Rice NIGT gene family and application thereof in improving iron deficiency tolerance of plants

Abstract

The invention discloses a rice NIGT gene family and application of the rice NIGT gene family in improving iron deficiency tolerance of plants. The gene sequence is shown as a sequence table SEQ ID No: 1-3, and the protein sequence is shown as a sequence table SEQ ID No: 4-6. It is identified for the first time that expression of the NIGT gene can obviously improve the iron deficiency tolerance of rice plants, mutation of the OsNIGT1 protein, the OsNIGT2 protein and the OsNIGT3 protein and combined mutation of the OsNIGT1 protein, the OsNIGT2 protein and the OsNIGT3 protein enable the iron deficiency symptom of rice leaves to be serious, and overexpression of the OsNIGT1 protein enables the iron deficiency symptom of the rice leaves to be relieved. The protein and the coding gene thereof have important theoretical and practical significance for improving iron deficiency symptoms of plants and crop yield, can play an important role in genetic breeding of crops, and have wide application prospects.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and in particular relates to a rice NIGT gene family and an application thereof in improving plant tolerance to iron deficiency. Background Art

[0002] Iron is an important trace element necessary for plant growth and development, and plays an important role in many physiological metabolic processes such as plant DNA and protein synthesis, photosynthesis and respiration, electron transfer and enzymatic reactions. At the same time, iron is also the trace element with the highest demand by the human body, and is involved in the synthesis of human hemoglobin and the transport of oxygen. Therefore, iron deficiency is one of the major nutritional deficiencies in the world, restricting the health of about 2 billion people in the world, leading to anemia, fatigue, fetal maldevelopment and cognitive impairment in children. Although there are many iron nutritional supplements, the high cost is difficult to afford for residents in poor and developing countries, and the "hidden hunger" caused by iron deficiency is still the main livelihood issue in these areas. Supplementing iron nutrition from daily diet is the most direct and economical solution. Rice is one of the three major food crops in the world, and more than 50% of the world's population uses rice as a staple food. Therefore, improving the adaptability of rice to iron deficiency provides a new way to solve the above problems.

[0003] Iron is usually found in soil as insoluble Fe 3+ Water-soluble and exchangeable Fe exists and can be absorbed and utilized by plants 2+ Fe is less, resulting in poor Fe availability in the soil and iron deficiency. To cope with iron deficiency stress, plants have evolved two sets of iron absorption strategies. Non-herbaceous plants use a reduction strategy: iron reductase FRO2 converts Fe 3+ Reduction to Fe 2+ The iron transporter IRT1 transfers Fe 2+ Transported into cells for absorption and utilization; Herbs use chelation strategy: Plant roots chelate Fe in the soil by secreting deoxyrhizic acid 3+ The YSL family of iron transporters chelates Fe 3+transported into the cell body. In addition, in dicots, iron deficiency activates the expression of the transcription factor FIT / AtbHLH29, which interacts with other transcription factors (including bHLHs and EIN3 / EIL1) to induce the expression of iron uptake genes FRO2 and IRT1. AtBTS / AtBTSL1 / AtBTSL2 and OsHRZ1 / OsHRZ2 are considered to be potential Fe sensors in Arabidopsis and rice. They contain a hemerythrin domain that can bind Fe in the N-terminal region and a RING domain in the C-terminal region, which helps E3 ubiquitin ligase activity to achieve ubiquitination, thereby regulating Fe homeostasis. IRONMAN (IMA) is a class of widely occurring small peptides with Asp repeats in the C-terminal region. Plants overexpressing IMA overaccumulate Fe and show enhanced tolerance to Fe deficiency. A large number of studies have shown that the iron nutrient homeostasis of rice is regulated by multiple genes, transcription factors, small peptides and protein modifications. This study discovered that a family of transcription factors, NIGT (NITRATE-INDUCIBLE GARP-TYPE TRANSCRIPTIONAL REPRESSOR), plays an important role in the regulation of plant iron deficiency, but related research has not been reported. Summary of the invention

[0004] The purpose of the present invention is to provide a rice NIGT gene family and an application thereof in improving plant iron deficiency tolerance.

[0005] The rice NIGT gene family includes OsNIGT1 gene, OsNIGT2 gene and OsNIGT3 gene, and its polynucleotide sequence is shown in (a), (b), (c) or (d):

[0006] (a) a polynucleotide as shown in SEQ ID No: 1-3; or

[0007] (b) a polynucleotide that can hybridize with the complementary sequence of SEQ ID No: 1-3 under stringent hybridization conditions, and the protein encoded by the polynucleotide still has the function of improving the iron deficiency tolerance of plants;

[0008] (c) a polynucleotide having at least 90% homology with the polynucleotide shown in SEQ ID No: 1-3; or

[0009] (d) A polynucleotide mutant obtained by deleting, substituting or inserting one or more bases based on the polynucleotide shown in SEQ ID No: 1-3, and the protein encoded by the polynucleotide mutant still has the function of improving the iron deficiency tolerance of plants.

[0010] The rice NIGT protein family includes OsNIGT1 protein, OsNIGT2 protein and OsNIGT3 protein, and its amino acid sequence is shown in (a), (b) or (c):

[0011] (a) the amino acid sequence shown in SEQ ID No: 4-6 in the sequence listing; or

[0012] (b) an amino acid having at least 90% homology with the amino acid shown in SEQ ID No: 4-6; or

[0013] (c) A protein mutant obtained by deleting, replacing or inserting one or more amino acids based on the protein shown in SEQ ID No: 4-6, and the protein still has the function of improving the iron deficiency tolerance of plants.

[0014] A vector containing the rice NIGT gene.

[0015] An engineered bacterium containing the rice NIGT gene vector.

[0016] Primers for amplifying any fragment of the rice NIGT gene.

[0017] Application of rice NIGT gene in improving plant iron deficiency tolerance.

[0018] A method for improving the tolerance of rice to iron deficiency, and increasing the expression level of NIGT protein in rice.

[0019] Beneficial effects of the present invention: The present invention identifies for the first time that NIGT gene expression can significantly improve the iron deficiency tolerance of rice plants, that mutations of OsNIGT1 protein, OsNIGT2 protein, OsNIGT3 protein and their combined mutations cause severe iron deficiency symptoms in rice leaves, and that overexpression of OsNIGT1 protein alleviates iron deficiency symptoms in rice leaves. The protein of the present invention and its encoding gene have important theoretical and practical significance for improving iron deficiency symptoms and crop yields in plants, and will play an important role in crop genetic breeding, with broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 To identify the members of rice OsNIGT gene family and analyze the conserved domains;

[0021] Figure A shows the evolution and conserved motif analysis of rice OsNIGT gene family; B shows the conserved domain analysis of rice OsNIGT gene family members; and C shows the expression pattern analysis of rice OsNIGT gene family members under different treatment conditions.

[0022] Figure 2 To identify transgenic plants of rice OsNIGT gene;

[0023] In the figure, A is the sequencing identification peak graph of rice osnigt1 gene-edited plants; B is the sequencing identification peak graph of rice osnigt2 gene-edited plants; C is the sequencing identification peak graph of rice osnigt3 gene-edited plants; D is the western blot identification of rice OsNIGT1-OE overexpressing plants.

[0024] Figure 3 For the analysis of rice OsNIGT1-OE and osnigt123-cas9 under different iron nutrient conditions;

[0025] In the figure, A is the phenotypic analysis of rice SSBM, OsNIGT1-OE and osnigt123-cas9 strains under different nutrient conditions; B is the SPAD value analysis of rice SSBM, OsNIGT1-OE and osnigt123-cas9 strains under different nutrient conditions. DETAILED DESCRIPTION

[0026] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0027] The experimental materials used in the following examples are: rice inbred line material: SSBM; strains: Escherichia coli strain DH5α, Agrobacterium strain EHA105; vectors: overexpression vector pPZP122-3xFLAG, gene editing vector pYLCRISPR-Cas9P35s.

[0028] Example 1 Identification and expression pattern analysis of rice OsNIGT gene family

[0029] Experimental methods: Arabidopsis thaliana ( http: / / www.arabidopsis.org ) was used as the reference sequence, and the rice genome was aligned using the local BLASTP of the Linux system with a screening threshold of 1e-5 to obtain the protein sequences of the candidate genes. http: / / smart.embl.de / smart / batch.pl ) and NCBI-CDD( https: / / www.ncbi.nlm.nih.gov / cdd / ) to verify the candidate sequences containing the MYB conserved domain. After removing the redundant sequences, the OsNIGT gene family member sequences of rice were obtained and named according to the location of the genes on the chromosome backbone. The NJ phylogenetic tree was constructed using MegaX, with a bootstrap parameter of 1000 and the remaining parameters as default. The online website MEME ( https: / / meme-suite.org / meme / tools / meme) Analysis of the motif arrangement distribution of OsNIGT protein. Rice RNA-Seq samples were processed as follows: After SSBM was cultured in normal nutrient solution for 7 days, it was continued to be cultured in normal nutrient solution, phosphorus-deficient nutrient solution, and iron-deficient nutrient solution for 14 days, and the fourth leaf of rice was taken to extract RNA and perform RNA-seq library sequencing. Three biological replicates were taken for each treatment, including three technical replicates.

[0030] The experimental results are shown in Figure 1 ,like Figure 1 A and Figure 1 As shown in B, five OsNIGT gene family members were identified in the rice genome, named OsNIGT1-OsNIGT5. Bioinformatics analysis found that they have similar conserved motifs and all contain MYB conserved domains. Expression pattern analysis based on transcriptome sequencing showed ( Figure 1 C), the rice OsNIGT gene family is strongly induced under phosphorus deficiency conditions, but its expression is inhibited under iron deficiency conditions, suggesting that the OsNIGT gene is an activator of the phosphorus deficiency response and an inhibitor of the iron deficiency response. It may play an important role in the phosphorus and iron deficiency responses of rice. The next step of this study will be to further explore its gene function.

[0031] Example 2 Preparation of rice OsNIGT1 overexpression and osnigt123 triple mutant transgenic plants

[0032] According to the full-length CDS sequence of OsNIGT1, primers 5'-ATGGAGGTGGACCACGCGGACCGCG-3' (SEQ ID No: 7) and 5'-CGCGGTCCGCGTGGTCCACCTCCAT-3' (SEQ ID No: 8) were designed using primer5.0 software. The full-length OsNIGT1 gene was cloned by RT-PCR and the 35S::pPZP122-3xFLAG-OsNIGT1 overexpression vector was constructed by Infusion method. Using "osnigt1-U6b-F:gttGCGCGCCGTCGCGGTCCGCG (SEQ ID No: 9)", "osnigt1-U6b-R:AAACCGCGGACCGCGACGGCGCG (SEQ ID No: 10)", "osnigt2-U6a-F:gccGGCGCTTAGCTTGCAGGCTC (SEQ ID No: 11)", "osnigt2-U6a-R:AAACGAGCCTGCAAGCTAAGCGC (SEQ ID No: 12)", "osnigt3-U3-F:ggcACATCTTGAGATCCAGGCTC (SEQ ID No: 13)", and "osnigt3-U3-R:AAACGAGCCTGGATCTCAAGATG (SEQ ID No: 14)" as target primers, a vector osnigt1 / 2 / 3-cas9 vector for simultaneous gene editing of three targets was constructed. After the above vectors were successfully constructed, they were transferred into EHA105α Agrobacterium competent cells and infected rice callus tissues. After tissue culture, successfully edited T0 transgenic plants were obtained. After further culture and harvesting seeds, homozygous vector-free osnigt123 triple mutants were obtained in T1 rice plants.

[0033] The experimental results are as follows Figure 2 As shown. After gene cloning, vector construction, genetic transformation and tissue culture, the T1 generation rice transgenic plants were obtained. PCR identification and sequencing revealed that the OsNIGT1 gene had mutated and lost 1bp, resulting in a frameshift mutation ( Figure 2 A); PCR identification and sequencing revealed that the OsNIG2 gene was missing 2 bp, resulting in a frameshift mutation ( Figure 2 A), PCR identification and sequencing revealed that OsNIG3 had a base substitution, resulting in gene mutation ( Figure 2 A). Figure 2B analysis showed that after western blot test, the target gene band could be detected using anti-flag antibody, indicating that the constructed overexpression vector had been transformed into the plant body and OsNIGT1-OE overexpression plants were obtained. The transgenic plant materials obtained in the above experiments provide materials for further experimental research.

[0034] Example 3 Application of Rice OsNIGT Gene Family in Improving Plant Iron Deficiency Tolerance

[0035] SSBM, OsNIGT1-OE and osnigt123-cas9 rice seeds were directly germinated in normal rice nutrient solution, phosphorus-deficient rice nutrient solution, iron-deficient rice nutrient solution and phosphorus-deficient and iron-deficient rice nutrient solution. After seven days of treatment, photos were taken to record the phenotypes and the SPAD values ​​of rice leaves were measured.

[0036] The experimental results are shown in Figure 3 .like Figure 3 As shown in A, under normal culture conditions and iron deficiency conditions, the rice leaves of SSBM, OsNIGT1-OE and osnigt123-cas9 strains showed no difference and were all green. Under iron deficiency conditions, the rice leaves of all strains showed yellowing symptoms of deficiency, but it can be observed that the iron deficiency symptoms of OsNIGT1-OE overexpressing plants under iron deficiency conditions were relatively weak, and the leaves could remain light green, while the iron deficiency symptoms of osnigt123-cas9 rice leaves were more serious, and the SPAD value was significantly lower than that of SSBM strains under iron deficiency conditions ( Figure 3 B) The above results indicate that OsNIGT is a positive regulator of iron deficiency in rice. Overexpression of OsNIGT can improve the iron deficiency tolerance of rice plants, while mutation of OsNIGT leads to decreased tolerance of rice plants to iron deficiency.

[0037] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Rice NIGT gene family, characterized in that: It includes OsNIGT1 gene, OsNIGT2 gene and OsNIGT3 gene, and its polynucleotide sequence is shown in (a), (b), (c) or (d): (a) a polynucleotide as shown in SEQ ID No: 1-3; or (b) a polynucleotide that can hybridize with the complementary sequence of SEQ ID No: 1-3 under stringent hybridization conditions, and the protein encoded by the polynucleotide still has the function of improving the iron deficiency tolerance of plants; (c) a polynucleotide having at least 90% homology with the polynucleotide shown in SEQ ID No: 1-3; or (d) A polynucleotide mutant obtained by deleting, substituting or inserting one or more bases based on the polynucleotide shown in SEQ ID No: 1-3, and the protein encoded by the polynucleotide mutant still has the function of improving the iron deficiency tolerance of plants.

2. Rice NIGT protein family, characterized in that: It includes OsNIGT1 protein, OsNIGT2 protein and OsNIGT3 protein, and its amino acid sequence is shown in (a), (b) or (c): (a) the amino acid sequence shown in SEQ ID No: 4-6 in the sequence listing; or (b) an amino acid having at least 90% homology with the amino acid shown in SEQ ID No: 4-6; or (c) A protein mutant obtained by deleting, replacing or inserting one or more amino acids based on the protein shown in SEQ ID No: 4-6, and the protein still has the function of improving the iron deficiency tolerance of plants.

3. A vector containing the rice NIGT gene according to claim 1.

4. An engineered bacterium containing the rice NIGT gene vector according to claim 3.

5. Primers for amplifying any fragment of the rice NIGT gene according to claim 1.

6. Use of the rice NIGT gene according to claim 1 in improving plant tolerance to iron deficiency.

7. A method for improving the tolerance of rice to iron deficiency, characterized in that: Increase the expression level of NIGT protein in rice.

Images