Escherichia coli for producing histidine and construction method and application thereof

Abstract

The invention belongs to the technical field of microbial engineering and genetic engineering, and discloses escherichia coli for producing histidine as well as a construction method and application thereof. The escherichia coli contains a growth dependent promoter PprpB of a methyl isocitrate lyase gene prpB and / or a stable phase dependent promoter PydgI of an ornithine reverse transport protein / lysine permease gene ydgI. Escherichia coli for producing histidine uses growth dependent promoter PprpB of methylisocitrate lyase gene prpB to regulate expression of glutamine phosphoribose pyrophosphate transamidase gene purF and uses ornithine reverse transport protein / lysine permease gene (ydgI) The stable-phase dependent promoter PydgI regulates the expression of the ATP phosphoribosyltransferase gene hisG, so that the energy supply of thalli in early-stage cell growth and the metabolic flux of L-histidine in later-stage thalli production can be realized, and the balanced distribution of the metabolic flux between the cell growth of a microbial cell factory and the production of L-histidine is effectively balanced.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial engineering and genetic engineering, and in particular to an Escherichia coli for producing histidine and a construction method and application thereof. Background Art

[0002] L-histidine is a synthetic precursor of many drugs and can be used to treat ulcers, renal failure, rheumatoid arthritis, Alzheimer's disease and other diseases. It has a wide range of applications in medicine, industry, food, cosmetics, animal husbandry and other fields, and has important economic and social value.

[0003] At present, there are three main methods for producing L-histidine: microbial fermentation, chemical synthesis, and protein hydrolysis. Among them, microbial fermentation has the advantages of a wide range of raw materials, relatively simple production process, relatively small impact on the environment, and high product purity, and has now become the mainstream method for L-histidine production.

[0004] Improving the L-histidine production performance in chassis microorganisms is the continuous goal of rational metabolic engineering breeding. In the process of systematic reconstruction of the chassis microbial metabolic network, the enhancement or weakening of the target gene expression intensity is a common strategy to improve the L-histidine production performance. For example, increasing the expression of key enzymes in the target product synthesis pathway, increasing the expression of target product efflux membrane proteins, and increasing the expression of key enzymes in the target product precursor synthesis pathway have significant beneficial effects on improving the production of L-histidine in chassis microorganisms; in addition, dynamic regulation of key metabolic targets in the L-histidine synthesis pathway can further balance cell growth and L-histidine production, and promote the efficient synthesis of L-histidine in microbial cell factories.

[0005] In order to obtain the optimal synthesis rate of the target product, a large number of trial and error experiments are often required to obtain the appropriate target gene expression dosage. On the basis of controlling the appropriate gene dosage, regulating the expression intensity of the target gene in the genome is an effective strategy to further optimize the metabolic flux intensity of the synthetic pathway. Gene expression regulation is a complex process involving the coordinated cooperation of multiple expression regulatory elements, and promoter engineering can accurately control the transcription of target genes to meet the challenges of coordinated expression regulation of multiple genes in the target product synthesis metabolic network. Therefore, it is promising to use promoter engineering to modify the genes of microorganisms. Summary of the invention

[0006] The purpose of the present invention is to solve the problems in the prior art of obtaining the optimal target product synthesis rate by regulating gene expression, which is complicated, has high trial and error cost, and is difficult to operate, thereby providing an Escherichia coli for producing histidine and a construction method and application thereof. The Escherichia coli for producing histidine uses a growth-dependent promoter P of a methyl isocitrate lyase gene prpB prpBRegulation of the expression of the glutamine phosphoribosylpyrophosphate transamidase gene purF and the stationary phase-dependent promoter P of the ornithine antiporter / lysine permease gene (ydgI) ydgI Regulating the expression of the ATP phosphoribosyltransferase gene hisG can achieve the energy supply for early cell growth and the metabolic flux required for late bacterial production of L-histidine, thereby effectively balancing the metabolic flux distribution between cell growth and L-histidine production in the microbial cell factory.

[0007] In order to achieve the above object, in the first aspect, the present invention provides an Escherichia coli for producing histidine, wherein the growth-dependent promoter P containing the methyl isocitrate lyase gene prpB of the Escherichia coli prpB and / or the stationary phase dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI ;in,

[0008] The growth-dependent promoter P of the methyl isocitrate lyase gene prpB prpB The base sequence is shown in SEQ.ID.NO:1;

[0009] The stationary phase dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI The base sequence is shown in SEQ.ID.NO:2.

[0010] In a second aspect, the present invention provides a use of the Escherichia coli as described in the first aspect in producing histidine.

[0011] In a third aspect, the present invention provides a method for producing histidine, the method comprising: culturing the strain on a slant, culturing the seed, inoculating the strain on a fermentation medium, culturing the strain by shaking, and adding glucose containing betaine after the substrate sugar is exhausted; wherein,

[0012] The bacterial species is the Escherichia coli described in the first aspect.

[0013] In the above technical solution, the inventors found two kinds of dynamic regulation promoters triggered by betaine during the research process: based on the growth-dependent promoter P prpB (Growth phase-dependent promoter, GPP), stable phase-dependent promoter P ydgIThe present invention adopts two regulatory methods to dynamically regulate the promoters of glutamine phosphoribosyl pyrophosphate amidotransferase (encoded by purF gene, NCBI-GeneID: 946794, EC: 2.4.2.14) and ATP phosphoribosyltransferase (encoded by hisG gene, NCBI-GeneID: 946549, EC: 2.4.2.17) at the 5-phosphoribosyl-1-pyrophosphate (PRPP) node in the pentose phosphate pathway (PPP) to refine the redirected carbon flux distribution.

[0014] Specifically, the present invention uses CRISPR / Cas9-mediated gene editing technology to modify the original promoter P of the glutamine phosphoribosyl pyrophosphate transamidase gene purF of the production strain. purF Replaced with the growth-dependent promoter P of the methylisocitrate lyase gene prpB prpB At the same time, the original promoter P hisG Replaced with the stationary phase-dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI , so that in the logarithmic growth phase of the cells, the purF gene is normally transcribed and the hisG gene is lowly transcribed, to ensure sufficient metabolic flux for the synthesis of energy ATP and a variety of primary metabolites and to maintain normal cell growth; when the microbial cells are in the stable growth phase, P ydgI Regulates hisG gene expression to automatically switch to high transcription expression while P prpB The purF gene is automatically regulated to a low expression mode to redirect more metabolic flux to L-histidine synthesis.

[0015] The histidine-producing Escherichia coli provided by the present invention can trigger dynamic regulation by adding betaine, and dynamically regulate the metabolic flux distribution of the PRPP metabolic node according to the requirements of different stages of fermentation, thereby improving the synthesis efficiency of histidine.

[0016] Other features and advantages of the present invention will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the following specific embodiments, they are used to explain the present invention but do not constitute a limitation of the present invention. In the accompanying drawings:

[0018] Figure 1A schematic diagram of the distribution of the metabolic flux of the PRPP node of the dynamically regulated L-histidine production strain of the histidine-producing Escherichia coli of the present invention;

[0019] Figure 2 is the pGRB plasmid map;

[0020] Figure 3 This is the pREDCas9 plasmid map. DETAILED DESCRIPTION

[0021] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0022] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0023] In a first aspect, the present invention provides an Escherichia coli for producing histidine, wherein the Escherichia coli contains a growth-dependent promoter P containing a methyl isocitrate lyase gene prpB. prpB and / or the stationary phase dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI ;in,

[0024] The growth-dependent promoter P of the methyl isocitrate lyase gene prpB prpB The base sequence is shown in SEQ.ID.NO:1;

[0025] The stationary phase dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI The base sequence is shown in SEQ.ID.NO:2.

[0026] SEQ.ID.NO:1

[0027] TGAAATTAAACATTTAATTTTATTAAGGCAATTGTGGCACAACCCCTT GCTTTGTCTTTATCAACGCAAATAACAAGTTGATAGGAAACAGACC

[0028] SEQ.ID.NO:2

[0029] CTCCTATCAGGTTGCGAAACGTGCCGCGAAGAAAGGTGCTAAGTATTACCACATCACCCGCCAGTGGCAGGAACGTGGTAATAACCTGACCGTCAGCGCAGATCTGTATAAATAACTATTCAGTTACTCCTATAAGGCGGCTTGATGCCG CCTTTCGCATTTTTAGTCACAAATTTCCCCGCGACCATTGCATGCAGACACATCTCTTCGTAAAATCCCGCGCTTCAGTGGCAAACTCCATTTTTATGCGTTTTGCCCTAATATTTATTCTTCTTATCACGTTTTAATCACTGGATATCG

[0030] In a preferred embodiment of the present invention, the original promoter P of the glutamine phosphoribosyl pyrophosphate transamidase gene purF of Escherichia coli purF Replaced with the growth-dependent promoter P of the methylisocitrate lyase gene prpB prpB ;in,

[0031] The growth-dependent promoter P of the methyl isocitrate lyase gene prpB prpB The base sequence is shown in SEQ.ID.NO:1;

[0032] In a preferred embodiment of the present invention, the original promoter P of the ATP phosphoribosyltransferase gene hisG is hisG Replaced with the stationary phase-dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI ;in,

[0033] The stationary phase dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI The base sequence is shown in SEQ.ID.NO:2.

[0034] In a preferred embodiment of the present invention, the original promoter P of the glutamine phosphoribosyl pyrophosphate transamidase gene purF of Escherichia coli purF Replaced with the growth-dependent promoter P of the methylisocitrate lyase gene prpB prpB At the same time, the original promoter P of ATP phosphoribosyltransferase gene hisG was hisG Replaced with the stationary phase-dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI ;in,

[0035] The growth-dependent promoter P of the methyl isocitrate lyase gene prpB prpB The base sequence is shown in SEQ.ID.NO:1;

[0036] The stationary phase dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI The base sequence is shown in SEQ.ID.NO:2.

[0037] In a second aspect, the present invention provides a use of the Escherichia coli as described in the first aspect in producing histidine.

[0038] In a third aspect, the present invention provides a method for producing histidine, the method comprising: culturing the strain on a slant, culturing the seed, inoculating the strain on a fermentation medium, culturing the strain by shaking, and adding glucose containing betaine after the substrate sugar is exhausted; wherein,

[0039] The bacterial species is the Escherichia coli described in the first aspect.

[0040] In a preferred embodiment of the present invention, the slant culture step comprises: taking a strain preserved at -80°C, streaking and inoculating it onto an activated slant, culturing it at 37°C for 12 hours, and subculturing it once to obtain slant seeds.

[0041] In a preferred embodiment of the present invention, the seed culture step comprises: scraping a ring of the slant seeds with an inoculating loop and inoculating it into a 500mL conical flask containing 30mL of seed culture medium, sealing it with nine layers of gauze, and culturing it at 37°C and 200rpm for 7-10h to obtain a seed culture solution.

[0042] In a preferred embodiment of the present invention, the shaking culture conditions include: inoculating into a 500mL conical flask containing fermentation medium at an inoculation rate of 10% of the volume of the seed culture solution, sealing with nine layers of gauze, 37°C, 200r / min, pH 7.0-7.2, fermentation cycle of 26-30h, and dissolved oxygen of 30%-40%.

[0043] In a preferred embodiment of the present invention, the final volume of the fermentation medium after inoculation is 30 mL.

[0044] In a preferred embodiment of the present invention, the mass concentration of betaine in the betaine-containing glucose is 1 g / L, and the mass fraction of the glucose is 60%.

[0045] In a preferred embodiment of the present invention, the mass concentration of glucose in the shaking culture is <5 g / L.

[0046] The present invention will be described in detail below through examples.

[0047] (1) Methods and equipment used in the examples

[0048] The experimental methods and equipment described in the following examples are conventional methods and equipment unless otherwise specified.

[0049] (2) Culture medium, bacteria and enzymes used in the examples

[0050] Slant culture medium: glucose 1-5g / L, peptone 5-10g / L, beef extract 5-10g / L, yeast powder 1-5g / L, NaCl 1-2.5g / L, agar 15-20g / L, the rest is water, pH 7.0-7.2.

[0051] Seed culture medium: glucose 20-40g / L, yeast extract 2-5g / L, peptone 2-4g / L, K2HPO4 1-3g / L, MgSO4·7H2O 1-2g / L, FeSO4·7H2O 15-20mg / L, MnSO4·3H2O15-20mg / L, V B1 、V B3 、V B5 、V B12 、V H 1-3 mg / L each, the rest is water, pH 7.0-7.2.

[0052] Fermentation medium: glucose 20-40g / L, yeast extract 1-3g / L, peptone 2-3g / L, K2HPO4 3-6g / L, MgSO4·7H2O 1-2g / L, FeSO4·7H2O 15-20mg / L, MnSO4·3H2O15-20mg / L, V B1 、V B3 、V B5 、V B12 、V H 1-3 mg / L each, the rest is water, pH 7.0-7.2.

[0053] The recombinant enzymes used were IIOne Step Cloning Kit series of enzymes.

[0054] HS enzyme was purchased from PrimeSTAR Biotechnology.

[0055] (3) Sequence

[0056] The primer sequences used are shown in Table 1:

[0057]

[0058]

[0059] (4) Reaction system and reaction conditions

[0060] Annealing system and reaction conditions are shown in Table 2:

[0061] Table 2

[0062]

[0063] The recombinant system and reaction conditions are shown in Table 3:

[0064] Table 3

[0065]

[0066]

[0067] ·The PCR amplification system is shown in Table 4:

[0068] Table 4

[0069] Reaction system Volume (50 μL) DNA template 1μL Upstream primer (10 μmol / L) 2μL Downstream primer (10 μmol / L) 2μL dNTP mixture (10mmol / L) 4μL 5×Buffer 10μL HS enzyme (5U / μL) 0.5μL <![CDATA[ddH2O]]> 30.5μL

[0070] The overlapping PCR amplification system is shown in Table 5:

[0071] Table 5

[0072] Reaction system Volume (50 μL) template 1μL Upstream primer of upstream homology arm (10 μmol / L) 2μL Downstream homology arm downstream primer (10μmol / L) 2μL dNTP mixture (10mmol / L) 4μL 5×Buffer 10μL HS enzyme (5U / μL) 0.5μL <![CDATA[ddH2O]]> 30.5μL

[0073] Note: The template consists of equimolar amounts of the amplified fragments of the upstream and downstream homology arms and the target gene, and the total amount does not exceed 10 ng.

[0074] The reaction conditions of the PCR amplification system and the overlapping PCR amplification system are shown in Table 6:

[0075] Table 6

[0076]

[0077] Note: Tm value is the melting temperature of DNA, and in the present invention, it refers to the melting temperature value of the primer and product.

[0078] (5) Methods of gene editing

[0079] The gene editing method used in the present invention is carried out with reference to the literature (Li Y, Lin Z, Huang C, et al. Metabolic engineering of Escherichia coli using CRISPR-Cas9 meditated genome editing. Metabolic engineering, 2015, 31: 13-21.), and the two plasmid maps used in this method are shown in Figure 2-3Among them, pREDCas9 carries the elimination system of the gRNA expression plasmid pGRB, the Red recombination system of λ phage and the Cas9 protein expression system, spectinomycin resistance (working concentration: 100 mg / L), and is cultured at 32°C; pGRB uses pUC18 as the backbone, including the promoter J23100, the gRNA-Cas9 binding region sequence and the terminator sequence, ampicillin resistance (working concentration: 100 mg / L), and is cultured at 37°C.

[0080] Example 1

[0081] This example is used to illustrate the construction of the histidine-producing Escherichia coli of the present invention, specifically the construction of the genetically engineered bacterium HCBHIS8:

[0082] Using the Escherichia coli genome as a template, upstream homology arm primers (purF-UP-S, prpB-purF-DN-S) and downstream homology arm primers (prpB-purF-DN-S, DN-purF-A) were designed according to the upstream and downstream sequences of its purF gene (NCBI GeneID: 945303), wherein the prpB promoter sequence was contained between the upstream and downstream homology arms, and the upstream and downstream homology arm fragments were PCR amplified. The above fragments were fused by overlapping PCR to obtain P purF ::P prpB Promoter replacement fragment (upstream homology arm-downstream homology arm). Construction of pGRB-purF: The DNA fragment containing the target sequence was prepared by annealing primers gRNA-purF-S and gRNA-purF-A. Upstream homology arm primers (hisG-UP-S, ydgI-hisG-DN-S) and downstream homology arm primers (ydgI-hisG-DN-S, DN-hisG-A) were designed according to the upstream and downstream sequences of hisG gene (NCBI GeneID: 946802), wherein the ydgI promoter sequence was contained between the upstream and downstream homology arms, and the upstream and downstream homology arm fragments were PCR amplified. The above fragments were fused by overlapping PCR to obtain P hisG ::P ydgI Promoter replacement fragment (upstream homology arm-downstream homology arm). Construction of pGRB-hisG: The DNA fragment containing the target sequence was prepared by annealing primers gRNA-hisG-S and gRNA-hisG-A.

[0083] Prepare competent cells of the engineered strain HCBHIS7, and operate according to the methods shown in steps (3) and (4) below to iteratively construct P purF ::P prpB and P hisG ::P ydgI The engineered strain HCBHIS8 with regulated gene expression.

[0084] (1) Construction of pGRB plasmid: The purpose of constructing the plasmid pGRB is to transcribe the corresponding gRNA, thereby forming a complex with the Cas9 protein, and recognize the target gene target site through base pairing and PAM to achieve the target DNA double-strand break. The pGRB plasmid is constructed by recombination of a DNA fragment containing the target sequence with a linearized vector fragment. The specific steps are described in steps a to f below.

[0085] a. Target sequence design: Use CRISPR RGEN Tools to design the target sequence (PAM: 5'-NGG-3');

[0086] b. Preparation of DNA fragments containing target sequences: Design primers: 5'-linearized vector terminal sequence (15 bp)-restriction site-target sequence (excluding PAM sequence)-linearized vector terminal sequence (15 bp)-3' and its reverse complementary primer, and prepare DNA fragments containing target sequences by annealing single-stranded DNA;

[0087] c. Preparation of linear vector: The linearization of the vector is carried out by inverse PCR amplification;

[0088] d. Recombination reaction;

[0089] e. Transformation of plasmid: Take 10μL of reaction solution, add it to 100mL DH5α competent cells, mix gently, place on ice for 20min, heat shock at 42℃ for 45-90s, place on ice for 2-3min, add 900μL SOC, and resuscitate at 37℃ for 1h. Centrifuge at 8000rpm for 2min, discard part of the supernatant, keep about 200μL to resuspend the bacteria, and then spread it on a plate containing 100mg / L ampicillin, turn the plate upside down, and culture at 37℃ overnight. After a single colony grows on the plate, identify it through colony PCR and select positive recombinants;

[0090] f. Clone identification: Inoculate PCR-positive colonies into LB medium containing 100 mg / L ampicillin and culture overnight to incubate the bacteria. Extract the plasmid and identify it by enzyme digestion.

[0091] (2) Preparation of recombinant DNA fragments: The recombinant fragments used for promoter replacement consist of the upstream and downstream homology arms of the sucA and gdhA genes (upstream homology arm-downstream homology arm). Using the primer design software primer5, the upstream and downstream sequences of the sucA and gdhA genes were used as templates to design upstream and downstream homology arm primers (amplification length of about 400-500 bp). The upstream and downstream homology arms and the target gene fragments were amplified by PCR, and then the recombinant fragments were prepared by overlapping PCR.

[0092] (3) Transformation of plasmids and recombinant DNA fragments

[0093] a. Transformation of pREDCas9: Use electroporation to electroporate the pREDCas9 plasmid into the electroporation competent state of the starting strain, and then spread the cells on LB plates containing spectinomycin after resuscitation and culture, and culture at 32°C overnight. Single colonies growing on the resistant plates are subjected to colony PCR using identification primers to screen for positive recombinants;

[0094] b. Preparation of electroporation competent cells of target strain containing pREDCas9: Culture at 32°C until OD 600 =0.1-0.2, add 0.1M IPTG (to make the final concentration 0.1mM), and continue to culture until OD 600 =0.6-0.7 for competent cell preparation. The purpose of adding IPTG is to induce the expression of the recombinase on the pREDCas9 plasmid. The culture medium and preparation process required for competent cell preparation refer to conventional standard operations;

[0095] c. Transformation of pGRB and recombinant DNA fragments: pGRB and donor DNA fragments were electroporated into electroporation competent cells containing pREDCas9 at the same time. The revived bacteria after electroporation were spread on LB plates containing ampicillin and spectinomycin and cultured at 32°C overnight. Colony PCR verification was performed using specially designed identification primers to screen positive recombinants and preserve the bacteria;

[0096] (4) Elimination of plasmids

[0097] a. Elimination of pGRB: Place the positive recombinant in LB medium containing 0.2% arabinose and culture overnight, dilute appropriately and spread on LB plates containing spectinomycin resistance, and culture overnight at 32°C. Spot LB plates containing ampicillin and spectinomycin resistance, and select single colonies that do not grow on ampicillin plates but grow on spectinomycin resistance plates.

[0098] b. Elimination of pREDCas9 plasmid: transfer the positive recombinant to LB liquid medium without resistance, culture at 42℃ overnight, dilute appropriately and spread on LB plate without resistance, culture at 37℃ overnight. Spot LB plates containing spectinomycin resistance and LB plates without resistance, select single colonies that do not grow on spectinomycin resistance plates and grow on plates without resistance.

[0099] Example 2

[0100] This example is used to illustrate the method of fermenting and producing L-histidine using an engineered strain with regulated expression of PpurF::PprpB and PhisG::PydgI genes.

[0101] (1) Slant culture: Take the -80°C stored strain and inoculate it on the activated slant, culture it at 37°C for 12 h, and subculture it once;

[0102] (2) Shake flask seed culture: Use an inoculation loop to scrape a ring of slant seeds and inoculate it into a 500 mL Erlenmeyer flask containing 30 mL of seed culture medium, seal it with nine layers of gauze, and culture it at 37°C and 200 rpm for 7-10 h.

[0103] (3) Shake flask fermentation: inoculate 10% of the volume of the seed culture solution into a 500 mL Erlenmeyer flask (final volume 30 mL) filled with fermentation medium, seal with nine layers of gauze, and culture at 37°C, 200 r / min with shaking. During the fermentation process, the pH is maintained at 7.0-7.2 by adding ammonia water; 60% (m / v) glucose solution is added to maintain the fermentation process; the fermentation cycle is 26-30 h; during the fermentation process, the pH is adjusted to 6.8-7.2 with ammonia water, and the DO is controlled at 30%-40%. When the bottom sugar is exhausted, 60% glucose containing 1 g / L of betaine is added, and the glucose concentration is controlled below 5 g / L during the entire fermentation process.

[0104] Example 3

[0105] Promoter modification purF ::P prpB and P hisG ::P ydgI The performance difference of the engineered strain HCBHIS8 and the starting strain HCBHIS7 in producing L-histidine.

[0106] HCBHIS8 and the starting strain HCBHIS7 were cultured in shake flasks using the culture method in Example 2. The concentration of L-histidine in the fermentation supernatant was measured, and the results are shown in Table 7.

[0107] Table 7

[0108] strain <![CDATA[OD 600 ]]> L-Histidine(g / L) HCBHIS7 32.60±1.38 1.26±0.22 HCBHIS8 30.03±1.09 1.52±0.31

[0109] From the data in Table 7, we can see that the promoter modification P purF ::P prpB and P hisG ::P ydgI The growth of the engineered strain was not significantly affected; at the same time, the L-histidine concentration in HCBHIS8 increased from 1.26 g / L to 1.52 g / L, and the L-histidine yield increased by 20.3%. The results show that the histidine-producing Escherichia coli provided by the present invention utilizes P prpB Regulation of purF gene expression and P ydgI By regulating the expression of hisG gene and adding betaine to trigger dynamic regulation of fermentation production of L-histidine, the L-histidine production performance of the engineered strain was significantly improved.

[0110] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0111] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0112] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. An Escherichia coli for producing histidine, characterized in that The growth-dependent promoter P containing the methyl isocitrate lyase gene prpB of Escherichia coli prpB and / or the stationary phase dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI ;in, The growth-dependent promoter P of the methyl isocitrate lyase gene prpB prpB The base sequence is shown in SEQ.ID.NO:1; The stationary phase dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI The base sequence is shown in SEQ.ID.NO:

2.

2. The Escherichia coli according to claim 1, characterized in that The original promoter P of the glutamine phosphoribosyl pyrophosphate transamidase gene purF of Escherichia coli purF Replaced with the growth-dependent promoter P of the methylisocitrate lyase gene prpB prpB and / or, The original promoter of ATP phosphoribosyltransferase gene hisG was hisG Replaced with the stationary phase-dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI ;in, The growth-dependent promoter P of the methyl isocitrate lyase gene prpB prpB The base sequence is shown in SEQ.ID.NO:1; The stationary phase dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI The base sequence is shown in SEQ.ID.NO:

2.

3. Use of the Escherichia coli as claimed in claim 1 or 2 in producing histidine.

4. A method for producing histidine, characterized in that The method comprises: culturing the strain on a slant, culturing the seed, inoculating the strain on a fermentation medium, culturing the strain by shaking, and adding glucose containing betaine after the base sugar is exhausted; wherein, The bacterial species is the Escherichia coli according to claim 1 or 2.

5. The method according to claim 4, characterized in that The slant culture step comprises: taking a strain preserved at -80°C and inoculating it on an activated slant, culturing it at 37°C for 12 hours, and subculturing it once to obtain slant seeds.

6. The method according to claim 5, characterized in that The seed culture step comprises: scraping a ring of the slant seeds with an inoculation loop and inoculating it into a 500mL conical flask filled with 30mL of seed culture medium, sealing it with nine layers of gauze, and culturing it at 37°C and 200rpm for 7-10h to obtain a seed culture solution.

7. The method according to claim 6, characterized in that The shaking culture conditions include: inoculating 10% of the volume of the seed culture solution into a 500mL triangular flask filled with fermentation medium, sealing with nine layers of gauze, 37°C, 200r / min, pH 7.0-7.2, fermentation cycle 26-30h, dissolved oxygen 30%-40%.

8. The method according to claim 7, characterized in that The final volume of the fermentation medium after inoculation was 30 mL.

9. The method according to any one of claims 4 to 8, characterized in that: The mass concentration of betaine in the betaine-containing glucose is 1 g / L, and the mass fraction of the glucose is 60%.

10. The method according to any one of claims 4 to 9, characterized in that: The mass concentration of glucose in the shaking culture is less than 5 g / L.

Images