Application of poplar GLR2.8 gene

Abstract

The invention discloses a gene knockout method of poplar. The method comprises the following steps: taking disinfected poplar tissue culture seedling tender leaves as explants; the method comprises the following steps: infecting an explant by using agrobacterium, wherein the agrobacterium can express a Cas9 gene and is used for knocking out gRNA of a poplar GLR2.8 gene through a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 system; co-culturing the poplar explants infected by the agrobacterium tumefaciens; performing callus induction culture on the poplar explant obtained by co-culture to obtain a callus; carrying out differentiation culture on the calluses to obtain germinated poplar plants; and carrying out rooting culture on the germinated poplar plant to obtain the germinated and rooted gene knockout poplar plant. The gene knockout plant has improved mechanical properties. The invention also discloses a preparation method of the composite material. The preparation method comprises the following steps: extracting wood fibers and bast fibers in poplar plants obtained by the knockout method; the wood fibers, the bast fibers and polylactic acid are subjected to melt blending, and the composite material is obtained. The composite material has improved mechanical properties.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering and relates to an application of a poplar GLR2.8 gene. Background Art

[0002] Natural plant fibers are one of the most abundant natural materials in nature and can come from wood (softwood and hardwood) or non-wood (seeds, fruits, bast, leaves, stems, grass, etc.) materials. Natural plant fibers have the advantages of wide sources, low prices, and complete degradability, as well as high strength-to-weight ratio. Although the mechanical properties of plant fibers are much lower than those of the most widely used synthetic fibers, their high performance-to-density ratio, low density, high stiffness, and high strength make them comparable to those of synthetic fibers. With their excellent mechanical properties and renewable characteristics, plant fibers are increasingly widely used in the preparation of high-performance biomass composites. For example, with their superior mechanical properties and environmental performance, they occupy an important position in the production of construction, shipbuilding, and aerospace materials. With the continuous consumption of fossil fuels and the increase in energy demand, the development of green renewable materials has become a global energy development trend. Therefore, it is of great practical significance to increase the yield and quality of wood fibers, accelerate the comprehensive utilization of fiber and polymer materials, improve the mechanical properties of wood fibers, and strengthen the efficient, high-value and diversified utilization of forest resources.

[0003] Wood fiber morphology is an important anatomical feature of wood and one of the important bases for evaluating whether the wood is suitable as a fiber raw material. Poplar (Populus spp.) is a multi-purpose tree species with the advantages of fast growth, high yield and high efficiency, and is an important industrial raw material. Polylactic acid (PLA) is a thermoplastic polymer made from lactic acid and does not rely on fossil raw materials. It is a degradable and renewable polymer with good processing performance. It is currently a very ideal biodegradable reinforced composite matrix material. It not only opens up a broad space for the leapfrog development of industries such as cotton textiles, petrochemical textiles, and plastic daily necessities, but also provides an important solution to the problem of "white pollution". At present, the selection of composite material reinforcement has changed from high-performance synthetic fibers to high-performance biomass natural fibers, which can not only realize the efficient and high-value utilization of plant fiber resources, improve the comprehensive application performance of composite materials, but also reduce the preparation cost of composite materials. The plant fibers that have been studied more include hemp fibers, bamboo fibers, and mallow stem bark fibers. There are no reports on the research of woody plant fibers and their application in the wood industry. Therefore, cultivating forest species that change the morphology of fiber cells is regarded as an important way to solve the shortage of industrial raw materials in my country. Therefore, it is of great strategic significance to increase the output and quality of poplar fiber, accelerate the development of comprehensive utilization of poplar fiber and polymer materials, improve the mechanical properties of poplar fiber, alleviate the contradiction between supply and demand of forest resources, and promote the realization of "carbon peak" and "carbon neutrality" as scheduled. Summary of the invention

[0004] The present invention uses Populus alba×P.glandulosa clone 84K as research material and calcium ion channel protein PagGLR2.8 as research object, utilizes gene editing technology to analyze its influence on poplar vascular tissue structure and developmental pattern, and applies it to prepare fiber composite materials with polymer material PLA, improves the mechanical properties of the composite materials, and establishes the quantity-effect and structure-effect relationship of the performance of the fiber and the composite materials. The creation of the composite materials is helpful to enrich the high-value application of forest wood resources, accelerates the development of comprehensive utilization of poplar fibers and polymer materials, and can obtain corresponding economic and social benefits.

[0005] The present invention knocks out the poplar glutamate receptor protein Glutamine Receptor 2.8 (GLR) by molecular genetic means, changes the length of its fiber, studies the mechanical properties of the fiber at a microscopic scale, and establishes the influence relationship between the cellulose length regulated by the GLR gene and the mechanical properties of the fiber; further investigates the mechanical properties of fiber-reinforced polylactic acid (PLA) composites, and analyzes the mechanism by which the GLR2.8 gene affects the mechanical properties of PLA composites. The test results show that the poplar GLR2.8 gene knockout plants show phenotypes such as shorter plants, thicker ground diameters, wider xylem, larger vessel apertures, longer fibers, and increased aspect ratios. The elastic modulus of the phloem of the transgenic plants is significantly enhanced compared to that of the CK plants, indicating that the phloem fiber support force is enhanced after transgenic. This method of cultivating forest materials with characteristic properties through genetic design and using them to develop high-performance biomass composites provides important guidance and theoretical support for the high-value utilization of forest resources and efficient low-carbon economy.

[0006] The present invention uses 84K poplar as material and focuses on the study of the effect of calcium ion channel protein PagGLR2.8 on the microscopic mechanical properties of wood fiber. Transgenic plants are obtained by genetic means, and the biological functions of the target genes are explored by phenotypic observation, fiber separation, preparation of PLA / fiber composite materials, and analysis of the mechanical properties of composite materials. The results show that the crispr-PagGLR2.8 plants have thicker ground diameters, wider xylem, significantly increased bast fibers and xylem fibers, and thinner cell wall thickness than CK plants. Nanoindentation results show that the elastic modulus of the bast fibers of transgenic plants is significantly enhanced, indicating that the stiffness of the bast fibers after genetic modification is large, and the supporting capacity of the bast fibers of transgenic plants is increased. The results of the mechanical properties of the composite material show that the wood fibers of the transgenic plants have higher rigidity and similar strength, and the bast fibers of the transgenic plants can enhance the composite material. It can be inferred that genetically modified fiber / PLA composite materials can be used to process various plastic products from industrial to civilian use, packaged food, fast food lunch boxes, non-woven fabrics, industrial and civilian fabrics, and then processed into agricultural fabrics, health fabrics, rags, sanitary products, outdoor UV protection fabrics, tent fabrics, and floor mats. The market prospects are very promising.

[0007] In order to solve the problems existing in the prior art, the first aspect of the present invention provides a biomaterial, wherein the biomaterial is selected from any one of the following B1, B2, B3, B4 and B5:

[0008] B1: gRNA

[0009] The gRNA is used to knock out the poplar GLR2.8 gene through the CRISPR / Cas9 system;

[0010] B2: Genetic Engineering Vector

[0011] The genetic engineering vector is capable of expressing the gRNA described in B1;

[0012] B3: Recombinant Agrobacterium

[0013] The recombinant Agrobacterium contains the genetic engineering vector described in B2;

[0014] B4: Test kit

[0015] The kit contains the gRNA described in B1, the genetic engineering vector described in B2 or the recombinant Agrobacterium described in B3;

[0016] B5: Composition

[0017] The composition contains the gRNA described in B1, the genetic engineering vector described in B2 of the present invention or the recombinant Agrobacterium described in B3.

[0018] In some embodiments, any one or a combination thereof is selected from the following situations C1, C2, C3, C4 and C5;

[0019] C1: the poplar is 84K poplar;

[0020] C2: The coding sequence of the poplar GLR2.8 gene is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2;

[0021] C3: The target sequence of the gRNA is selected from the sequence shown in SEQ ID NO: 7;

[0022] C4: The genetic engineering vector can also express the Cas9 gene;

[0023] C5: The host bacteria of the recombinant Agrobacterium is GV3101 or EHA105.

[0024] The second aspect of the present invention provides the use of the biomaterial described in the first aspect of the present invention in preparing a formulation for improving poplar traits in poplar breeding;

[0025] The improved poplar traits include:

[0026] Increase the stem diameter of poplar trees;

[0027] Increase the width of the xylem and cambium of poplar stems;

[0028] Reduce the lignin content of poplar plants;

[0029] Increase the size of the pores in the poplar plant's vessels;

[0030] Increase the length of bast fibers of poplar plants, increase the length of xylem fibers of poplar plants, and increase the length of vessels of poplar plants;

[0031] Enhance the elastic modulus of bast fibers of poplar plants;

[0032] Increase the hardness of bast fibers in poplar plants.

[0033] The third aspect of the present invention provides a gene knockout method for poplar, wherein the gene knockout method comprises: knocking out the poplar GLR2.8 gene.

[0034] In some embodiments, the poplar is 84K poplar; and / or

[0035] The gene knockout is achieved through the CRISPR / Cas9 system.

[0036] In some embodiments, the gene knockout step is:

[0037] S1: Obtain poplar explants;

[0038] S2: infecting the poplar explants with recombinant Agrobacterium;

[0039] The recombinant Agrobacterium is capable of expressing the Cas9 gene and gRNA;

[0040] The gRNA is used to knock out the poplar GLR2.8 gene through the CRISPR / Cas9 system;

[0041] S3: co-cultivating the poplar explants infected by the recombinant Agrobacterium;

[0042] S4: callus induction culture: obtaining callus tissue from the poplar explants obtained through co-cultivation;

[0043] S5: Differentiation culture of the callus to obtain poplar plants with sprouts;

[0044] S6: Rooting and culturing the poplar plants that have sprouted to obtain gene-knockout poplar plants that have sprouted and grown roots.

[0045] In some embodiments, the method is selected from any one or a combination of the following situations D1, D2, D3, D4, D5 and D6;

[0046] D1: The tree explant is a poplar leaf;

[0047] D2: The coding sequence of the poplar GLR2.8 gene is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2;

[0048] D3: The co-culture medium is based on WPM, and the co-culture medium also contains 15-25 g / L sucrose, 6-10 g / L agar, 0.4-0.6 g / L 2-morpholineethanesulfonic acid, 80-120 μm acetosyringone, and pH 5.5-6.5;

[0049] D4: The callus induction medium is based on WPM, and the callus induction medium also contains 15-25 g / L sucrose, 6-10 g / L agar, 0.4-0.6 g / L 2-morpholineethanesulfonic acid, 0.8-1.2 mg / L 2,4-D, 0.8-1.2 mg / L KT, 150-250 mg / L cephalosporin, 150-250 mg / L timentin, 30-70 mg / L kanamycin, pH 5.5-6.5;

[0050] D5: The culture medium for differentiation culture is based on WPM, and the culture medium for differentiation culture also contains 15-25 g / L sucrose, 6-10 g / L agar, 0.4-0.6 g / L 2-morpholineethanesulfonic acid, 0.04-0.06 mg / L NAA, 0.4-0.6 mg / L 6-BA, 150-250 mg / L cephalosporin, 150-250 mg / L timentin, 30-70 mg / L kanamycin, pH 5.5-6.5;

[0051] D6: The culture medium for rooting culture is based on WPM, and the culture medium for rooting culture also contains 8-12 g / L sucrose, 6-10 g / L agar, 0.4-0.6 g / L 2-morpholineethanesulfonic acid, 150-250 mg / L cephalosporin, 150-250 mg / L timentin, 30-70 mg / L kanamycin, pH 5.5-6.5.

[0052] In some embodiments, the method is selected from any one or a combination of the following situations E1, E2, E3, E4, E5 and E6;

[0053] E1: The poplar leaves are young leaves of sterilized poplar tissue culture seedlings;

[0054] E2: The target sequence of the gRNA is selected from the sequence shown in SEQ ID NO: 7;

[0055] E3: The co-culture conditions are: culture in the dark for 1.5-2.5 days;

[0056] E4: The callus induction culture conditions are: dark culture for 15-30 days;

[0057] E5: The conditions of the differentiation culture are: the culture temperature is 20-28°C, the light intensity is 40-60 μmol·m -2 ·s -1 , the photoperiod is 14-18h light / 6-10h dark per day, and the cultivation time is 50-70 days;

[0058] E6: The rooting culture conditions are: the culture temperature is 20-28°C, the light intensity is 40-60 μmol·m -2 ·s -1 The photoperiod is 14-18h light / 6-10h dark every day, and the cultivation time is 7-14 days.

[0059] A fourth aspect of the present invention provides a method for preparing a composite material, the steps of the method are as follows:

[0060] T1: extracting wood fiber or bast fiber from a poplar plant obtained by the knockout method described in the third aspect of the present invention;

[0061] T2: reacting the wood fiber or the bast fiber with a first grafting agent to obtain grafted wood fiber or grafted bast fiber;

[0062] T3: dissolving polylactic acid in the first solvent to obtain a polylactic acid solution;

[0063] T4: mixing the dried grafted wood fiber or the dried grafted bast fiber with the polylactic acid solution to obtain a dispersion, and then drying the dispersion to obtain a composite material masterbatch containing wood fiber or a composite material masterbatch containing bast fiber;

[0064] T5: mixing polylactic acid, polylactic acid grafted with a second grafting agent, and the composite material masterbatch containing wood fibers or the composite material masterbatch containing bast fibers, and performing melt blending to obtain the composite material;

[0065] Whether the free end of the first grafting agent and the free end of the second grafting agent can undergo chemical reaction and bond.

[0066] In some embodiments, any one or a combination thereof is selected from the following X1, X2 and X3;

[0067] X1: the first grafting agent is KH560;

[0068] X2: the first solvent is chloroform;

[0069] X3: The second grafting agent is maleic anhydride.

[0070] In some embodiments, any one or a combination thereof is selected from the following Y1, Y2, Y3, Y4 and Y5;

[0071] Y1: In T2, the weight ratio of the wood fiber or the bast fiber to the first grafting agent is 100:1.5-2.0;

[0072] Y2: In T3, the weight ratio of the first solvent to the polylactic acid is 100:5-15;

[0073] Y3: In T4, the weight ratio of the dried grafted wood fiber or the dried grafted bast fiber to the polylactic acid in the polylactic acid solution is 30-50:100;

[0074] Y4: In T5, when wood fiber is selected in T1, the weight ratio of the polylactic acid, the polylactic acid grafted by the second grafting agent and the composite material masterbatch containing wood fiber is: 6-12:0.2-0.4:1;

[0075] When bast fiber is selected in T1, the weight ratio of the polylactic acid, the polylactic acid grafted by the second grafting agent and the composite material masterbatch containing bast fiber is: 20-30:0.6-1.0:1;

[0076] Y5: In T5, the melt blending conditions are: temperature 160-200°C, rotation speed 30-50 rpm, time 5-16 min.

[0077] The fifth aspect of the present invention provides a composite material, which is prepared according to the preparation method described in the fourth aspect of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0078] Figure 1 Comparison chart of the expression patterns of PagGLR2.8 in different tissues and in situ PCR photos.

[0079] Figure 2 Analysis of PagGLR2.8 gene editing.

[0080] Figure 3 The expression level of Pag GLR2.8 in gene knockout plant #17 is shown

[0081] Figure 4 The results of the comparative observation of morphology and section phenotype between wild-type and gene knockout plants are shown.

[0082] Figure 5 The results of fiber isolation and fiber length quantification of wild-type and gene knockout plants are shown.

[0083] Figure 6 The results of measurements of vessel number, pore size, and cell wall thickness in wild-type and knockout plants are shown.

[0084] Figure 7 The results of nanoindentation experiments on the phloem and xylem of wild-type and gene knockout plants are shown.

[0085] Figure 8 The results of mechanical property tests of wild-type and gene knockout plant fiber / PLA composites are shown. DETAILED DESCRIPTION

[0086] In order to make the objectives, technical solutions and advantages of the present invention more clear, the embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0087] Materials and instruments not described in the present invention are conventional materials and instruments in the art, and operation details not described in the present invention are conventional operations in the art. Unless otherwise specified, the nucleic acid sequences shown in the present invention are written from left to right in the direction of 5' to 3'.

[0088] Example 1: Obtaining the 84K poplar GLR2.8 gene and preparing gene knockout plants

[0089] 1. Plant species

[0090] The poplar used in the present invention is Populus alba×P. glandulosa '84K' (referred to as "84K poplar").

[0091] 2. Genetic information

[0092] The inventors of the present invention used the Illumina HiSeq X Ten platform in combination with Sanger sequencing to determine and assemble the 84K poplar genome and construct an 84K poplar genome database.

[0093] According to the gene homology naming rules, the GLR2.8 gene of 84K poplar (called Pag GLR2.8 gene) was obtained.

[0094] GLR gene: glutamate receptor gene, glutamate receptor gene, the prefix Pag of the GLR gene represents that it comes from the following 84K poplar genome, and the suffix represents the corresponding homologous gene number.

[0095] The coding sequence of the 84K poplar PagGLR2.8 gene from the first parent (Populus alba, referred to as parent A) is as follows (SEQ ID NO.1):

[0096]

[0097] The coding sequence of the PagGLR2.8 gene from the second parent (Populus glandulosa, abbreviated as G parent) of 84K poplar is as follows (SEQ ID NO.2):

[0098] ATGGCAATTCCGAAGCAGAAATTGACCCTGCCTTTTTTCACCCTTCTCTTGTTTAATATGTGGTCCAAGCAAAT

[0099] GGTGATCATGGCAATGGAGATTATACCAATAGGAGTAGTTCTTGATTTGAACTCAACAGTTGGAGAAATGGCAGCG

[0100] AGCTGCATATCCATGGCAGTCTCCGATTTCTATGCTGTTAATGCTGATTTTAAAACGAGACTCGCTCCTTTCACTAGG

[0101] GATTCCAGCAGTGATGTCGTTGCTGCAACTTCTTCAGTGCTGGATTTAATGAAGAATGAACAAGTGCATGCTATCAT

[0102] AGGGCCTCAAAAGTCATCGCAAGCTAAGTTTGTGGTGGAGCTCGGAGGAAAAGCAGAGGTTCCGATTGTTTCTTT

[0103] CGCAGCCACAAGCCCAACTCTTTCTGCAACTCAAAGCAAATATTTTGTCCGGACAGCTCAGGATGATTCTTCTCAA

[0104] GTGAAAGCAATAGCCAGCATTGTCCAAGCTTATGGTTGGCGGGAGATTGTACCGATCTATGAAGACACCGAATATG

[0105] GAAATGGTTTGGTTCCATTTTTGTTAGATGCCTTTCAAGAGATCGACACTCGAGTCCCTAATCGAAGTAGAATTCCT

[0106] TTGTATTTCAATGACACTCAAATCATGAGGGAGCTCAACAAGTTGAAGGCGACGCAGAAGAGTATATTTCTAGTGC

[0107] ACATGTCAGCCTCTCTTGGGTCCAGGCTGTTCTTACTTGCCAAGGATGCAGGAATGATGAGCGAAGGATATGGATG

[0108] GCTCGTGACAGCTGGATTATCCACCTTGCTAGATACTCTAGGTTCTGAAGTCATGGATTCAATGCGAGGTGTGTTGG

[0109] GTATAAAGCCACATATACCAACTTCAAAGAAACTCGAAAGTTTTAAATCAAGATGGAGCAAGAATTTCACCATAAG

[0110] CAAACCACAAAGTAAGATCAATGAATTAAACCACTTCGGTTTGTGGGCATATGACACAGTTTGGGCAATAGCAATG

[0111] GCTGTAGAAAAGGCTGGTATTGTGCGTTCTGGATACGTAAAGCAGAATACAAGTGAAAGCACAGTTGACATTGCTG

[0112] CCTTGGGAAAATCTGAAACGGGGCCAAGACTCCTAAGCTCCATATTAAGCACAAGATTTCAAGGCCTGAGTGGGG

[0113] ACTTCCATTTGGCTGGTGGAGAAAGGGTACCTTCAGCATTTGAAATACTCAATTTGATCGGAAAAGAAGAGAGAGT

[0114] CATTGGATATTGGACTCCAGAGAGAGGACTCTCACGGAACTTGTATGCTAATGGTAAAATAGCATATTCAACTTCCA

[0115] AAAACAGACTGAAGGAGCCAATTTGGCCAGGAGACACAACCCAGCAGCCAAAGAGGTTGAGGATTGGGGTTCCA

[0116] CTGAAAACTGGTTTTAAAGAGTTTATCAAAGTGGAATGGAATCCTGAAGATAAACCTATTGTTTCAGGTTTCACCC

[0117] GAGATATTTTCGTCTCCGTGGTTGAAGCATTACCATTCCCCCTTCCGTATGAGTTCATTCCCTTCGTCAACCAAAGTA

[0118] AACAGAGTGCTGGGACTTACAATGAACTTCTCGACCAAATCAAACTAAAGAATTTTGATGCTGCGGTGGGAGATAT

[0119] AACAATAATTGCCAATCGCTCAACATATGTGGATTTTACGTTGCCTTTTTCAGAATCAGGCATCAGAATGGTAGTTTT

[0120] GACAAAACGTGATGAGAGGGAAAACATGTGGATTTTCTTGAAGCCACTAAGCCCGGAGCTTTGGTTAACAACTGG

[0121] AATAGCATTCATCTTCACTGGCTTAGTGGTGTGGGTGCTCGAACACCGTGAAAACAAAGTGTTCAGGGGAAAACC

[0122] AGCGCAACAAGTTGGCACAACGTTGTGGTTCTCCTTTTCAACCCTCTTCTTTGCACATAGGGAGAAGGTGGTGAAT

[0123] AACTGGACAAGATTTGTATTGATCATATGGATTTTTGTGGTGCTAATCATATCACAGAGTTACACTGCTAGCTTAGCC

[0124] TCAATTTTGACTGTAAAGCGGTTCCAGCCTACATTTGTTGATGTCAAAGAGATTAGAAAGAATGGTTACTTTGTAGG

[0125] ACACCTGAAGAATTCTTTTGTGAAAGACTTCCTCGTAAAACAATTAAACTTCAATGACACCATGTTGAGGGAATAT

[0126] AGCACCCCAGAAGAGTATCATGATGCATTGTCTAATGGAATCCACAATGGTGGTGTAGCTGCTATCTTTGCTGAAAT

[0127] TCCCTACATCAAACTCTTTCTAGCAAAGTATTGCTCCAAATTCCAGATGGTAGGACCAACCTACAAAACCGATGGAT

[0128] TGGGCTTTGCATTTCCCCTTGGATCCCCACTGGTCCCTTACATTTCAAGGGCAGTCTTGAATGTCACACAAGATAAA

[0129] GATAAAATGGACGAAATTGAACGAAGGAACTTTGGTGGCGAAAACACTTGCTCAGATCAACCTTCCATGGAAACC

[0130] TCTGATGGTCTTTGTTTATCCAGCTTCGGAGGCCTCTTCATCATCACAGGAGTTGCTTCCATTTCTGCGCTTCTGATA

[0131] TATGTCACGAAGTTCCTTTACATTCATTGGCCTGCTTCGAACACCATGGATCGAGAAAGATCCTTTTACTTGAGAGT

[0132] TCTTGAATTGGCAAAACATTTTGACAAGGCAGATCCATCAGCTCATCAACTTAATGGAGCTGAGTCAAGAGTTCAC

[0133] CCTGTACCAAGTGCTGAAATAGTTGGAGCTTCACCTGATATCGATGATGCACGTAGCCATCCAAGGACTTCCAGTG

[0134] AAGGATCTGGAGACATCATTGGAGATCAAGACCATGAAAATCATACCCCAAGGAGCAGCGCTGCAAACCCCGAAC

[0135] CCCCACACACACCGTAG

[0136] Test of tissue-specific expression of GLR2.8 gene in 3.84K poplar

[0137] The primer design tool of NCBI was used to design qPCR primer pairs in the 84K poplar gene library based on the A parent of the PagGLR2.8 gene mentioned above, and the primer pairs F1 and R1 with good specificity verified by PCR were selected. The internal reference gene was the cytoskeleton UBQ gene, and the internal reference primers were F2 and R2.

[0138] F1(SEQ ID NO:3):CCGATTGTTTCTTTCGCGGC

[0139] R1(SEQ ID NO:4):ATCTCCCGCCAACCATAAGC

[0140] F2(SEQ ID NO:5):AGACCTACACCAAGCCCAAGAAGAT

[0141] R2(SEQ ID NO:6):CCAGCACCGCACTCAGCATTAG

[0142] One-month-old plants of conventional tissue culture 84K poplar were taken after transplantation, and partial tissues of the 1st to 3rd leaves (young leaves) and partial tissues of the 4th to 6th leaves (mature leaves) were obtained respectively. The stem segments were peeled and the phloem, cambium, developing xylem, mature xylem tissue and roots were scraped with an RNase-free blade to obtain a total of 7 samples, with 3 replicates for each sample.

[0143] The RNA of the seven 84K poplar samples was extracted using Trizol reagent, and cDNA was obtained by reverse transcription. VazymeChamQ SYBR qPCR Master Mix (Nanjing Novogene Biotech Co., Ltd., Catalog No.: Q311-02) was used according to the instructions for the experiment. -ΔΔCT Calculate the expression level.

[0144] The internal reference expression results were normalized to 1. The gene expression statistics of the above 7 samples can be found in Figure 1 A. Quantitative analysis of PagGLR2.8 gene tissues showed that its expression level was high in the xylem, and in situ PCR results also showed that PagGLR2.8 gene was expressed in the phloem and developing xylem of the stem ( Figure 1 B), it is speculated that this gene is related to the development of poplar vascular tissue. The present invention will subsequently knock out this gene to study its function.

[0145] The seventh internode of the stem of one-month-old “84K” tissue culture seedlings was fixed in formaldehyde solution, and the penetration of the fixative was enhanced by vacuum infiltration. Then, the samples were embedded in agarose for subsequent sectioning on a vibrating microtome. The sections were collected in microcentrifuge tubes, genomic DNA was removed with DNase, and the mRNA in the sections was converted into cDNA by reverse transcription. The resulting cDNA was amplified using nucleotide-specific PCR primers for the PagGLR2.8 gene labeled with digoxigenin (DIG, digoxigenin-11-dUTP, alkali-stable, Roche). The sections were incubated with anti-DIG antibodies conjugated to alkaline phosphatase. The addition of a specific substrate for alkaline phosphatase allowed colorimetric detection of the DIG-labeled PCR products defined by the RNA synthesis site. Then, the sections were transferred to microscope slides and visualized by bright-field microscopy (Leica DM6B). The results can be found in. Figure 1 B, where no colored tissue was found in the negative control. Ph indicates phloem, xy indicates xylem, and ca indicates cambium. It can be seen that the PagGLR2.8 gene is mainly expressed in phloem and developing xylem, which corresponds to the above qPCR results.

[0146] 4. Gene Target Selection

[0147] In order to ensure that the paternal and maternal PagGLR2.8 genes can be edited at the same time and improve the success rate of knockout, the paternal and maternal PagGLR2.8 genes were edited according to the consistent sequence in exon 5 (see Design Idea for details). Figure 2 A), design the following target sequence:

[0148] T1 (SEQ ID NO:7): AAATTGAACGAAGGAACTTTGG

[0149] The CRISPR / Cas9 system used in the present invention (for the usage method of this version, see the document Yi An, Yangyan Zhou, Xiao Han, Chao Shen, Shu Wang, Chao Liu, Weilun Yin, Xinli Xia. The GATA transcription factor GNC plays an important role in photosynthesis and growth in poplar. J Exp Bot. 2020 Mar 25; 71(6): 1969-1984.) was donated by Andrew Groover's laboratory. Its entry vector is pEn-Chimera1.1, also called pEn-C1.1, which contains a target sequence insertion site and a guide RNA (guide RNA, gRNA) expression element; the final vector (also called the destination vector) is pDe-Cas9, which has a Cas9 gene coding sequence and an expression element; after the target sequence expression element in the entry vector is inserted into the final vector through the Gateway reaction, the target receptor is transformed by Agrobacterium.

[0150] 5. Design of gRNA

[0151] Oligonucleotides gRNA_GLR2.8_F and gRNA_GLR2.8_R were synthesized for target T1 and annealed to form double-stranded CT.

[0152] gRNA_GLR2.8_F(SEQ ID NO:8):attgAAATTGAACGAAGGAACTTTGG

[0153] gRNA_GLR2.8_R(SEQ ID NO:9):aaacCCAAAGTTCCTTCGTTCAATTT

[0154] 6. Preparation of Recombinant Entry Vector

[0155] Under the action of restriction endonuclease NEB BbsI, the pEn-Chimera1.1 vector was linearized by enzyme digestion, and the linearized vector was verified by electrophoresis and purified and recovered. The recovered product was connected to the double-stranded CT under the action of T4DNA ligase. The recombinant vector was transformed into Escherichia coli DH5α competent cells and screened and cultured using LB solid medium containing 50mg / L ampicillin. Monoclonal colonies were picked and gRNA_GLR2.8_F and M13_R were used as primers for monoclonal detection PCR. After the recombinant positive clones were successfully confirmed by electrophoresis, the SS42 primer was used for Sanger sequencing to verify the correctness of the recombinant sequence, and the recombinant entry vector EVCT was obtained.

[0156] M13_R(SEQ ID NO:10):CACAGGAAACAGCTATGAC

[0157] SS42 (SEQ ID NO:11):TCCCAGGATTAGAATGATTAGG

[0158] 7. Preparation of recombinant gene knockout vector

[0159] The recombinant entry vector EVCT was mixed with the final vector plasmid, and the recombinant product was formed by Gateway reaction using the LR clonase II enzyme mix kit. The recombinant product was transformed into Escherichia coli DH5α competent cells, and screened and cultured using LB solid medium containing 50 mg / L spectinomycin. Pick the monoclonal colony and use crispr_F and gRNA_GLR2.8_R primers for monoclonal detection PCR. After the positive recombinant clone was successfully confirmed by electrophoresis, the Sanger sequencing was performed using crispr_F as a primer to verify the correctness of the recombinant sequence. Select the positive recombinant plasmid to transform Agrobacterium GV3101 competent cells, screen and culture using YEP solid medium containing spectinomycin and rifamycin, and use crispr_F and gRNA_GLR2.8_R primers for monoclonal detection PCR. The successfully transformed monoclone was determined by electrophoresis. The positive monoclonal clone was expanded to obtain the recombinant Agrobacterium bacterial liquid.

[0160] crispr_F(SEQ ID NO:12):CTCCCTAGGCCTGTTATCCCT

[0161] 8.84k Poplar leaf disc immersion transformation

[0162] (1) Explant treatment: Tender leaves of 84K poplar tissue culture seedlings grown for 4-6 weeks were used as explant transformation materials. After collection, the leaves were first washed with clean water, then disinfected with 20w / v% sodium hypochlorite aqueous solution in a clean bench for 20 minutes, and washed with sterile distilled water for at least 5 times to ensure that there was no sodium hypochlorite residue on the surface of the material, and excess distilled water was absorbed with sterile filter paper.

[0163] (2) Cultivation of Agrobacterium: The recombinant Agrobacterium culture was cultured in YEP liquid medium (200 mL) containing 100 mg / L Kan (kanamycin) and 50 mg / L Rif (rifamycin) at 28°C and 180 rpm overnight. After logarithmic phase amplification, the culture was centrifuged at 3600 rpm and 4°C for 10-15 min. The cells were resuspended in sterile 1 / 2MS solution (with 30 g / L sucrose) to a final OD of 0. 600 It is about 0.4, and the infected bacterial solution is obtained for standby use.

[0164] (3) Infection: The explant leaves sterilized above were cut with a knife tip to create wounds on the main veins, the leaf margins were removed, and the leaves were cut into pieces of approximately 0.5 × 2.0 cm in size. 600 Infect in about 0.4% infection solution for 10-20 minutes, gently rotate and oscillate during the process to ensure that each leaf is in close contact with Agrobacterium.

[0165] (4) Co-culture: The infected leaves were dried with filter paper and spread on the co-culture medium. They were kept away from light for 2 days to allow the Agrobacterium carrying the target gene to be transferred into the leaves. The co-culture medium was based on WPM and also contained 20 g / L sucrose, 7.8 g / L agar, 0.5 g / L MES (2-morpholineethanesulfonic acid), 100 μM AS (acetosyringone), and pH 5.9.

[0166] (5) Callus induction culture: Tear the leaves apart and transfer them to callus induction medium and continue dark culture for about two weeks. After callus grows, transfer them to new callus induction medium. Change the medium every two weeks, and callus will grow in about 2-4 weeks. The callus induction medium is based on WPM as the basic medium, and also contains 20g / L sucrose, 7.8g / L agar, 0.5g / LMES, 1.0mg / L 2,4-D, 0.1mg / L KT (kinetin), 200mg / L cephalosporin, 200mg / L timentin, 50mg / L kanamycin, pH 5.9.

[0167] (6) Differentiation culture: When the callus reaches the size of a rice grain, it is transferred to a differentiation medium. The medium is changed approximately every three weeks. The culture temperature is 25°C and the light intensity is 50 μmol·m -2 ·s -1 , the photoperiod is 16h light / 8h dark. During this period, the callus will turn green, harden, and sprout. This stage is about two months. The differentiation medium is based on WPM, and also contains 20g / L sucrose, 7.8g / L agar, 0.5g / L MES, 0.05mg / L NAA, 0.5mg / L 6-BA, 200mg / L cephalosporin, 200mg / L timentin, 50mg / L kanamycin, pH 5.9.

[0168] (7) Rooting culture: When the seedlings grow to about 1 cm, they are cut and placed in rooting medium for about a week to grow roots. The culture temperature is 25°C and the light intensity is 50 μmol·m -2 ·s -1 The photoperiod was 16 h light / 8 h dark. The rooting medium was based on WPM and also contained 10 g / L sucrose, 7.8 g / L agar, 0.5 g / L MES, 200 mg / L cephalosporin, 200 mg / L timentin, 50 mg / L kanamycin, and pH 5.9.

[0169] (8) Results: After 2 weeks of rooting, plant DNA was extracted and PCR detection was performed using specific primers on the CRISPR vector to obtain positive gene knockout plants for subsequent research.

[0170] 9. Mutation Identification of Gene Knockout Plants

[0171] For the positive strains of target combination gene knockout operation, genomic DNA was extracted respectively, and PCR amplification was performed using the specific primers GLR2.8_F and GLR2.8_R for gRNA target site detection, and the amplified products were connected to the T vector. Escherichia coli DH5α was transformed to obtain a single colony. Then the plasmid was extracted for sequencing of the target site. The Sanger sequencing results were compared with the control sequence to analyze the mutation effect. Among them, the knockout site sequences (corresponding to the target sequence T1) of plants #8, #9 and #17 and the wild control plant (CK) are shown in Figure 2 A lower part and Figure 2 B. The two sequences of each plant represent the sequence from the male parent and the sequence from the female parent in 84K poplar, respectively. It can be seen that the PagGLR2.8#8 and #9 genes of the gene knockout-positive plants underwent frameshift mutations, indicating that the gene was successfully knocked out. Only one parent of the PagGLR2.8#17 plant was edited. Subsequently, the expression level of the PagGLR2.8 gene in the PagGLR2.8#17 plant was examined by qPCR using the aforementioned primers F1 and R1. The results showed that the expression level of the PagGLR2.8 gene in each group of the PagGLR2.8#17 plant was significantly reduced ( Figure 3 ), so we continued to carry out subsequent experiments.

[0172] GLR2.8_F(SEQ ID NO:13):GCATTTCCCCTTGGATCCCCAC

[0173] GLR2.8_R(SEQ ID NO:14):ACTATTTCAGCACTTGGTACAGGGT

[0174] The #8 knockout strain was named crispr-PagGLR2.8#8, the #9 knockout strain was named crispr-PagGLR2.8#9, and the #17 knockout strain was named crispr-PagGLR2.8#17.

[0175] Example 2: Analysis of phenotypic differences between plants of different genotypes

[0176] 1. Morphological Comparative Analysis

[0177] To explore the biological function of PagGLR2.8, two-month-old seedlings (two months after conventional tissue culture transplanting) of the parent 84K poplar (CK for short), crispr-PagGLR2.8#8 (C8 for short), crispr-PagGLR2.8#9 (C9 for short), and crispr-PagGLR2.8#17 (C17 for short) of four poplar plants (referred to as the four poplar germplasms) were counted and the following parallel test experiments were carried out respectively.

[0178] The morphological differences of the plants are shown in Figure 4 . Among them, A and B show the comparison of plant height between three crispr-PagGLR2.8 and wild type, C shows the comparison of ground diameter between crispr-PagGLR2.8#8 and wild type, D shows the cross-sectional slice photos of the 7th internode of the crispr-PagGLR2.8 and wild type stems, E shows the longitudinal slice photos of the 7th internode of the crispr-PagGLR2.8 and wild type stems, F is the comparison of the width of the cambium in the 7th internode of the crispr-PagGLR2.8 and wild type stems, and G is the width of the xylem in the 7th internode of the crispr-PagGLR2.8 and wild type stems. Comparison results: H is the comparison of the phloem width of the 7th internode of the crispr-PagGLR2.8 and wild-type stems, I is the cellulose content measurement results of crispr-PagGLR2.8 and wild-type stems, J is the lignin content measurement results of crispr-PagGLR2.8 and wild-type stems, K is the hemicellulose content measurement results of crispr-PagGLR2.8 and wild-type stems, L is the phloem staining photo of the 7th internode of the crispr-PagGLR2.8 and wild-type stems, and M is the bleach staining photo of the 7th internode of the crispr-PagGLR2.8 and wild-type stems.

[0179] Figure 4 In the figure, L and M from top to bottom and other sub-figures from left to right show the results of CK, crispr-PagGLR2.8#8, crispr-PagGLR2.8#9, and crispr-PagGLR2.8#17, and the scale bars in D, L, and M represent 400 μm.

[0180] The plant height measurement results showed that the knockout plants grew significantly slower than the CK plants ( Figure 4 A, B), comparing the ground diameter, it was found that the gene knockout plants had a significant increase in thickness ( Figure 4 C). It can be seen that the height of PagGLR2.8 knockout plants became shorter and the stem segments became thicker, which can reduce plant height without obvious changes in biomass, better prevent lodging under strong wind conditions, and make it easier to cut down trees.

[0181] The 7th internode of the stem of two-month-old seedlings of the above four poplar germplasms was sliced ​​with a vibrating knife (VT1200S, Leica) with a thickness of 50 μm. The fresh slices were routinely stained with 0.01% toluidine blue O (TBO) for 1 min, washed three times with water to remove excess staining solution on the surface, covered with a coverslip, and observed and photographed the TBO-stained slices using an optical microscope (Leica DM6B) to analyze the morphological differences of the stem end cross-sections.

[0182] The 7th internode stem sections of the above four poplar germplasms were stained by phloroglucinol staining to show the distribution of cellulose lignin.

[0183] The 7th internode stem sections of the above four poplar germplasms were stained with calcifluorescein white (CFW) to reveal cellulose.

[0184] Three plants with relatively average growth conditions from the three knockout strains were taken to prepare mixed samples. For the analysis of crystalline cellulose, the remaining material after trifluoroacetic acid treatment was hydrolyzed in Updegraff reagent. The cooled pellets were washed and hydrolyzed with 72% sulfuric acid. The cellulose content was routinely determined by the anthrone method. The lignin content was routinely determined by the acetyl bromide method. Hemicellulose was converted into reducing sugars after acid treatment, and a reddish-brown substance was generated with 3,5-dinitrosalicylic acid (DNS). The hemicellulose content was determined by a spectrophotometer. The data are expressed as the mean ± standard deviation of three biological replicates.

[0185] Image J software was used to measure the double wall thickness, pore diameter, and number of vessels per square millimeter of crispr-PagGLR2.8 and CK plants.

[0186] Take the 8th to 10th internodes of the two-month-old seedlings of the above four poplar germplasms, peel off the bark, cut the separated phloem and xylem into several small pieces with a knife and put them into centrifuge tubes. Put the separation liquid (glacial acetic acid AR analytical grade: 30% hydrogen peroxide = 1:1) into a centrifuge tube and put it into a 65℃ constant temperature water bath. Shake it vigorously several times during the separation. After the separation is complete, pour the separation liquid with fibers into the centrifuge tube, put the centrifuge tube into the centrifuge, and discard the supernatant. Add RO water for centrifugal washing, and repeat the steps until the glacial acetic acid smell dissipates. Use a dropper to absorb the washed fibers in the centrifuge tube, observe and take photos of the fibers with an optical microscope (Leica DM6B), and measure the fiber length with Image J software.

[0187] Results Figure 4 , where D and E show the TBO staining results, xy indicates xylem, the scale bar is 400 μm, and FH show the width of cambium, xylem, and phloem, respectively. Figure 4 D, E) show that the width of the xylem and cambium of the knockout plants is significantly wider than that of CK ( Figure 4 F, G); Figure IK shows that the cellulose content in crispr-PagGLR2.8 plants increased and the lignin content decreased. Only crispr-PagGLR2.8#9 and CK showed significant differences in hemicellulose. L shows the results of phloroglucinol staining. The staining results ( Figure 4 L) shows that compared with CK, crispr-PagGLR2.8 plants have lighter phloroglucinol staining, indicating that crispr-PagGLR2.8 inhibits the reduction of poplar lignin content. M shows the CFW staining results, the staining results ( Figure 4 M) shows that the cellulose content of crispr-PagGLR2.8 plants was increased compared with CK.

[0188] The results of optical electron microscopy showed that the knockout plants had longer vessel length, bast fiber length, and wood fiber length ( Figure 5 A, 5B, 5C, 5D), and had a larger aspect ratio of wood fiber and bast fiber. The crispr-PagGLR2.8 plants had more vessels ( Figure 6 A, 6B, 6C), the aperture is significantly increased ( Figure 6 A, 6B, 6E), the cell wall of crispr-PagGLR2.8 plants was significantly thinner ( Figure 6 C, 5F), so it is speculated that the PagGLR2.8 gene is involved in xylem development.

[0189] Figure 5 In A, in the four sub-figures from top to bottom in the left column, the lower left, lower right, upper right, and upper double arrows indicate vessels, and the other double arrow indicates wood fibers. The double arrows in the right column represent bast fibers.

[0190] In summary, the crispr-PagGLR2.8 gene knockout plants had lower lignin content, higher cellulose content, and no significant difference in hemicellulose content compared with CK. It is speculated that the PagGLR2.8 gene affects the synthesis of lignin and cellulose content. The reduction of lignin is conducive to the utilization of papermaking bioenergy, and provides a feasible and efficient new strategy for creating high-quality and high-yield new forest materials. In addition, the average length of the overall gene knockout bast fiber is 1031.67μm, which meets the standard intermediate length fiber (0.91-1.60mm) specified by the International Society of Wood Anatomy. The overall fiber is longer and more suitable for papermaking, and the reduction of lignin content facilitates the separation between fibers, which is helpful for the pulping process or the application of bioenergy.

[0191] Figure 6(A) TBO-stained xylem cross section of the 10th internode. (B) Xylem fibers and vessels were observed under SEM (×500). (C) The structure of xylem cells was analyzed by SEM at ×1200 magnification. (D) The number of vessels. (E) The width of vessels. (F) The thickness of the wood fiber cell wall.

[0192] The results showed that the crispr-PagGLR2.8 knockout plants had more ducts than the CK ( Figure 6 (A, B, D), large pore size (A, B, E), thin wood fiber cell wall (A, B, C, F)

[0193] 2. Mechanical properties analysis

[0194] The phloem and xylem of the CK plants and gene knockout edited plants (C8 was selected as a representative) were taken and embedded in epoxy resin to prepare samples. The micromechanical properties of the fibers were characterized and analyzed using a nanoindenter (KLAiMicro) to explore the effect of PagGLR2.8 gene knockout on the mechanical properties of the fibers.

[0195] The results of nanoindentation experiments showed that the elastic modulus of bast fibers of crispr-PagGLR2.8 knockout plants was between 20.0 and 25.0 GPa, and the elastic modulus of bast fibers of CK plants was between 14.0 and 18.0 GPa ( Figure 7 A). Compared with CK plants, the elastic modulus of bast fibers in crispr-PagGLR2.8 knockout plants was significantly enhanced, indicating that the bast fibers after gene knockout were stiffer. The hardness comparison results showed that the hardness of bast fibers in crispr-PagGLR2.8 plants (mostly between 0.4 and 0.5 GPa) was greater than that of bast fibers in CK plants (0.3 to 0.4 GPa), indicating that bast fibers in gene knockout plants have better support. Some cell outlines can be seen in the xylem elastic modulus mapping diagram ( Figure 7 B), the elastic modulus of crispr-PagGLR2.8 plants and CK plants were between 15.0 and 20.0 GPa, and the hardness was between 0.70 and 0.90 GPa. There was no significant difference in elastic modulus and hardness between crispr-PagGLR2.8 plants and CK plants, indicating that the gene knockout plants did not significantly affect the xylem while changing the mechanical properties of phloem fibers.

[0196] Example 3: Study on the Effect of PagGLR2.8 Gene on Mechanical Properties of Fiber / PLA Composites 1. Pretreatment of Bast Fiber / Wood Fiber

[0197] The bast fiber / wood fiber that is separated and dried to a constant weight is obtained in the same manner as above (the bast fiber / wood fiber is operated independently, and the bast fiber / wood fiber is collectively referred to as fiber), and is dispersed in a 90 vol% ethanol / water solution to obtain a 5 wt% uniform dispersion of the bast fiber / wood fiber; the pH of the above dispersion is adjusted to 4.5 with glacial acetic acid, and then 1.7 wt% of a silane coupling agent (KH560, i.e., the amount of KH560 is 1.7 wt% of the total weight of KH560 and the bast fiber / wood fiber) is added, and after stirring, an ultrasonic treatment is performed for 22 minutes with an ultrasonic power of 220 W to cause a grafting reaction between KH560 and the fiber; the ethanol solution is volatilized to finally obtain the pretreated fiber (dry product).

[0198] 2. Preparation of polylactic acid / fiber composite masterbatch

[0199] Composite masterbatch preparation includes the following steps:

[0200] 1. Dissolve polylactic acid (PLA, type 4032D, the same below) in chloroform to obtain a 10 wt% PLA-chloroform solution;

[0201] 2. Add a certain amount of the pretreated fiber (dry product) mentioned above to the PLA-chloroform solution prepared above, stir for 1.5 hours until the fiber is evenly dispersed, and obtain a fiber / PLA-chloroform dispersion with a fiber mass content of 30 wt% (i.e., the ratio of the dry fiber to the total weight of PLA in the dry fiber and the PLA-chloroform dispersion is 30%);

[0202] 3. Add a certain amount of anhydrous ethanol to the fiber / PLA-chloroform dispersion obtained above, stir until no precipitate is precipitated, filter, wash with ethanol, and wash with deionized water, repeat washing for 5 times, collect the filter cake product, and vacuum dry it at 60°C for 12 h to obtain a 30 wt% PLA / fiber composite masterbatch (i.e., the ratio of the dry fiber product to the total weight of the dry fiber product and PLA is 30%).

[0203] 3. Polylactic acid / fiber composite

[0204] PLA / fiber composite preparation includes the following steps:

[0205] 1. Weigh a certain amount of the PLA / fiber composite masterbatch (also referred to as pre-composite masterbatch) with a fiber content of 30 wt% obtained in the above step 2 and compound it with a certain amount of pure PLA to form composite pellets, and add a maleic anhydride grafted polylactic acid modifier with a total mass fraction of 3 wt% of the composite material after compounding to obtain preformed pellets.

[0206] 2. The preformed pellets obtained above are melt blended and hot pressed to finally obtain the target PLA / fiber composite material. The melt blending parameters include: the banburying temperature is 170-185°C, the banburying speed is 35-50rpm, and the banburying time is 10-15min; the hot pressing molding parameters include: the hot pressing temperature is 170-185°C, the hot pressing pressure is 7-10MPa, and the hot pressing time is 8-12min.

[0207] The specific implementation cases are as follows:

[0208] 56.0 g of polylactic acid, 1.8 g of maleic anhydride grafted polylactic acid, and 2.2 g of the pre-composite material were mixed and added in batches to a 175° C. internal mixer at a speed of 45 rpm for 12 min to obtain a 1% PLA / fiber composite material (i.e., the weight ratio of bast fiber / wood fiber to all solid materials is approximately 1%). Figure 8 Marked as 1% XF / PLA or 1% PF / PLA or 1% crispr-PagGLR2.8-XF / PLA or 1% crispr-PagGLR2.8-PF / PLA); subsequently, relevant mechanical properties test specimens were prepared by hot pressing molding (conditions as mentioned above).

[0209] 52.2 g of polylactic acid, 1.8 g of maleic anhydride grafted polylactic acid, and 6.0 g of the pre-composite material were mixed and added in batches to a 180° C. internal mixer at a speed of 40 rpm for 10 min to obtain a 3% PLA / fiber composite material (i.e., the weight ratio of bast fiber / wood fiber to all solid materials is approximately 3%). Figure 8 Marked as 3% XF / PLA or 3% PF / PLA or 3% crispr-PagGLR2.8-XF / PLA); then, relevant mechanical properties test specimens were prepared by hot pressing molding (conditions as above).

[0210] 48.2 g of polylactic acid, 1.8 g of maleic anhydride grafted polylactic acid, and 10 g of the pre-composite material were mixed and added in batches to a 175° C. internal mixer at a speed of 50 rpm for 15 min to obtain a 5% PLA / fiber composite material (i.e., the weight ratio of bast fiber / wood fiber to all solid materials is approximately 5%). Figure 8 5% XF / PLA or 5% PF / PLA in the figure); then, the relevant mechanical properties test specimens were prepared by hot pressing molding (conditions as above).

[0211] 58.2 g of polylactic acid, 1.8 g of maleic anhydride grafted polylactic acid, and 0 g of the pre-composite material were mixed and added in batches into a 175° C. internal mixer at a speed of 45 rpm for 12 min to obtain a 0% PLA / fiber composite material (i.e., a control of preparing polymers from polylactic acid and maleic anhydride grafted polylactic acid, Figure 8 Subsequently, relevant mechanical properties test specimens were prepared by hot pressing (conditions as above).

[0212] 5. Determination of mechanical properties of composite materials

[0213] Determination of tensile properties: The specimens were tested according to the requirements of GB / T 1040-2018. The test tensile speed was 2 mm / min. The tensile strength and elastic modulus of the final composite material specimens were obtained. Five specimens were tested for each group of samples to reduce the error, and the average value was calculated.

[0214] The bending properties were determined according to the requirements of GB / T 9341-2008. The bending speed was 5 mm / min. The bending strength and bending modulus of the final composite material were obtained. Five specimens were tested for each group of samples to reduce the error and the average value was calculated. The statistical data of bending strength and elastic modulus can be found in Figure 8 .

[0215] like Figure 8 As shown in A and C, first, according to the mechanical property values ​​of different addition amounts of wild-type plant fibers in the PLA composite material, the addition amount with the best mechanical properties (i.e., 3% wood fiber composite material (3% XF / PLA) and 1% bast fiber composite material (1% PF / PLA)) was selected, and then the wood fiber and bast fiber of the gene knockout strain were compounded with PLA respectively to prepare 3% gene knockout wood fiber composite material (3% crispr-PagGLR2.8-XF / PLA) and 1% gene knockout bast fiber composite material (1% crispr-PagGLR2.8-PF / PLA). The preparation method was the same as the aforementioned composite material preparation method and steps, and the mechanical properties were tested according to the same steps.

[0216] Wood fiber / PLA mechanical properties test results ( Figure 8A, B) show that the comprehensive mechanical properties of the 3% control plant wood fiber / PLA composite (3% XF / PLA) are the best, and adding an appropriate amount of wood fiber can improve the rigidity of the composite to a certain extent. The elastic modulus and bending modulus of the 3% crispr-PagGLR2.8-XF / PLA composite are 15.3MPa and 80.3MPa higher than 3% XF / PLA, and 43.7MPa and 837.1MPa higher than PLA, while the tensile strength and bending strength are basically maintained. This shows that the wood fiber of the gene knockout plant has the ability to significantly enhance the rigidity of PLA.

[0217] Bast fiber / PLA mechanical properties test results ( Figure 8 C, D) show that the comprehensive mechanical properties of the 1% control plant bast fiber / PLA composite (1% PF / PLA) are the best. Thanks to the large aspect ratio and reinforcing effect of bast fibers, adding an appropriate amount of bast fibers can improve the rigidity of the composite. The elastic modulus and flexural modulus of the 1% crispr-PaGLR2.8 PF / PLA composite were increased by 54.3MPa and 41.93MPa respectively compared with the 1% PF / PLA composite, and the tensile strength and flexural strength were slightly improved; compared with PLA, the elastic modulus and flexural modulus of the 1% crispr-PaGLR2.8 PF / PLA composite were increased by 32.9% and 35.6% respectively, showing an enhancement effect. The above results show that gene knockout plant bast fibers can significantly enhance PLA composites.

[0218] Figure 8 In the table, the left side of the column data corresponding to each material of A and C is the tensile strength, and the right side is the elastic modulus. The left side of the column data corresponding to each material of B and D is the bending strength, and the right side is the bending modulus. The units of the above four indicators are all MPa. A and B are the measured data corresponding to wood fiber, and C and D are the measured data of bast fiber.

[0219] It is known from common technical knowledge that the present invention can be implemented by other embodiments that do not deviate from its spirit or essential features. Therefore, the above disclosed embodiments are only illustrative in all respects and are not exclusive. All changes within the scope of the present invention or within the scope equivalent to the present invention are included in the present invention.

Claims

1. A biomaterial, wherein the biomaterial is selected from any one of the following B1, B2, B3, B4 and B5: B1: gRNA The gRNA is used to knock out the poplar GLR2.8 gene through the CRISPR / Cas9 system; B2: Genetic Engineering Vector The genetic engineering vector is capable of expressing the gRNA described in B1; B3: Recombinant Agrobacterium The recombinant Agrobacterium contains the genetic engineering vector described in B2; B4: Test kit The kit contains the gRNA described in B1, the genetic engineering vector described in B2 or the recombinant Agrobacterium described in B3; B5: Composition The composition contains the gRNA described in B1, the genetic engineering vector described in B2 of the present invention or the recombinant Agrobacterium described in B3.

2. The biomaterial according to claim 1, characterized in that Selected from any one or a combination of the following situations C1, C2, C3, C4 and C5; C1: the poplar is 84K poplar; C2: The coding sequence of the poplar GLR2.8 gene is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2; C3: The target sequence of the gRNA is selected from the sequence shown in SEQ ID NO: 7; C4: The genetic engineering vector can also express the Cas9 gene; C5: The host bacteria of the recombinant Agrobacterium is GV3101 or EHA105.

3. Use of the biomaterial according to claim 1 or 2 in the preparation of a formulation for improving poplar traits in poplar breeding; The improved poplar traits include: Increase the stem diameter of poplar trees; Increase the width of the xylem and cambium of poplar stems; Reduce the lignin content of poplar plants; Increase the size of the pores in the poplar plant's vessels; Increase the length of bast fibers of poplar plants, increase the length of xylem fibers of poplar plants, and increase the length of vessels of poplar plants; Enhance the elastic modulus of bast fibers of poplar plants; Increase the hardness of bast fibers in poplar plants.

4. A gene knockout method for poplar, the gene knockout method comprising: knocking out the poplar GLR2.8 gene.

5. The method according to claim 4, characterized in that The poplar is 84K poplar; and / or The gene knockout is achieved through the CRISPR / Cas9 system.

6. The method according to claim 4 or 5, characterized in that The steps of gene knockout are: S1: Obtain poplar explants; S2: infecting the poplar explants with recombinant Agrobacterium; The recombinant Agrobacterium is capable of expressing the Cas9 gene and gRNA; The gRNA is used to knock out the poplar GLR2.8 gene through the CRISPR / Cas9 system; S3: co-cultivating the poplar explants infected by the recombinant Agrobacterium; S4: callus induction culture: obtaining callus tissue from the poplar explants obtained through co-cultivation; S5: Differentiation culture of the callus to obtain poplar plants with sprouts; S6: Rooting and culturing the poplar plants that have sprouted to obtain gene-knockout poplar plants that have sprouted and grown roots.

7. The method according to any one of claims 4 to 6, characterized in that The method is selected from any one or a combination of the following situations D1, D2, D3, D4, D5 and D6; D1: the tree explant is a poplar leaf; D2: The coding sequence of the poplar GLR2.8 gene is shown in SEQ ID NO: 1 and / or SEQ ID NO: 2; D3: The co-culture medium is based on WPM, and the co-culture medium also contains 15-25 g / L sucrose, 6-10 g / L agar, 0.4-0.6 g / L 2-morpholineethanesulfonic acid, 80-120 μm acetosyringone, and pH 5.5-6.5; D4: The callus induction medium is based on WPM, and the callus induction medium also contains 15-25 g / L sucrose, 6-10 g / L agar, 0.4-0.6 g / L 2-morpholineethanesulfonic acid, 0.8-1.2 mg / L 2,4-D, 0.8-1.2 mg / L KT, 150-250 mg / L cephalosporin, 150-250 mg / L timentin, 30-70 mg / L kanamycin, pH 5.5-6.5; D5: The culture medium for differentiation culture is based on WPM, and the culture medium for differentiation culture also contains 15-25 g / L sucrose, 6-10 g / L agar, 0.4-0.6 g / L 2-morpholineethanesulfonic acid, 0.04-0.06 mg / L NAA, 0.4-0.6 mg / L 6-BA, 150-250 mg / L cephalosporin, 150-250 mg / L timentin, 30-70 mg / L kanamycin, pH 5.5-6.5; D6: The culture medium for rooting culture is based on WPM, and the culture medium for rooting culture also contains 8-12 g / L sucrose, 6-10 g / L agar, 0.4-0.6 g / L 2-morpholineethanesulfonic acid, 150-250 mg / L cephalosporin, 150-250 mg / L timentin, 30-70 mg / L kanamycin, and pH 5.5-6.

5.

8. The method according to any one of claims 4 to 7, characterized in that The method is selected from any one or a combination of the following situations E1, E2, E3, E4, E5 and E6; E1: The poplar leaves are young leaves of sterilized poplar tissue culture seedlings; E2: The target sequence of the gRNA is selected from the sequence shown in SEQ ID NO: 7; E3: The co-culture conditions are: culture in the dark for 1.5-2.5 days; E4: The callus induction culture conditions are: dark culture for 15-30 days; E5: The conditions of the differentiation culture are: the culture temperature is 20-28°C, the light intensity is 40-60 μmol·m -2 ·s -1 , the photoperiod is 14-18h light / 6-10h dark per day, and the cultivation time is 50-70 days; E6: The rooting culture conditions are: the culture temperature is 20-28°C, the light intensity is 40-60 μmol·m -2 ·s -1 The photoperiod is 14-18h light / 6-10h dark every day, and the cultivation time is 7-14 days.

9. A method for preparing a composite material, the steps of the method are as follows: T1: extracting wood fiber or bast fiber from a poplar plant obtained by the knockout method described in any one of 4 to 8 of the present invention; T2: reacting the wood fiber or the bast fiber with a first grafting agent to obtain grafted wood fiber or grafted bast fiber; T3: dissolving polylactic acid in the first solvent to obtain a polylactic acid solution; T4: mixing the dried grafted wood fiber or the dried grafted bast fiber with the polylactic acid solution to obtain a dispersion, and then drying the dispersion to obtain a composite material masterbatch containing wood fiber or a composite material masterbatch containing bast fiber; T5: mixing polylactic acid, polylactic acid grafted with a second grafting agent, and the composite material masterbatch containing wood fibers or the composite material masterbatch containing bast fibers, and performing melt blending to obtain the composite material; Whether the free end of the first grafting agent and the free end of the second grafting agent can undergo chemical reaction and bond.

10. The method according to claim 9, characterized in that Selected from any one or a combination of the following X1, X2 and X3; X1: the first grafting agent is KH560; X2: the first solvent is chloroform; X3: The second grafting agent is maleic anhydride.

11. The method according to claim 9, characterized in that Any one or a combination thereof selected from the following Y1, Y2, Y3, Y4 and Y5; Y1: In T2, the weight ratio of the wood fiber or the bast fiber to the first grafting agent is 100:1.5-2.0; Y2: In T3, the weight ratio of the first solvent to the polylactic acid is 100:5-15; Y3: In T4, the weight ratio of the dried grafted wood fiber or the dried grafted bast fiber to the polylactic acid in the polylactic acid solution is 30-50:100; Y4: In T5, when wood fiber is selected in T1, the weight ratio of the polylactic acid, the polylactic acid grafted by the second grafting agent and the composite material masterbatch containing wood fiber is: 6-12:0.2-0.4:1; When bast fiber is selected in T1, the weight ratio of the polylactic acid, the polylactic acid grafted by the second grafting agent and the composite material masterbatch containing bast fiber is: 20-30:0.6-1.0:1; Y5: In T5, the melt blending conditions are: temperature 160-200°C, rotation speed 30-50 rpm, time 5-16 min.

12. A composite material, wherein the composite material is prepared according to the preparation method according to any one of claims 9 to 11.

Images