCGACAGGTCACTGGTTAAAACCA, hamMETTL3-KO-#5-R AAACTGGTTTAACCAGTGACCTGTC; hamMETTL3-KO-#6-F CACCGGGCGGACAAGAAAGGCCATG, hamMETTL3-KO-#6-R AAACCATGGCCTTTCTTGTCCCGCCC.

5. Application of METTL3 gene / protein knockout cell line in breeding for resistance to foot-and-mouth disease virus.

6. The use according to claim 5, characterized in that The method for constructing the METTL3 gene / protein knockout cell line comprises the following steps: (1) Prepare sgRNA that specifically targets the METTL3 gene / protein; (2) inserting the double-stranded fragment of the sgRNA oligonucleotide prepared in step (1) into the multiple cloning site of the lentiviral vector expressing Cas9, and transfecting cells to obtain a recombinant lentivirus that simultaneously expresses the Cas9 protein gene and the targeting sgRNA sequence; (3) Transducing the recombinant lentivirus prepared in step (2) into host cells, picking single cells, inoculating and culturing, and obtaining a METTL3 gene / protein knockout cell line.

7. Use of METTL3 gene / protein as a target in the preparation or screening of foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production enhancers; the drug targets METTL3 gene / protein and promotes the expression of METTL3 gene / protein.

8. Application of METTL3 protein in the preparation of foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production enhancer.

9. Application of METTL3 gene / protein overexpressing cell line in the preparation of foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production cell line.

10. The use according to claim 9, characterized in that The method for constructing the METTL3 gene / protein overexpression cell line comprises the following steps: (1) Preparing METTL3 overexpression plasmid; (2) constructing a recombinant lentivirus containing the METTL3 overexpression plasmid described in step (1); (3) Transducing the recombinant lentivirus prepared in step (2) into host cells, picking out single cells, inoculating and culturing, and obtaining a METTL3 overexpressing cell line.

Images