Neutrophilic and thermostable alpha-galactosidase mutant as well as preparation method and application thereof

Abstract

The invention provides a neutrophilic and thermostable alpha-galactosidase mutant as well as a preparation method and application thereof. The amino acid sequence of the alpha-galactosidase mutant SLHY is shown as SEQ ID NO.2. Compared with parent type alpha-galactosidase, the neutrophile and thermal stability of the alpha-galactosidase mutant SLHY are remarkably improved, and the half-life period of the alpha-galactosidase mutant SLHY with the pH value of 7.0 is prolonged by 9.5 times; the half-life period at 60 DEG C is improved by 16.8 times. The alpha-galactosidase mutant provided by the invention is remarkably enhanced in neutrophilicity and thermal stability, can be effectively matched with a commercial enzyme preparation for use, degrades anti-nutritional factors of laver, improves the trophism and utilization rate of laver extract, and greatly improves the industrial application prospect of alpha-galactosidase.

Description

Technical Field

[0001] The invention belongs to the field of gene engineering technology and enzyme engineering, and specifically relates to a neutrophilic and thermostable alpha-galactosidase mutant and a preparation method and application thereof. Background Art

[0002] α-galactosidase catalyzes the hydrolysis of α-galactosidic bonds, which can destroy the cell wall structure, promote the release of intracellular nutrients, and improve utilization efficiency; it also transforms and decomposes anti-nutritional factors such as α-galactosidase, raffinose, and stachyose in food, reduces the viscosity of chyme, improves its nutritional content, reduces the incidence of diarrhea, and alleviates or avoids compensatory hyperplasia and hypertrophy of digestive organs. In addition, the enzyme is also used in pharmaceuticals, thickener processing, and papermaking industries.

[0003] α-galactosidase exists in plants, bacteria, fungi and other organisms. However, in commonly used food-safe microorganisms such as Saccharomyces cerevisiae and lactic acid bacteria, the enzyme expression level or enzyme activity is very low. In addition, the optimum pH of common α-galactosidase is acidic or alkaline, and the thermal stability is poor, which is not convenient for food processing. Therefore, the development of neutrophilic or pH-stable α-galactosidase and the search for microorganisms or plants with high enzyme production have become research hotspots in recent years. The construction of genetically engineered bacteria to solve the above problems has aroused widespread interest among scientists, who expect to change its process applicability to play a greater role in industry and show broader application prospects in the fields of science and technology and medicine.

[0004] Currently, the engineering modification of α-galactosidase mainly focuses on the construction of genetically engineered bacteria and fermentation process research. For example, "An α-galactosidase and its preparation method and application" (CN 112048495 A) discloses an α-galactosidase polypeptide (Galase) obtained from Elizabethkingia eningoseptica (FMS-007), a polynucleotide encoding the α-galactosidase polypeptide, and its preparation method and application; "A preparation method of a strain of Trichoderma reesei with high yield of Penicillium yanciense α-galactosidase and its application" (CN 105176849 B) discloses a preparation method of a strain of Trichoderma reesei with high yield of Penicillium yanciense α-galactosidase and its application, a strain obtained by introducing the coding gene and selection marker gene of Penicillium yanciense α-galactosidase into the host Trichoderma reesei; "A recombinant α-galactosidase gene, vector, engineered bacteria and its application" (CN 107164398 B) The present invention discloses a recombinant α-galactosidase gene, a vector, an engineered bacterium and its application. The recombinant α-galactosidase gene Saccharomyces cerevisiae engineered bacterium can produce α-galactosidase, which can be used for fermentation of beans and molasses, remove anti-nutritional factors and undesirable oligosaccharides in fermentation raw materials, improve the nutritional value and digestibility of food and feed, and improve resource utilization. However, there are few studies and reports on improving the neutrophilic and thermal stability of α-galactosidase by mutation. Summary of the invention

[0005] In response to the actual industrial production needs, the present invention provides an α-galactosidase mutant with improved neutrophilic and thermal stability, and a preparation method and application thereof. The present invention performs multi-point mutations on the parent α-galactosidase AHA to obtain an α-galactosidase mutant with significantly enhanced neutrophilic and thermal stability, which meets the needs of industrial production; and is applied to the degradation of laver anti-nutritional factors to improve the nutritional value of laver extracts. It is helpful to promote the commercialization of α-galactosidase.

[0006] In order to achieve the above-mentioned invention object, the present invention adopts the following technical solutions: The present invention provides an α-galactosidase mutant SLHY, the amino acid sequence of the mutant SLHY is shown in SEQ ID NO.2; the mutant SLHY is obtained by mutating Ser at position 98 to Leu and His at position 316 to Tyr in the α-galactosidase shown in the amino acid sequence of SEQ ID NO.1.

[0007] In one embodiment of the present invention, the nucleotide sequence of the parent α-galactosidase is shown as SEQ ID NO.5.

[0008] The invention also provides a gene encoding an α-galactosidase mutant.

[0009] In one embodiment of the present invention, the nucleotide sequence of the gene encoding the α-galactosidase mutant AHA-SLHY is shown in SEQ ID NO.6.

[0010] The invention also provides a recombinant vector carrying the gene.

[0011] In one embodiment of the present invention, the recombinant vector uses pHT01 as an expression vector.

[0012] The present invention also provides the mutant, or a recombinant cell containing the gene, or containing the recombinant vector.

[0013] In one embodiment of the present invention, the recombinant cell uses a prokaryotic cell or a eukaryotic cell as an expression host.

[0014] In one embodiment of the present invention, the expression host is Bacillus subtilis.

[0015] The present invention also provides a recombinant Bacillus subtilis, characterized in that the Bacillus subtilis expresses the above-mentioned α-galactosidase mutant.

[0016] The present invention also provides a method for preparing an α-galactosidase mutant, comprising the following steps: (1) Construction of α-galactosidase mutant recombinant cells: Transforming a recombinant vector containing the α-galactosidase mutant SLHY into Bacillus subtilis to obtain α-galactosidase mutant recombinant cells; (2) Expression and purification of α-galactosidase mutants: The α-galactosidase mutant recombinant cells are cultured, the recombinant protein is induced to express, and the α-galactosidase mutant is isolated and purified.

[0017] The present invention also provides the use of α-galactosidase mutants, α-galactosidase mutant encoding genes, recombinant vectors, recombinant cells or α-galactosidase mutants prepared by the above preparation methods in degrading anti-nutritional factors of laver.

[0018] Compared with the prior art, the advantages and beneficial effects of the present invention are as follows: (1) After performing multiple mutations on the parent α-galactosidase AHA (whose amino acid sequence is shown in SEQ ID NO.1) and characterizing the α-galactosidase mutants, it is proved that the α-galactosidase mutants with significantly enhanced neutrophilic and thermal stability are obtained, which can be effectively used in combination with commercial enzyme preparations, greatly improving the application prospects of α-galactosidase in industry.

[0019] (2) The effective pH range of the α-galactosidase mutant SLHY provided by the present invention is reduced from 8.0 to 9.0 of the parent to 6.0 to 7.5; the optimum pH is reduced from 8.5 of the parent to 6.8; and the half-life is increased by 3 times at pH 6.0. It can be seen that the neutrophilic activity of the α-galactosidase mutant of the present invention is significantly improved.

[0020] (3) The thermal stability of the α-galactosidase mutant SLHY provided by the present invention is significantly improved; the effective action temperature is increased from 30-40°C to 30-60°C; the half-life at 60°C is increased by 5 times; it can be seen that the thermal stability of the α-galactosidase mutant of the present invention is significantly improved.

[0021] (4) The present invention uses a combination of an α-galactosidase mutant and a commercial enzyme preparation to degrade laver and laver anti-nutritional factors, thereby improving the nutritional value and utilization rate of the laver extract.

[0022] (5) The α-galactosidase mutant provided by the present invention has significantly improved neutropenia and thermal stability, and can catalyze the degradation of laver at a relatively high temperature. High temperature is conducive to the dissolution of polysaccharides in laver to maintain a sol state, avoid coagulation, and improve the laver degradation rate; the neutropenia allows it to react at the natural pH of the reaction system without the need for acid-base adjustment, which is conducive to the development and utilization of subsequent products, reduces production costs, and meets the needs of industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Comparison of activity changes of α-galactosidase parent and mutant at different pH. DETAILED DESCRIPTION

[0024] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto.

[0025] Definitions of terms used in this invention Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0026] The amino acids in the various amino acid sequences appearing herein are represented by their well-known three-letter or single-letter abbreviations, such as the three-letter abbreviation Ser for serine and the single-letter abbreviation S. The nucleotides appearing in the various DNA fragments are represented by the standard single-letter identifiers routinely used in the art.

[0027] The term "nucleotide" means deoxyribonucleosides, ribonucleosides or ribonucleotides and polymers thereof. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides.

[0028] The terms "mutation" and "mutant" refer to genetic, naturally occurring or introduced changes in nucleic acid or polypeptide sequences, and their meanings are the same as those generally known in the art.

[0029] The term "host cell" or "recombinant host cell" refers to a cell comprising a nucleotide or polypeptide or protein of the present invention. Exogenous nucleotides may be maintained as non-integrated vectors or may be integrated into the host genome.

[0030] The term "transformation" refers to the process by which a eukaryotic cell acquires new genetic markers as a result of the incorporation of foreign DNA.

[0031] The culture medium involved in the following examples is as follows: LB liquid medium: weigh 1g peptone, 0.5g yeast extract, and 1g NaCl. Dissolve with deionized water and make up to 100mL. Autoclave at 121℃ for 20min.

[0032] LB solid medium: Add 1.5% agar powder to LB liquid medium.

[0033] Example 1: Construction of parent α-galactosidase recombinant vector Construction of parental α-galactosidase recombinant vector: design primers to amplify the parental α-galactosidase gene, the amino acid sequence of α-galactosidase is shown in SEQ ID NO.1, and the nucleotide sequence of α-galactosidase gene is shown in the sequence table SEQ.ID.NO.5; connect with the plasmid to construct the recombinant vector pHT01-AHA.

[0034] AHA-F:CAATTAAAGGAGGAAGGATCCATGGTGGAATTAGCAGATAACGAA (SEQ.ID.NO.7) AHA-R: CATTAGGCGGGCTGCCCCGGGTTAAGCTGTTTTAGCCGCTTGG (SEQ. ID. NO. 8).

[0035] Example 2: Construction of α-galactosidase mutant recombinant vector With the help of the design software Alphafold2, the three-dimensional structure of α-galactosidase was predicted, and the mutation points that affect the neutrophilic and thermal stability of the parent α-galactosidase were screened; through Gibbs free energy calculation, the mutants with ΔΔG < 2.7 k J / mol were selected, and Ser 98 and His 316 Combination mutation to Leu 98 and Tyr 316 (SLHY); Ser 98 Mutation to Leu 98 (S98L); His 316 Combination mutation to Tyr 316 (H316Y). Based on the strain codon preference, the mutation primers were designed as follows: S98L -F: GCATCAACTGCACCTACGCCCAGCATGGATGA (SEQ ID NO.9) S98L -R: GTAGGTGCAGTTGATGCGGTAGCCTAAAGGTG (SEQ ID NO.10) H316Y -F:GTATATACCTTTTCAGGTGTGCGCCCACTGCT (SEQ ID NO.11) H316Y -R: CCTGAAAAGGTATATACTATGTCTTCGCGTTTAATGTGG (SEQ ID NO.12) Using the parent α-galactosidase recombinant vector in step (1) as a template, the above primers are used to construct single point mutants S98L (nucleotide sequence as shown in SEQ ID NO.13) and H316Y (nucleotide sequence as shown in SEQ ID NO.14), and then using the S98L mutant recombinant plasmid as a template, a combined mutant SLHY is constructed.

[0036] The PCR reaction system is shown in Table 1: Table 1 Mutation PCR reaction system

[0037] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 10 min, for a total of 30 cycles, and final extension at 72°C for 5 min.

[0038] Example 3 Construction of α-galactosidase parent and mutant recombinant cells The α-galactosidase mutant recombinant plasmids in Example 2 were recovered and purified, and then transformed into Bacillus subtilis ( Bacillus subtilis), spread the transformants on chloramphenicol (50 μg / mL) LB plates, culture at 37°C overnight, and after colonies grew, pick a single colony and transfer it to liquid LB medium containing chloramphenicol (50 μg / mL) and culture at 37°C, 160 rpm overnight.

[0039] Mutant engineered bacteria containing correct mutants were obtained respectively: B. subtilis pHT01-s98l, B. subtilis pHT01- h316y, and B. subtilis pHT01- slhy.

[0040] As a control: pHT01-AHA was transformed into B. subtilis, and according to the above method, an engineered bacterium containing the parent type α-galactosidase was prepared: B. subtilis pHT01-AHA.

[0041] Example 4 Expression and purification of α-galactosidase parent and its mutants The genetically engineered bacteria obtained in Example 3 were streaked on LB plates containing chloramphenicol (50 μg / mL) and cultured at 37°C for 12 h. Single colonies were picked and inoculated into LB liquid culture medium containing chloramphenicol (50 μg / mL) for shake flask fermentation. The culture was carried out at 37°C and 200 rpm for 12 h to obtain seed solution.

[0042] 1 mL of seed solution was transferred to 100 mL of chloramphenicol (50 μg / mL) LB liquid medium for shake flask fermentation. Culture at 37°C until OD600 reached 0.6-0.8, then add IPTG at a final concentration of 0.5 mM, lower the temperature to 28°C, induce enzyme production, and collect the bacteria by centrifugation after 24 h of culture.

[0043] Add an appropriate amount (2-3 times the volume) of lysis buffer (50 mM Tris-HCl, 100 mM NaCl, pH 7.5) to the collected cells, and then ultrasonically disrupt them on ice. Centrifuge at 4°C, 8000 rpm for 10 min to collect the supernatant, and filter it with a 0.22 μm filter membrane. 2+ The mutant enzyme was purified by column affinity chromatography.

[0044] Pure enzyme solutions containing the parent α-galactosidase and mutants AHA, S98L (amino acid sequence as shown in SEQ ID NO.3), H316Y (amino acid sequence as shown in SEQ ID NO.4), and SLHY were prepared respectively.

[0045] Example 5 Determination of Neutrophilic and Thermostability of α-Galactosidase (1) α-galactosidase activity assay ① Substrate preparation: prepare PBS buffer at pH 6.8 and 10 mM pNP-α-D-Gal aqueous solution; ② Preheating: Take 0.5mL of reaction substrate into a colorimetric tube and keep it warm in a 35℃ water bath; ③ Reaction: Add 0.01 mL of enzyme solution, shake and mix, react for 30 min, immediately add 0.75 mL of 1 M Na2CO3 to terminate the reaction, and measure the absorbance at 405 nm and calculate the enzyme activity.

[0046] Definition of enzyme activity unit: Under the conditions of 35°C and pH 6.8, the amount of enzyme required to catalyze the substrate to produce 1 μg of pNP-α-D-Gal per minute is defined as one activity unit.

[0047] (2) Steps for determining the optimal pH of the enzyme: ① Reaction substrate preparation: prepare PBS buffer at pH 6.8 and 10 mM pNP-α-D-Gal aqueous solution; ② Determine enzyme activity.

[0048] (3) Enzyme neutrophil assay steps: ① Buffer preparation: prepare PBS buffer at pH 6.0 and pH 7.0; ② Enzyme treatment: dilute the enzyme solution with the above buffer to the same enzyme activity concentration, store it at room temperature, and take samples at regular intervals to measure the enzyme activity; ③ Calculation of half-life: record the enzyme activity at different treatment times, and calculate the treatment time at which the remaining enzyme activity is half of the initial enzyme activity as its half-life.

[0049] (4) Steps for determining the thermal stability of enzymes: ① Enzyme treatment: Take equal amounts of enzyme solution and place them in a water bath at 45, 50, 55, or 60°C for insulation, and take samples at regular intervals to measure enzyme activity; ② Calculation of half-life: record the enzyme activity at different treatment times, and calculate the treatment time at which the remaining enzyme activity is half of the initial enzyme activity as its half-life.

[0050] Experimental results: The results are as follows Figure 1As shown in Table 2: The neutrophilicity of the α-galactosidase mutants was significantly increased. After combined mutation, the effect of α-galactosidase SLHY in a neutral environment was significantly improved, and the effect was better than that of single-point mutants S98L and H316Y. The effective pH range of the mutant SLHY was reduced from 8.0 to 9.0 of the parent AHA to 6.0-7.4, and the optimal pH was reduced from 8.5 of the parent AHA to 6.8. The effective pH range of the single mutants S98L and H316Y was 6.0-8.5, and the optimal pH was reduced from 8.5 of the parent AHA to 7.4 and 8.0. The stability of the mutants in pH6.0 and pH7.0 environments was significantly improved relative to the parent type. Among them, the half-life of the combined mutant SLHY was increased by 23.2 times and 9.5 times relative to the parent AHA. The half-life of single point mutants S98L and H316Y was increased by 5.6-7.2 times and 2.3-3.1 times relative to the parental AHA. It can be seen that the effective pH range, optimal pH and neutrophilicity of the mutant SLHY combined with α-galactosidase were significantly improved relative to the parental type and point mutants, and its performance in a neutral reaction system can better meet industrial needs.

[0051] The half-life test results of the α-galactosidase parent type and its mutants at different temperatures are shown in Table 2: The temperature resistance of the α-galactosidase mutant is significantly improved. The half-life of the combined mutant SLHY is 160 ~436 min at 45℃ ~ 60℃. The half-life of the parent type is only 10 ~ 50 min. The tolerance time of the corresponding residual enzyme activity of the point mutant in the above temperature environment is improved relative to the parent type, but the effect is limited. The half-lives of the point mutants S98L and H316Y at 45℃ ~ 60℃ are 36 ~ 112 min and 48 ~ 136 min, respectively. It can be seen that the temperature resistance of the α-galactosidase mutant SLHY of the present invention is significantly improved.

[0052] From the above, it can be seen that the neutrophilic and thermal stability of α-galactosidase can be improved after mutation. The α-galactosidase mutant SLHY provided by the present invention has excellent neutrophilic and thermal stability, which is significantly better than that reported previously. The amino acid sequence of the α-galactosidase mutant HSYE is shown in SEQ ID NO.2, and the nucleotide sequence of the mutant SLHY encoding gene is shown in SEQID NO.6. The α-galactosidase mutant SLHY provided by the present invention can be used in conjunction with commercial enzyme preparations in neutral and high temperature reaction systems to meet industrial production requirements.

[0053] Table 2 Optimal pH and half-life results of α-galactosidase parent and its mutants

[0054] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. A neutrophilic and thermostable α-galactosidase mutant, characterized in that The amino acid sequence of the mutant is shown in SEQ ID NO.2; it is obtained by mutating the 98th Ser to Leu and the 316th His to Tyr of the α-galactosidase shown in the amino acid sequence of SEQ ID NO.

1.

2. The gene encoding the neutrophilic and thermostable α-galactosidase mutant according to claim 1, characterized in that: The nucleotide sequence of the gene encoding the α-galactosidase mutant is shown in SEQ ID NO.

4.

3. A recombinant vector, characterized in that: A gene encoding the α-galactosidase mutant according to claim 1.

4. A method for preparing a neutrophilic and thermostable α-galactosidase mutant, characterized in that A recombinant cell expressing the mutant according to claim 1, or carrying the coding gene according to claim 2, or carrying the recombinant vector according to claim 3.

5. Use of the neutrophilic and thermostable α-galactosidase mutants according to claim 1 in degrading substrates containing α-galactosidic bonds.

6. The use according to claim 5, characterized in that The substrate is an anti-nutritional factor containing alpha-galactoside bonds in laver.

7. The use according to claim 6, characterized in that Degrade the anti-nutritional factors of laver and improve the nutritional value and utilization rate of laver extract.

Images