Application of human ST gene in plant immune disease resistance

Abstract

The invention provides application of a human ST gene in plant immune disease resistance, and belongs to the technical field of plant protection. According to the invention, a proton channel protein ST is introduced into a plant from human, and the protein is started by different phytopathogen inducible promoters or strong promoters, so that the protein becomes a specific broad-spectrum resistance gene aiming at various pathogenic bacteria. According to the invention, ST is combined with different promoters and expressed in a plant to form a transgenic plant, and the transgenic plant has a specific broad-spectrum disease-resistant effect. The ST gene disclosed by the invention can be transformed by selecting different promoters according to different pathogenic bacteria of different crops, is flexible and changeable, is suitable for multiple crops, and achieves a specific broad-spectrum disease-resistant effect by transforming the sequence of the ST promoter.

Description

Technical Field

[0001] The present invention belongs to the field of plant protection technology, and specifically relates to human ST The application of genes in plant immunity and disease resistance. Background Art

[0002] There are two types of disease-resistant bodies in plant cells. One type binds to specific effectors to form polymers, opens holes in the cell membrane, triggers calcium ion flow, and causes plant disease resistance. After the other effector binds, it needs the help of helper genes to polymerize and open holes in the cell membrane, triggering calcium ion flow and causing plant disease resistance. However, there are still great inconveniences in the transformation and design of plant disease-resistant bodies, and they are often unsatisfactory in the face of attacks by fungi, bacteria, viruses and other diseases. At the same time, cloning and discovering more disease-resistant bodies from plants requires a lot of manpower, material resources and financial resources.

[0003] ST It is involved in immunity against fungi, bacteria, and viruses in animal cells, but there has been no research on its role in plants. Summary of the invention

[0004] The present invention provides human ST The application of genes in plant immunity and disease resistance can achieve cross-species disease resistance, which is more flexible and ST It becomes a specific broad-spectrum resistance gene against a variety of pathogens.

[0005] The present invention provides a target plant broad-spectrum disease resistance gene, comprising a promoter and a target plant codon optimized promoter connected in sequence. ST Gene, the ST NCBI Sequence ID of the gene: 340061).

[0006] Preferably, the promoter includes a plant pathogen-inducible promoter and a strong promoter.

[0007] Preferably, when the target plant is tobacco or rice, the codon-optimized ST The nucleotide sequences of the genes are shown in SEQ ID No.1.

[0008] The present invention also provides a primer pair for amplifying the above-mentioned target plant broad-spectrum disease-resistant gene, comprising an upstream primer with a nucleotide sequence as shown in SEQ ID No.2 and a downstream primer as shown in SEQ ID No.3.

[0009] The present invention also provides a recombinant vector comprising the above target plant broad-spectrum disease-resistant gene.

[0010] The present invention also provides the use of the above-mentioned broad-spectrum disease resistance gene of the target plant or the above-mentioned recombinant vector in improving the broad-spectrum disease resistance of the target plant.

[0011] Preferably, the broad-spectrum disease resistance includes resistance to oomycete diseases and resistance to fungal diseases.

[0012] The present invention also provides a method for improving the broad-spectrum disease resistance of plants, comprising: ST The gene was codon optimized. ST The gene is inserted into an expression vector, and the recombinant vector is used to transform the plant to obtain a plant with improved broad-spectrum disease resistance; Said ST NCBI Sequence ID of the gene: 340061; The expression vector contains a plant pathogen-inducible promoter or a strong promoter.

[0013] Preferably, the recombinant vector is transformed into the target plant using Agrobacterium-mediated genetic transformation method.

[0014] The present invention also provides the use of the above-mentioned target plant broad-spectrum disease-resistant gene or the above-mentioned recombinant vector or the above-mentioned method in constructing disease-resistant plant germplasm.

[0015] Beneficial effects: The present invention introduces the proton channel protein ST from humans into plants, and activates this protein by different plant pathogen-inducible promoters or strong promoters, making it a specific broad-spectrum resistance gene against multiple pathogens.

[0016] The present invention will ST Transient expression was performed in tobacco leaves to verify whether it induced an immune response in plants; ST The results showed that after transformation, proton channel proteins that did not exist in the plant itself could be introduced. Different from the traditional theory of plant disease resistance body activation disease resistance, the present invention introduces a new strategy for plant disease resistance. At the same time, the present invention also confirms that only the transformation of ST This gene can produce disease resistance to a variety of pathogens, reducing the cost of genetic modification. ST Genes can be transformed by selecting different promoters according to different crops and different pathogens. It is flexible and applicable to multiple crops. ST The promoter sequence achieves a specific broad-spectrum disease resistance effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1This is the result of human ST protein having plant disease resistance protein. In the figure, a indicates that transient expression of ST induces cell death. Photos were taken under white light (upper) and ultraviolet light (middle) 24 hours after inoculation. DAB (lower) was used to stain ROS in tobacco leaves with 3,3-diaminobenzidine (DAB). The rice bacterial blight resistance gene Xa23 was used as a positive control, and the empty vector (EV) was used as a negative control. The scale bar is 1 cm; b: ST immunoblot analysis, using ST-specific antibodies to indicate protein expression, and the loading of each sample was indicated by Ponceau S staining of ribulose-1,5-bisphosphate carboxylase / oxygenase (RBC); c: ROS production in plants transiently expressing ST and EV was measured by chitin and water (mock) treatment, RLU: relative light unit; d: (c) Total photon counts of the sample shown; e: ST induced the expression of defense-related genes; f: The expression of ST in N. benthamiana can be seen through the leakage of electrolyte; g: ST confers resistance to Phytophthora capsici in N. benthamiana, the photo was taken 48 h after inoculation, the scale bar is 1 cm; h: Lesion area of ​​the sample shown in (g); i: Relative pathogen biomass of the sample shown in (g); j: ST confers resistance to the bacterial pathogen Pseudomonas syringae, the photo was taken 4 days after inoculation, the scale bar is 1 cm; k: Luciferase intensity of the sample shown in (j); l: Bacterial proliferation of diseased leaves of the sample shown in (j); All data are mean ± SD; N is the number of biological independent samples in the figure, * indicates significant difference by unpaired Student's t test (*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001), and statistical significance indicated by different letters was calculated using Duncan's multiple test; Figure 2 The results of the detection of pepper phytophthora lesions in mST, in the figure a: N. benthamiana strains mST#6 and mST#15 are resistant to pepper phytophthora, photographed 48 hours after infection, scale bar is 1 cm; b, c: lesion area and relative pathogen biomass of the strains in (a); d: N. benthamiana strains mST#6 and mST#15 show resistance to GFP-labeled TuMV virus, photographed 8 days after infection, scale bar is 1 cm; e, f: RT-qPCR detection of TuMV-CP and TuMV-GFP in the samples shown in (a), for immunoblot analysis of TuMV-GFP antibody, data are mean ± SD; N is the number of biological independent samples in the figure, and the statistical significance represented by different letters was calculated using Duncan's multiple test; Figure 3The results of the lesion detection of rice blast and Xanthoceras in RST are shown in Figure a: immunoblot analysis of ST-HA fusion protein in rice, with wild-type rice WT as the control, immunoblot analysis of two strains RST#1 and RST#2, identified by Ponceau red staining of plant actin and ribulose-1,5-bisphosphate carboxylase / oxygenase (RBC); b: the disease results of RST and WT strains inoculated with rice blast pathogen taken 14 days after inoculation; c: the lesion area and relative fungal biomass of the strain in (b); d: the disease results of RST and WT strains inoculated with Xanthoceras oryzae taken 14 days after inoculation; e, f: the lesion length and relative fungal biomass of the strain in (d); Figure 4 This is the plasmid map of the pRHE vector. DETAILED DESCRIPTION

[0018] The present invention provides a target plant broad-spectrum disease resistance gene, comprising a promoter and a target plant codon optimized promoter connected in sequence. ST Gene, the ST NCBI Sequence ID of the gene: 340061.

[0019] The promoters of the present invention include plant pathogen-inducible promoters and strong promoters MAS, such as the strong promoter MAS (CP026926.1) used in tobacco and the pathogen-inducible promoter PR10a (LOC_Os12g36880) used in other plants.

[0020] In the present invention, due to ST The gene is of human origin. When it is applied to plant disease resistance, codon optimization needs to be performed according to the codon preferences of different plants. The present invention does not specifically limit the method of codon optimization. An online codon optimization tool (https: / / www.novopro.cn / tools / codon-optimization.html) can be used to optimize the ST protein according to the codon preferences of plants. For example, in the embodiment of the present invention, when the target plants are tobacco and rice, the codon optimized ST The nucleotide sequences of the genes are shown in SEQ ID No. 1:

[0021] The present invention also provides a primer pair for amplifying the above-mentioned target plant broad-spectrum disease-resistant gene, comprising an upstream primer with a nucleotide sequence as shown in SEQ ID No.2 and a downstream primer as shown in SEQ ID No.3.

[0022] The primer sequences used in the present invention are preferably as follows: p1300-ST-F (SEQ ID No. 2): 5'CCAAATCGACTCTAGAAATGCCGCACTCTAGCCT3'; p1300-ST-R (SEQ ID No. 3): 5'TTGCTCACCATGGTCTCTGAGAAGTCTGTGCGAAGT3'.

[0023] In the embodiment of the present invention, preferably the synthetic ST The fragments were used as templates for PCR amplification, and the reaction conditions were preferably: pre-denaturation at 95°C for 5 min; 95°C for 30 sec, 58°C for 30 sec, 72°C for 30 sec, 28 cycles; and extension at 72°C for 5 min.

[0024] The present invention also provides a recombinant vector comprising the above target plant broad-spectrum disease-resistant gene.

[0025] The present invention preferably uses enzyme digestion to insert the amplified fragment into an expression vector to construct the recombinant vector. In the embodiment, the pCAMBIA1300 vector is preferably digested with HindIII, and the digestion product and the corresponding fusion fragment are connected to construct a tobacco expression vector, which is then transformed into Escherichia coli DH5α to obtain a vector containing ST protein, and finally transformed into Nicotiana benthamiana; ST The fragments were connected to the PR10a construct into the pRHE vector ( Figure 4 ) and then transformed into rice.

[0026] The present invention also provides the use of the above-mentioned broad-spectrum disease resistance gene of the target plant or the above-mentioned recombinant vector in improving the broad-spectrum disease resistance of the target plant.

[0027] The broad-spectrum disease resistance of the present invention preferably includes resistance to oomycete diseases and resistance to fungal diseases, and is mainly based on triggering plant immunity to achieve a broad-spectrum antibacterial effect.

[0028] The present invention also provides a method for improving the broad-spectrum disease resistance of plants, comprising: ST The gene was codon optimized. ST The gene is inserted into an expression vector, and the recombinant vector is used to transform the plant to obtain a plant with improved broad-spectrum disease resistance; Said ST Gene (ID: 340061); The expression vector contains a plant pathogen-inducible promoter or a strong promoter. In the embodiment of the present invention, all vectors are synthesized by the company, wherein tobacco is driven by the MAS promoter and rice is driven by the PR10a promoter.

[0029] The present invention preferably includes using Agrobacterium-mediated genetic transformation methods to transform the recombinant vector into target plants.

[0030] The present invention also provides the use of the above-mentioned target plant broad-spectrum disease-resistant gene or the above-mentioned recombinant vector or the above-mentioned method in constructing disease-resistant plant germplasm.

[0031] In order to further illustrate the present invention, the following embodiments are combined with the human ST The application of genes in plant immunity and disease resistance is described in detail, but they should not be understood as limiting the scope of protection of the present invention.

[0032] Example 1 ST induces tobacco cell death and has plant disease resistance gene immunity characteristics S1. Vector construction: Amplification ST , and constructed into the pCAMBIA1300 vector through homologous recombination.

[0033] Amplification ST Segment: Primer pairing is: p1300-ST-F and p1300-ST-R, to synthesize ST The fragment was used as a template for PCR amplification. The reaction conditions were: 95°C pre-denaturation for 5 min; 95°C 30 sec, 58°C 30 sec, 72°C 30 sec, 28 cycles; 72°C extension for 5 min.

[0034] Homologous recombination connection: The pCAMBIA1300 vector was digested with HindIII, and the digestion product and the corresponding fusion fragment were connected to construct a tobacco expression vector, which was then transformed into Escherichia coli DH5α to obtain a vector containing the ST protein.

[0035] S2. Immune signature analysis: (1) Transient expression of ST in Nicotiana benthamiana to induce plant hypersensitivity (HR) response: This experiment was divided into 3 groups, pCAMBIAsuper1300 empty vector (EV) and positive control Xa23 (GenBank: AIX09985.1) that induces HR response. STand Xa23 were constructed into pCAMBIAsuper1300 vector and transformed into Agrobacterium GV3101. After 16 h of shaking culture, the bacteria were resuspended in infection solution (10 mM MgCl2, 10 mM MES and 150 μM acetosyringone) and the OD of each component was adjusted. 600 ST, empty vector negative control (EV) and positive control Xa23 were injected into four-week-old Nicotiana benthamiana leaves. 24 hours after injection, the tobacco leaves were observed and photographed.

[0036] The results are as follows Figure 1 As shown in a, ST It can induce HR response in tobacco cells like the positive control Xa23, while the empty vector (EV) remains the same and does not induce HR response in tobacco cells.

[0037] (2) ST Induced reactive oxygen species (ROS) burst in Nicotiana benthamiana - DAB staining: As described in (1), ST, empty vector negative control (EV) and positive control Xa23 were injected into four-week-old Nicotiana benthamiana leaves. 15 h after injection, the injected tobacco leaves were immersed in 20 ml of DAB staining solution, incubated horizontally in the dark for 8 h, then placed in 95% ethanol for decolorization, incubated horizontally for 48 h, and photographed under white light.

[0038] The results are as follows Figure 1 As shown in a, both ST and the positive control Xa23 can stain the ROS burst, while the control group empty vector (EV) has no such phenomenon. This shows that ST expression in tobacco cells can induce ROS burst like the positive control Xa23.

[0039] (3) ST-induced ROS burst in Nicotiana benthamiana - ROS assay: The experiment was divided into eight groups, namely ST / chitin group, EV / chitin group, ST / mock group, and EV / mock group. The ST / chitin group was induced with a mixed solution containing chitin that stimulates plant cellular immunity to induce Nicotiana benthamiana leaves containing ST Agrobacterium; the EV / chitin group was induced with a mixed solution containing chitin that stimulates plant cellular immunity to induce Nicotiana benthamiana leaves containing empty vector EV Agrobacterium; the ST / mock group was treated with distilled water to treat Nicotiana benthamiana leaves containing ST Agrobacterium; the EV / mock group was treated with distilled water to treat Nicotiana benthamiana leaves containing empty vector EV Agrobacterium. Each sample group had at least eight biological replicates.

[0040] Chitin treatment system (100 μL): dd H2O 98.25 μL, 6 Mm chitin 0.5 μL, 4 Mm Lo-12 1.25 μL, and 1 mg / ml HRP 1 μL; Mock treatment system (100 μL): dd H2O 98.75 μL, 4 Mm Lo-12 1.25 μL, and 1 mg / ml HRP 1 μL; Agrobacterium containing expression plasmids of ST and empty vector EV was injected into 4-week-old Nicotiana benthamiana leaves, and Agrobacterium containing empty vector expression plasmid was used as EV control. After 7 hours, 3 mm × 3 mm Nicotiana benthamiana leaf discs were collected and immersed in distilled water overnight in a 96-well plate. The distilled water was discarded, and 100 μL of mixed solution (50 μM luminol (Wako), 10 μg / mL horseradish peroxidase and 6 mM chitin (GLPBIO)) was added to each well. 100 μL of distilled water was added to each well of the ST / mock group and EV / mock group as a control. Chemiluminescence was measured at 500 ms intervals for 60 minutes in a SPARK-10M microplate reader (TECAN).

[0041] The results are as follows Figure 1 As shown in b, after induction with chitin, expression was found ST The reactive oxygen species in tobacco with the gene increased dramatically, significantly higher than those without the gene ST Genetic material, indicating ST Expression can induce the production of reactive oxygen species, and the total amount of reactive oxygen species is much higher than that of the control group.

[0042] (4) Detection of disease resistance-related genes: Experimental method: The experiment was divided into four groups, namely, Agrobacterium injected with ST expression plasmid in Nicotiana benthamiana as the experimental group and Agrobacterium injected with empty vector expression plasmid in Nicotiana benthamiana as the EV control. Each sample was subjected to at least three biological replicates.

[0043] RNA extraction and reverse transcription quantitative PCR analysis: Tobacco leaves containing ST and control EV were collected 15 h after Agrobacterium injection and quickly frozen in liquid nitrogen. They were ground in liquid nitrogen for RNA extraction. Total RNA was extracted from the samples using RNAprep Pure PlantKit (TianGen Biotech; China). RNA was purified from total RNA using DNase I (Thermo Scientific). Complementary DNA (cDNA) was synthesized using HiScript II First Strand cDNA Synthesis Kit (Vazyme). qRT-PCR was performed on a Bio-Rad CFX96 Real-Time System with a C1000 Thermal Cycler (Bio-Rad) using SYBR Green Mix (Vazyme). -ΔΔCT The method was used to calculate the expression levels of genes, with NbEF1a as the internal reference gene.

[0044] qRT-NbEF1a-F (SEQ ID No. 4): AGAGGCCCTCAGACAAAC; qRT-NbEF1a-R (SEQ ID No. 5): TAGGTCCAAAGGTCACAA; qRT-NbPR4-F (SEQ ID No. 6): GGCCAAGATTCCTGTGGTAGAT; qRT-NbPR4-R (SEQ ID No. 7): CACTGTTGTTGAGTTCCTGTTCCT; qRT-NbPR1b-F (SEQ ID No. 8): GTGGACACTATACTCAGGTG; qRT-NbPR1b-R (SEQ ID No. 9): TCCAACTTGGAATCAAAGGG; qRT-NbPR2b-F (SEQ ID No. 10): AGGTGTTTGCTATGGAATGC; qRT-NbPR2b-R (SEQ ID No. 11):CTGTACCCACCATTCTGC; LOX-F (SEQ ID No. 12):AAAACCTATGCCTCAAGAAC; LOX-R(SEQ ID No.13):ACTGCTGCATAGGCTTTGG; The results are as follows Figure 1 As shown in Figure c, the expression levels of disease resistance genes such as PR1b, PR2b, PR4 and LOX in tobacco samples injected with ST were significantly increased, significantly higher than those in the control group, indicating that the expression of ST activated the expression of plant disease resistance genes and proved that the ST gene has the immune characteristics of plant R genes.

[0045] Depend on Figure 1 It can be seen that human ST protein has the basic characteristics of plant disease resistance protein.

[0046] Pseudomonas syringae DC3000 ΔhopQ1:LUC (hoPQ gene NCBIReference Sequence: NZ_AP026446.1 was knocked out so that it could infect tobacco and carry the LUC gene) was cultured in LB medium (10 g tryptone, 5 g yeast extract and 10 g NaCl dissolvedin 1 L of water), and placed in a 28°C shaker at 150 rpm overnight. Instantly transformed tobacco was used as the experimental group, and EV tobacco was used as the control group. At 3 days after inoculation (dpi), photos were taken and counted under an imager. At the same time, the number of colonies in the lesion area of ​​the inoculated tobacco leaves was extracted, and the biomass of the pathogen was determined by counting. At least three biological replicates were performed for each group.

[0047] The results are as follows Figure 1 As shown in a and b, the LUC fluorescence in ST was significantly lower than that in the control group. Figure 1 The results in Figure c showed that the colony count of DC3000ΔhopQ1:LUC was also significantly lower than that of the control group. In summary, mST transgenic tobacco has significant resistance to DC3000.

[0048] Tumv (carrying the GFP gene) was cultured in LB medium (10 g peptone, 5 g yeast extract, 10 g NaCl mixed in 1 L water) and placed in a 28°C shaker at 150 rpm overnight. Transgenic tobacco was used as the experimental group and WT tobacco was used as the control group. 3 days after inoculation (dpi), photos were taken and counted under an imager. At the same time, the number of colonies in the lesion area of ​​the inoculated tobacco leaves was extracted, and the biomass of the pathogen was determined by counting. At least three biological replicates were performed for each group.

[0049] The results are as follows Figure 1 As shown in a and b, the LUC fluorescence in ST was significantly lower than that in the control group. Figure 1 The results in Figure c showed that the colony count of DC3000ΔhopQ1:LUC was also significantly lower than that of the control group. In summary, mST transgenic tobacco has significant resistance to DC3000.

[0050] qRT-TuMV-CP-F (SEQ ID No. 14): CACGCCGGAGCAGACGGATC; qRT-TuMV-CP-R (SEQ ID No. 15): CTGATCGTCGCCGTCCATCATC; qRT-TuMV-GFP-F (SEQ ID No. 16): gaagcggcacgacttcttcaagag; qRT-TuMV-GFP-R (SEQ ID No. 17): gccgaggatgtttccgtcctcc; qRT-NbEF1a-F (SEQ ID No. 18): AGAGGCCCTCAGACAAAC; qRT-NbEF1a-R (SEQ ID No. 19): TAGGTCCAAAGGTCACAA.

[0051] Example 2 Analysis of resistance of mST transgenic tobacco to pepper phytopathogenes Preparation of S1 and mST transgenic tobacco materials Transgenic Nicotiana benthamiana was prepared using the ST vector constructed into the pCAMBIA1300 vector in Example 1.

[0052] The transgenic method is as follows: (1) Agrobacterium infection of tobacco: Cut Nicotiana benthamiana leaves into 2 cm pieces. 2 The leaves were cultured on a co-culture medium (MS medium + NAA 0.1 mg / L + 6-BA 1.5 mg / L), and the cut leaves were placed in an Agrobacterium solution containing an artificially designed plant disease resistance protein carrier designed in Example 1 with an OD value of 0.4-0.6 and immersed for 10 minutes. The bacterial solution was then poured out and the leaves were transferred to a sterile filter paper, the bacterial solution was discarded and dried.

[0053] (2) Differentiation and screening of transgenic tobacco: Leaves that have been co-cultured for 3 days were transferred to the culture medium. The culture was carried out under light conditions at 25°C. After culturing for two to three weeks, the tobacco sprouts that grew out were cut off and transferred to the seedling medium (MS + 0.1 mg / L 6-BA + 0.01 mg / L NAA + 30 mg / L hygromycin) for cultivation.

[0054] (3) Rooting of transgenic tobacco: Tobacco seedlings with roots were selected and transferred to rooting medium (MS + 30 mg / L hygromycin) for culture and testing.

[0055] (4) Extract genomic DNA samples using the CTAB method.

[0056] (5) PCR identification of transgenic plants: PCR detection was performed using specific primers, and the target fragment size obtained was 840 bp. The PCR product was sequenced by Sanger sequencing to identify the editing sites of positive transgenic plants, and MASpro-ST transgenic tobacco was obtained and named mST.

[0057] The PCR detection primers are as follows: SeqST-F (SEQ ID No. 20):ATGCCGCAATTGCTC; SeqST-R (SEQ ID No. 21):GACGCCTTCGTCTGCC.

[0058] After culturing the mST transgenic tobacco obtained above for one month, disease resistance immunity test was performed.

[0059] Capsicum was activated on PDA plates and cultured at 25°C for 3 days. Two young leaves of mST transgenic tobacco and wild-type tobacco (WT) that had been cultured for one month were inoculated with bacterial cakes punched with a 3mm puncher. Transgenic tobacco was used as the experimental group, and WT tobacco was used as the control group. At 36 h post-inoculation (hpi), photos were taken and counted under ultraviolet (UV) light. At the same time, DNA was extracted from the lesion area of ​​the inoculated tobacco leaves, and qPCR was performed to determine the biomass of the pathogen. In short, the lesion area of ​​the inoculated tobacco leaves was quickly placed in liquid nitrogen for freezing. Liquid nitrogen was ground and used for DNA extraction. Total DNA was extracted from the samples using CTAB. qRT-PCR was performed using SYBRGreen mixture (Vazyme) on a Bio-Rad CFX96 Real-Time System with a C1000 Thermal Cycler (Bio-Rad). 2 -ΔΔCT The method was used to calculate the expression levels of genes. At least three biological replicates were performed for each group.

[0060] The results are as follows Figure 2 As shown in a and d, the size of pepper lesions in mST was significantly smaller than that in the control group. Figure 2 The results in middle c showed that the biomass of pepper phytophthora pathogen was also significantly lower than that of the control group. In summary, mST transgenic tobacco has significant resistance to pepper phytophthora.

[0061] Activate TumV in LB medium, culture it at 25°C for 3 days, and adjust its concentration to 5*10 -4 Two young leaves above the mST transgenic tobacco and wild-type tobacco (WT). Transgenic tobacco served as the experimental group and WT tobacco served as the control group. At 7 days post inoculation (dpi), photos were taken and counted under ultraviolet (UV) light. At the same time, RNA was extracted from the infected tobacco leaf area, and qPCR was performed to determine the viral biomass. In brief, the infected area of ​​the inoculated tobacco leaves was quickly frozen in liquid nitrogen. The leaves were ground in liquid nitrogen for RNA extraction. Total DNA was extracted from the samples using an RNA extraction kit (Vazyme). qRT-PCR was performed using SYBR Green mixed solution (Vazyme) on a Bio-Rad CFX96 Real-Time System with a C1000 Thermal Cycler (Bio-Rad). 2 -ΔΔCT The method was used to calculate the expression levels of genes. At least three biological replicates were performed for each group.

[0062] The results are as follows Figure 2 As shown in a, b and c, the size of GFP infected in mST was significantly lower than that in the control group. Figure 2 The results in middle c show that mST transgenic tobacco has significant resistance to the virus Tumv.

[0063] qRT-TuMV-CP-F (SEQ ID No. 22): CACGCCGGAGCAGACGGATC; qRT-TuMV-CP-R (SEQ ID No. 23): CTGATCGTCGCCGTCCATCATC; qRT-TuMV-GFP-F (SEQ ID No. 24): gaagcggcacgacttcttcaagag; qRT-TuMV-GFP-R (SEQ ID No. 25): gccgaggatgtttccgtcctcc; qRT-NbEF1a-F (SEQ ID No. 26): AGAGGCCCTCAGACAAAC; qRT-NbEF1a-R (SEQ ID No. 27): TAGGTCCAAAGGTCACAA.

[0064] Example 3 Analysis of resistance of RST transgenic rice to rice blast fungus The rice transformed by connecting the PR10a promoter constructed in Example 1 to the pRHE vector was used.

[0065] The transgenic method is as follows: (1) Seed disinfection: Soak peeled rice seeds in 75% ethanol for 1 minute, then treat them twice with 2.5% sodium hypochlorite for 15 minutes each time, and finally rinse them with sterile ddH2O 3 to 5 times.

[0066] Induction and subculture of callus: Sterilized mature seeds were cultured in (MS medium + NAA 0.1mg / L + 6-BA 1.5mg / L) at 28℃ in the dark for 25-28 days to induce callus. After the callus grew to a suitable size, smooth, light yellow, hard embryonic callus was selected and evenly spread on the subculture callus medium (macroelements (20×) 50 mL, trace elements (200×) 5 mL, iron salts (200×) 5 mL, organic matter (200×) 5 mL, Sucrose 30.0 g, pH adjusted to 5.8), and cultured for 7-8 days.

[0067] (2) Agrobacterium-mediated rice callus transformation and co-culture: After Agrobacterium is activated, it is co-cultured with callus tissue to increase the OD of Agrobacterium to600 The co-cultured callus was first washed three times with sterile water, then soaked in sterile water containing 500 mg / L cephalosporin for 30 minutes, then dried with filter paper and spread on the selective medium (MS + 0.1 mg / L 6-BA + 0.01 mg / L NAA + 30 mg / L hygromycin).

[0068] (3) Selection and culture of transformed callus tissue: After co-culture, the callus was first washed three times with sterile water, then immersed in sterile water containing 500 mg / L cephalosporin for 30 minutes, then dried with filter paper, and evenly spread on the selection medium (MS + 0.1 mg / L 6-BA + 0.01 mg / L NAA + 30 mg / L hygromycin), and cultured in the dark at 28°C for 10 days. After that, a second screening was carried out to select the light yellow callus with good growth status and continue to culture.

[0069] (4) Callus differentiation culture: Select yellow, round callus and evenly spread it on the pre-differentiation medium (MS + 30 mg / L hygromycin), and culture it in the dark at 28°C for 7 days. Then select the embryonic callus with good growth and light yellow color, place it on the differentiation medium (MS + 30 mg / L hygromycin), and culture it in the light at 28°C for about 30 to 60 days until the transgenic seedlings grow out.

[0070] (5) Extract genomic DNA samples using the CTAB method.

[0071] (6) PCR identification of transgenic plants: PCR detection was performed using specific primers, and the target fragment size obtained was 840 bp. The PCR product was sequenced by Sanger sequencing to identify the editing sites of positive transgenic plants, and PR10pro-ST transgenic rice was obtained and named RST.

[0072] The PCR detection primers are as follows: SeqST-F (SEQ ID No. 20):ATGCCGCAATTGCTC; SeqST-R (SEQ ID No. 21):GACGCCTTCGTCTGCC.

[0073] After culturing the RST transgenic rice obtained above for one month, a disease resistance immunity test was conducted.

[0074] The rice blast fungus was activated on OTA (150 mL tomato juice, 40 g oatmeal, 0.6 g CaCO3, 15 g agarose mixed in 1 L water) plates, which were placed at 25°C for 7-10 days. The fungus cakes were punched with a 3 mm hole puncher and inoculated into the leaves of RST transgenic rice and wild-type rice (WT) that had been cultured for one month. The transgenic rice was used as the experimental group, and the WT rice was used as the control group. Photos were taken and counted 14 days after inoculation (dpi).

[0075] The bacterial blight was activated on NB plates and cultured at 25℃ for 2-3 days. The leaves were re-cut with sterile water and inoculated into the leaves of RST transgenic rice and wild-type rice (WT) at the heading stage. The transgenic rice was used as the experimental group and the WT rice as the control group. Photos were taken and counted 14 days after inoculation (dpi).

[0076] RST has a lesion-like phenotype. Figure 3 As shown in the figure, the size of rice blast lesions in RST was significantly lower than that in the control group. In conclusion, RST transgenic rice has significant resistance to rice blast.

[0077] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A broad-spectrum disease resistance gene for a target plant, characterized in that: The invention comprises a promoter and an ST gene which is optimized by target plant codons and connected in sequence, wherein the NCBI Sequence ID of the ST gene is 340061.

2. The target plant broad-spectrum disease resistance gene according to claim 1, characterized in that: The promoter includes a plant pathogen-inducible promoter and a strong promoter.

3. The target plant broad-spectrum disease resistance gene according to claim 1, characterized in that: When the target plants are tobacco and rice, the nucleotide sequences of the ST genes after codon optimization are all shown in SEQ ID No.

1.

4. A primer pair for amplifying the target plant broad-spectrum disease resistance gene according to any one of claims 1 to 3, characterized in that: It includes an upstream primer with a nucleotide sequence as shown in SEQ ID No.2 and a downstream primer as shown in SEQ ID No.

3.

5. A recombinant vector comprising the target plant broad-spectrum disease resistance gene according to any one of claims 1 to 3.

6. Use of the target plant broad-spectrum disease resistance gene according to any one of claims 1 to 3 or the recombinant vector according to claim 5 in improving the broad-spectrum disease resistance of the target plant.

7. The use according to claim 6, characterized in that: The broad-spectrum disease resistance includes resistance to oomycete diseases and resistance to fungal diseases.

8. A method for improving the broad-spectrum disease resistance of plants, characterized in that: The method comprises codon-optimizing the ST gene according to the codon preference of the plant, inserting the codon-optimized ST gene into an expression vector, and transforming the plant using the recombinant vector to obtain a plant with improved broad-spectrum disease resistance; NCBI Sequence ID of the ST gene: 340061 ； The expression vector contains a plant pathogen-inducible promoter or a strong promoter.

9. The method according to claim 8, characterized in that: The method comprises utilizing an Agrobacterium-mediated genetic transformation method to transform the recombinant vector into a target plant.

10. Use of the target plant broad-spectrum disease resistance gene according to any one of claims 1 to 3, the recombinant vector according to claim 5, or the method according to claim 8 or 9 in constructing disease-resistant plant germplasm.

Images