Oilseed rape nitrate transporter gene BnaNRT1.1, nitrate transporter protein, application of nitrate transporter gene BnaNRT1.1 in regulation and control of growth of oilseed rape, and amplification primer

Abstract

The invention belongs to the field of biological gene engineering, and discloses a rape nitrate transporter gene BnaNRT1.1, the nucleotide sequence of which is shown as SEQ ID NO: 1, and a nitrate transporter obtained by encoding the rape nitrate transporter gene BnaNRT1.1. The invention also discloses application of the rape nitrate transporter gene BnaNRT1.1 or the nitrate transporter protein in regulation and control of rape growth, and an amplification primer for the rape nitrate transporter gene BnaNRT1.1. The invention also discloses application of the rape nitrate transporter gene BnaNRT1.1 or the nitrate transporter protein in regulation and control of rape growth. The oilseed rape nitrate transporter gene BnaNRT1.1 and the nitrate transporter protein obtained by encoding the oilseed rape nitrate transporter gene BnaNRT1.1 are overexpressed in oilseed rape, so that the nitrate absorption rate and biomass of the oilseed rape can be remarkably increased, and an effective method is provided for nitrogen fertilizer reduction and synergism in field production application; and a basis is provided for providing gene and germplasm resources for further improving the quality of the rape through genetic breeding.

Description

Technical Field

[0001] The present invention belongs to the field of biological genetic engineering technology, and in particular relates to a rapeseed nitrate transport gene BnaNRT1.1, Nitrate transporters and their application in regulating rapeseed growth, amplification primers. Background Art

[0002] Rapeseed is one of the main oil crops in my country, accounting for 60% of my country's self-produced vegetable edible oil. Developing rapeseed production and increasing rapeseed yield are of great significance to maintaining national grain and oil security.

[0003] Nitrogen (N) is an essential "element of life" for plant growth. The application of chemical fertilizers represented by nitrogen fertilizer is one of the key factors in promoting crop yield. Due to excessive or unreasonable application of nitrogen fertilizer, the average nitrogen fertilizer utilization efficiency in my country is significantly lower than that in developed countries, only about 30%. Excessive nitrogen application will not only cause resource waste, soil acidification and hardening, and water eutrophication, but also cause crop leggy growth, lodging, and increased pests and diseases, resulting in reduced yield and quality. Compared with gramineous crops, rapeseed has a higher demand for nitrogen fertilizer, but the lack of soil nitrogen in the southern rice-oil rotation area limits the production of winter rapeseed. Studies have shown that compared with rapeseed with low nitrogen absorption genotypes, rapeseed with high nitrogen absorption genotypes has significantly increased nitrogen utilization efficiency and yield. Therefore, improving the nitrogen absorption efficiency of rapeseed under low nitrogen conditions and ultimately improving nitrogen utilization efficiency is one of the key methods to reduce nitrogen fertilizer and increase efficiency in field production applications. Summary of the invention

[0004] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the above background technology and provide a rapeseed nitrate transport gene BnaNRT1.1, Nitrate transporters and their application in regulating rapeseed growth, amplification primers.

[0005] In order to solve the above technical problems, the technical solution proposed by the present invention is: A nitrate transport gene in rapeseed BnaNRT1.1 , whose nucleotide sequence is shown in SEQ ID NO: 1.

[0006] As a general inventive concept, the present invention also provides a method for producing a nitrate transport gene of rapeseed BnaNRT1.1 The amino acid sequence of the encoded nitrate transporter is shown in SEQ ID NO:2.

[0007] As a general inventive concept, the present invention also provides a rapeseed nitrate transport gene as described above BnaNRT1.1 Or the use of the above-mentioned nitrate transporter in regulating rapeseed growth.

[0008] The above application preferably comprises the following steps: amplifying the rapeseed nitrate transport gene by PCR BnaNRT1.1 The CDS sequence was then cloned into the expression vector by homologous recombination to obtain a gene containing BnaNRT1.1 The target vector is then transformed into Agrobacterium by heat shock transformation, and then cloned into rapeseed by genetic transformation for expression to obtain a vector containing the nitrate transport gene. BnaNRT1.1 overexpression strains.

[0009] In the above application, preferably, the expression vector is pCAMBIA1300.

[0010] In the above application, preferably, the amplification primer used for PCR amplification of the CDS sequence of rapeseed nitrate transporter BnaNRT1.1 is OE:: BnaNRT1.1 The sequences of the forward primer and the reverse primer are shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

[0011] As a general inventive concept, the present invention also provides a method for using the above-mentioned nitrate transport gene BnaNRT1.1 The amplification primer is G:: BnaNRT1.1 The sequences of the forward primer and the reverse primer are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively. BnaNRT1.1 For amplification of nitrate transport genes in rapeseed BnaNRT1.1 Detection of nitrate transport genes in rapeseed by using specific CDS fragments BnaNRT1.1 mRNA level, suitable for verifying rapeseed nitrate transport genes BnaNRT1.1 expression profile.

[0012] As a general inventive concept, the present invention also provides a method for using the above-mentioned nitrate transport gene BnaNRT1.1 The amplification primer is OE:: BnaNRT1.1 The sequences of the forward primer and the reverse primer are shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

[0013] As a general inventive concept, the present invention also provides a method for using the above-mentioned nitrate transport gene BnaNRT1.1 The amplification primer is OE:: BnaNRT1.1-GFP The sequences of the forward primer and the reverse primer are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively. BnaNRT1.1-GFP For amplification of nitrate transport genes in rapeseed BnaNRT1.1 CDS fragment suitable for rapeseed nitrate transporter BnaNRT1.1 Subcellular localization experiments.

[0014] Compared with the prior art, the present invention has the following beneficial effects: (1) The rapeseed nitrate transport gene of the present invention BnaNRT1.1 and the nitrate transporter encoded by it, overexpressing it in rapeseed can significantly increase the nitrate absorption rate and biomass of rapeseed, providing an effective method for reducing nitrogen fertilizer and increasing its efficiency in field production applications, and providing a basis for providing genes and germplasm resources for further improving the quality of rapeseed through genetic breeding.

[0015] (2) The present invention also provides several rapeseed nitrate transport genes BnaNRT1.1 PCR amplification primers can effectively and quickly BnaNRT1.1 Amplified from cDNA of rapeseed. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Picture 1 is obtained in Example 1 BnaNRT1.1 The spatiotemporal expression pattern results; Picture 2 is the subcellular localization result of BnaNRT1.1 obtained in Example 1; Picture 3 is obtained in Example 2 BnaNRT1.1 Overexpression lines BnaNRT1.1 The relative expression level of Picture 4 The seedling stage obtained in Example 2 BnaNRT1.1 Comparison of the phenotypes of the overexpression strain and the wild type. Figure A shows the phenotype under low nitrogen conditions, and Figure B shows the phenotype under high nitrogen conditions. Picture 5 The results of biomass and nitrogen accumulation at the seedling stage obtained in Example 2 are shown in Figure A for the aboveground biomass, Figure B for the aboveground nitrogen accumulation, Figure C for the underground biomass, and Figure D for the underground nitrogen accumulation; Picture 6 The seedling stage NO3 obtained in Example 2 - Figure A shows the nitrate flow rate under low nitrogen conditions, and Figure B shows the nitrate flow rate under high nitrogen conditions. DETAILED DESCRIPTION

[0017] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively and meticulously below in conjunction with the accompanying drawings and preferred embodiments of the present invention, but the protection scope of the present invention is not limited to the following specific embodiments.

[0018] Unless otherwise defined, all professional terms used below have the same meanings as those generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0019] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0020] Embodiment 1: A nitrate transport gene in rapeseed BnaNRT1.1 , whose nucleotide sequence is shown in SEQ ID NO.1; the nitrate transporter protein encoded by it (hereinafter referred to as "nitrate transporter protein BnNRT1.1 The amino acid sequence of "") is shown in SEQ ID NO: 2.

[0021] SEQ ID NO: 1:>BnaC08T0453800WE SEQ ID NO:2 Met Ser Leu Pro Glu Thr Lys Thr Gln Thr Leu Leu Asp Ala Trp Asp PheGln Gly Arg Pro Ala Asp Arg Ser Lys Thr Gly Gly Trp Ala Ser Ala Ala Met IleLeu Cys Ile Glu Ala Val Glu Arg Leu Thr Thr Leu Gly Ile Gly Val Asn Leu ValThr Tyr Leu Thr Gly Thr Met His Leu Gly Asn Ala Thr Ala Ala Asn Thr Val ThrAsn Phe Leu Gly Thr Ser Phe Met Leu Cys Leu Leu Gly Gly Phe Ile Ala Asp ThrPhe Leu Gly Arg Tyr Leu Thr Ile Ala Ile Phe Ala Ala Ile Gln Ala Thr Gly ValSer Ile Leu Thr Leu Ser Thr Ile Ile Pro Gly Leu Arg Pro Pro Arg Cys Asp ProThr Thr Ser Ser His Cys Val Gln Ala Ser Gly Ile Gln Leu Thr Val Leu Tyr LeuAla Leu Tyr Leu Thr Ala Leu Gly Thr Gly Gly Val Lys Ala Ser Val Ser Gly PheGly Ser Asp Gln Phe Asp Glu Thr Glu Pro Lys Glu Arg Ser Gln Met Thr Tyr PhePhe Asn Arg Phe Phe Phe Cys Ile Asn Val Gly Ser Leu Leu Ala Val Thr Val LeuVal Tyr Ile Gln Asp Asp Val Gly Arg Lys Trp Gly Tyr Gly Ile Cys Ala Ala LeuIle Val Leu Ser Leu Ser Ile Phe Leu Ala Gly Thr Asn Arg Tyr Arg Phe Lys LysLeu Ile Gly Ser Pro Met Thr GlnVal Ala Thr Val Leu Val Ala Ala Trp Arg AsnArg Arg Leu Glu Leu Pro Ser Asp Pro Ser Phe Leu Tyr Asp Leu Asp Asp Val IleAla Ala Glu Gly Ser Met Lys Ser Lys Gln Lys Leu Pro His Thr Asn Gln Phe ArgSer Leu Asp Lys Ala Ala Ile Lys Asp Gln Glu Met Ala Met Thr Gln Asn Val TyrAsn Lys Trp Thr Leu Ser Thr Val Thr Asp Ile Glu Glu Val Lys Gln Ile Val ArgMet Leu Pro Ile Trp Ala Thr Cys Ile Leu Phe Trp Thr Val His Ala Gln Leu ThrThr Leu Ser Val Ala Gln Ser Glu Thr Met Asp Arg His Ile Gly Ser Phe Glu IlePro Pro Ala Ala Met Ala Val Phe Tyr Ile Gly Gly Leu Leu Leu Thr Thr Ala ValTyr Asp Arg Leu Ala Ile Pro Leu Cys Lys Lys Leu Phe Asn Tyr Pro His Gly LeuArg Pro Leu Gln Arg Ile Gly Leu Gly Leu Leu Ala Ala Thr Gly Met Ala ValAla Ala Leu Val Glu Ile Lys Arg Leu Arg Thr Ala His Ala His Gly Pro Thr ValLys Thr Leu Pro Leu Gly Phe Ser Leu Leu Ile Pro Gln Tyr Leu Ile Val Gly IleGly Glu Ala Leu Ile Tyr Thr Gly Gln Leu Asp Phe Phe Leu Arg Glu Cys Pro LysGly Met Lys Thr Met Ser Thr Gly Leu Leu Leu Ser Thr LeuAla Leu Gly Phe PhePhe Ser Ser Val Leu Val Thr Ile Val Glu Lys Val Thr Asp Lys Ala His Pro TrpIle Ala Asp Asp Leu Asn Lys Gly Arg Leu Tyr Asn Phe Tyr Trp Leu Val Ala IleIle Val Ala Leu Asn Phe Leu Val Phe Leu Val Phe Ser Lys Gly Tyr Val Tyr LysGlu Lys Arg Leu Ala Asp Leu Gly Ile Glu Leu Glu Asp Glu Pro Asp Ile Pro MetGly His The nitrate transporter gene BnNRT1.1 Nitrate transporter BnNRT1.1 It was discovered in rapeseed through homologous gene analysis and plant molecular genetics and physiological and biochemical methods. After research, we also found that its overexpression can improve the absorption of nitrates and significantly increase the biomass of rapeseed, which provides a practical basis for enhancing the nitrogen absorption efficiency of rapeseed through variety genetic improvement and continuously increasing the biomass of rapeseed.

[0022] 1. Nitrate transporter genes BnNRT1.1 The spatiotemporal expression pattern of To obtain the nitrate transporter gene of rapeseed BnNRT1.1 To investigate the expression pattern of the gene, RNA was extracted from various parts of rapeseed at different growth stages, with three replicates for each sample. Total RNA was extracted using TRIzol, and the total RNA (1 μg) was synthesized into first-strand cDNA using the Hiscript II Q RT SuperMix Kit (Vazyme). Real-time fluorescence quantitative PCR analysis was performed on a StepOnePlus instrument using the ChanQTM SYBR using the qPCR premix (Vazyme) system (Analytik Jena AG). The PCR amplification primers were G:: BnNRT1.1, with forward and reverse primers 5'-TGGCCGGCACTAATCGCTACCGT-3' (as shown in SEQ ID NO: 3) and 5'-CCATTTCTTGGTCCTTTATCGCTGCTTTA-3' (as shown in SEQ ID NO: 4), respectively. Action was used as an internal standard with primers 5'-CACTATGTTCTCGGGGATTGC-3' (as shown in SEQ ID NO: 9) and 5'-TGGACCTGCCTCATCATACTC-3' (as shown in SEQ ID NO: 10).

[0023] The specific steps are as follows: Total RNA extraction: 1. After tissue sampling, freeze the sample in liquid nitrogen and grind it into powder. Take 0.1 g of sample and add it to a 1.5 mL centrifuge tube. Add 1 mL TRIzol, mix quickly, and let it stand at room temperature for 5 min. 2. Add 200 µL of chloroform to the centrifuge tube, shake vigorously for 30 s, and let it stand at room temperature (25°C) for 10 min. 3. Centrifuge at 4°C 12000 rpm for 10 min. 4. Carefully transfer 500 µL of supernatant to a new 1.5 mL centrifuge tube. 5. Add an equal volume of isopropanol, gently invert and mix, let it stand at room temperature (25°C) for 10 min. Centrifuge at 4°C 12000 rpm for 10 min, and discard the supernatant. 6. Add 1 mL of 75% ethanol, gently invert to suspend the precipitate. 7. Centrifuge at 4°C 8000 rpm for 5 min, and discard the supernatant. 8. Repeat steps 6 and 7, blow the RNA precipitate into a translucent gel in a clean bench, and add 40 µL of DEPC water to dissolve the RNA.

[0024] RNA quality detection and concentration determination: 1. Electrophoresis detection of RNA integrity: 1% agarose gel fast electrophoresis, detection of RNA molecular integrity, observation of 18S and 28S bands, 28S band brightness is about 2 times the brightness of 18S band, indicating that RNA integrity is good; 2. Nucleic acid analyzer detection of RNA purity and concentration: DEPC water is used to read BLANK, NanoDrop to determine RNA concentration. The absorption peak of nucleic acid is at 260 nm, and the maximum absorption peak of protein is at 280 nm. RNA samples with OD260 / 280 between 1.8-2.0 meet the purity standards and can be used for subsequent fluorescence quantitative experiments.

[0025] Synthesis of the first strand of cDNA: Total RNA was used to synthesize the first strand of cDNA using the reverse transcription kit Hiscript II Q RT SuperMix. The total amount of cDNA for each sample was 1 µg. cDNA was stored at -20°C for future use. The reverse transcription system was as follows: Total RNA (1 µg), 4 × gDNA wiper Mix 4 µL, 5 × HiScript® II qRT SuperMix II 4µL, and RNA-free water was added to 20 µL. Reaction conditions: incubate at 42°C for 15 min, and inactivate at 85°C for 5 s. After the reaction was completed, an equal volume of RNA-free water was added to dilute it by half, and after mixing, it was stored in a refrigerator at -20°C for future use.

[0026] Real-time fluorescence quantitative PCR primer design and specificity analysis: According to the full length of gene cDNA, qPCR primers were designed using the primer5 software, and primers with good specificity and no complementary bases were selected and sent to Qingke Biotechnology Co., Ltd. for synthesis to obtain amplification primers G:: BnaNRT1.1 Using cDNA of rapeseed at different stages as template, primer specificity was detected by agarose gel electrophoresis. The reaction system was as follows: cDNA 1 µL, G:: BnaNRT1.1 Forward primer (10 µM) 0.5 µL, G:: BnaNRT1.1 Reverse primer (10 µM) 0.5 µL, 1.1×T3 Super PCR Mix (Qingke Biotechnology) 18 µL. Reaction conditions: 95°C, 3 min; 95°C, 10 s; 55°C, 10 s; 72°C, 10 s; 36 cycles in total, 72°C, 5 min.

[0027] After the fluorescence quantitative PCR primers were detected correctly, the first-strand cDNA synthesized by reverse transcription was used as a template and quantified using a two-step method on a Roche LightCycler®96 real-time fluorescence quantitative PCR instrument. Three technical replicates were set for each gene and each sample. The reaction system was as follows: cDNA 1 µL, G:: BnaNRT1.1 Forward primer (10 µM) 0.5 µL, G:: BnaNRT1.1 Reverse primer (10 µM) 0.5 µL, 2 × ChamQ Universal SYBR qPCR Master Mix 10 µL, ddH2O 8 µL. Reaction conditions: (1) Pre-denaturation stage: 95°C, 10 min; (2) Amplification stage: 95°C, 10 s, 60°C, 30 s, 40 cycles in total; (3) Melting curve stage: 96°C 15 s, 60°C 60 s, 95°C 15 s.

[0028] The results are as follows Picture 1As shown, nitrate transport genes BnNRT1.1 The expression level was relatively high in roots during the seedling and bud stages, and in leaves and petioles during the flowering and silique stages.

[0029] 2. Nitrate transporter BnaNRT1.1 Positioning For research BnaNRT1.1 To enhance the cell specificity of expression, we constructed BnaNRT1.1-GFP The transformation vector was obtained by PCR amplification. BnaNRT1.1 CDS sequence (excluding the terminator), amplification primer OE:: BnaNRT1.1- GFP The forward and reverse primers were 5'-GAGCTCGGTACCCGG GGATCC ATGTCTCTACCTGAAACTAAAACAC-3' (as shown in SEQ ID NO: 7, BamHI recognition site is italicized) and 5'- CTTCTCCTTTGCCCAT GTC GAC TGGCCCATTGGAATGTCTGG-3' (as shown in SEQ ID NO: 8, the SalI recognition site is italicized). The fragment was cut using BamHI and SalI endonucleases, and the amplified fragment was cloned into the pCAMBIA1300-GFP vector to generate the BnaNRT1.1-GFP vector, which was further transformed into Arabidopsis protoplasts by a PEG-mediated method.

[0030] The specific steps are as follows: shake the BnaNRT1.1-GFP bacterial solution, extract the BnaNRT1.1-GFP plasmid using the Solebow plasmid extraction kit and concentrate the plasmid. The concentration steps are as follows: (1) Mix all plasmids with the same gene name into one tube; (2) Freeze the centrifuge tube containing the plasmid at -80°C. (3) Seal the centrifuge tube with sealing film and poke two holes in the tube cap with a needle; (4) Freeze-dry the plasmid using a freeze dryer; (5) Add ddH2O to adjust the concentration to ≥1 µg and store at -20℃ for later use.

[0031] Preparation of Arabidopsis protoplasts: (1) Cultivate Arabidopsis col in 1 / 2MS and grow in the dark for 12 days. Select 15 yellow flower seedlings with good growth status and cut them into thin strips with disposable sterile blades. The thinner the better. (2) Place the cut filaments into a 50 mL beaker containing 10 mL of enzymatic solution, wrap with tin foil, leave a hole at the mouth of the beaker, evacuate for 5 min, and perform enzymatic hydrolysis on a shaker in the dark for 4 h (28°C, 45 rpm); (3) Filter the enzymatic solution through a 150-mesh sieve into a 10 mL round-bottom centrifuge tube; (4) 200 g, 1 min, 4°C, discard the supernatant, gently add 1 mL of W5 along the wall, and gently resuspend the protoplasts until there is no precipitation at the bottom; (5) Incubate on ice for 40 min; (6) Remove the supernatant, add 2 mL of W5 and gently invert to mix; (7) Cut off the tip of the yellow pipette, draw 12 µL of the mixed sample and gently inject it into the hemocytometer and place it under a microscope for counting; (8) Incubate the remaining protoplasts on ice for 40 min and discard the supernatant.

[0032] PEG-mediated protoplast transformation: Estimate the number of protoplasts based on the protoplast concentration, and add MMG (a solution made of mannitol, MgCl2, and MES) to make the final protoplast concentration approximately 2×10 5 / mL; prepare the following reaction solution in a 1.5 mL round-bottom centrifuge tube: 150 µL protoplasts, 15 µg GFP plasmid (1.0 µg / µL), mix evenly; then add 165 µL PEG transformation solution, gently invert up and down several times to promote the fusion of PEG and protoplasts, let stand at room temperature for 5 min, add 1 mL W5 to terminate the reaction; centrifuge at 200 g for 5 min, remove the supernatant, resuspend the protoplasts with 200 µL W5, and culture overnight at 22℃ in the dark; observe the GFP signal of the protoplasts using a laser confocal microscope.

[0033] The results are as follows Picture 2 As shown, the rapeseed nitrate transporter BnaNRT1.1 Located on the cell membrane of protoplasts.

[0034] Embodiment 2: The rapeseed nitrate transport gene of the present invention BnaNRT1.1 The application in regulating rapeseed growth includes: 1. BnaNRT1.1 Obtaining gene overexpression materials To further verify the nitrate transport gene of rapeseed BnaNRT1.1 We use the OE:: BnaNRT1.1 Primer sequences: 5'-CGGGGGACTCTAGA GGAT ATGTCTCTACCTGAAACTAAAACAC -3' (as shown in SEQ ID NO: 5, wherein the BamHI recognition site is italicized) and 5'-TCGGAGGAGGCCAT ACT AGTTGGCCCATTGGAATGTCTGG -3' (as shown in SEQ ID NO: 6, wherein the SpeI recognition site is italicized), the gene was cloned by PCR. BnaNRT1.1 The cDNA of rapeseed was amplified and then cloned into the plant expression vector pCAMBIA1300 by homologous recombination to obtain the gene BnaNRT1.1 The target vector OE:: BnaNRT1.1 ; Then the target vector is transformed into Agrobacterium by heat shock transformation, and the purified plasmid is cloned into rapeseed for expression. The specific steps are as follows: (1) Disinfection and sowing of rapeseed seeds: Select full Westar rapeseed seeds and place them in a sterile box. Add 70% alcohol and soak for 2 minutes. After pouring out the alcohol, add sterile water to wash. After pouring out the sterile water, add 50% sodium hypochlorite disinfectant and wash for 15 minutes. Use sterile tweezers to sow the disinfected seeds in a sterile box containing MS culture medium and culture at 25°C for 6 days.

[0035] (2) Explant preparation and infection: Cultivate the target strain in LB liquid medium containing Kan resistance. Shake overnight at 28°C and 220 rpm until the OD600 of the bacterial solution reaches 0.6. Cut the hypocotyl into small segments of 0.8-1.0 cm in length, pour the resuspended bacterial solution into a culture dish containing hypocotyls, and culture at 25°C for 2 days.

[0036] (3) Select and induce callus tissue: transfer the explants in M1 medium to M2 (MS2.2g / L, sucrose 30g / L, agarose 6g / L) medium and culture at 25°C for two weeks. The above operations need to be carried out in a clean bench, and the experimental instruments and reagents used have been sterilized.

[0037] (4) Inducing differentiation, bud regeneration and rooting: Transfer the callus tissue in the M2 medium to the M3 (MS 2.2 g / L, glucose 30 g / L, xylose 0.25 g / L, MES 0.6 g / L, agarose 6 g / L) medium. If green buds appear, cut off the tissue with a sterile blade and transfer it to the M4 (MS 4.4 g / L, sucrose 30 g / L, agarose 6 g / L) medium. After the callus tissue grows into a complete plant, transplant it into the soil.

[0038] (5) Identification of transgenic plants: DNA of transgenic plants was extracted, and PCR identification with hygromycin-specific primers was designed based on the sequence of the selection marker hygromycin gene carried on the vector. Finally, transgenic positive seedlings were obtained, namely, overexpression strains OX-1, OX-2, OX-3 and OX-4, etc.

[0039] (6) In transgenic plants BnaNRT1.1Relative expression detection: extract the mRNA of transgenic plants and wild type, reverse synthesize cDNA, and use amplification primers G:: BnaNRT1.1 Detection of transgenic plants by fluorescence quantitative PCR BnaNRT1.1 Relative expression.

[0040] like Picture 3 As shown, compared with the wild-type Westar, the strains OX-1, OX-2, OX-3, and OX-4 BnaNRT1.1 The relative expression levels increased significantly, verifying that OX-1, OX-2, OX-3, and OX-4 were BnaNRT1.1 Overexpression lines.

[0041] 2. BnaNRT1.1 Effects of gene overexpression on rapeseed growth For research BnaNRT1.1 To study the effects of nitrate nitrogen on rapeseed seedling growth and absorption, we selected three strains with higher expression levels for high nitrogen and low nitrogen treatments. We also measured nitrogen content and calculated nitrogen accumulation in the wild type (WT) and overexpression strains (OX-1, OX-2, OX-3), as follows: (1) Use a 1 / 10,000 balance to weigh 0.1 g of the crushed dry rapeseed sample into a 50 mL narrow-necked conical flask. Add a small amount of distilled water to wet the sample, then add 5 mL of concentrated sulfuric acid, shake well and leave to soak overnight. After covering the bottle mouth with a small curved-neck funnel, place the conical flask on a hot plate in a fume hood and boil at 250 °C until the solution is uniform (no obvious black particles). After the concentrated sulfuric acid decomposes and produces a large amount of white smoke, raise the temperature to 400 °C. When the solution is brown-black, turn off the hot plate and let it cool to room temperature. Add 10 drops of hydrogen peroxide solution and shake well. Heat to a slight boil, then repeat adding hydrogen peroxide solution (and gradually reduce the amount added as the digestion solution decolorizes). Boil until the solution is clear and transparent. Heat for a while to remove the remaining hydrogen peroxide in the digestion solution. Turn off the hot plate. After letting it cool to room temperature, add deionized water three times to rinse and dilute to a 50 mL centrifuge tube. Shake well and determine the nitrogen content.

[0042] (2) Blank test: Except for not adding sample, the reagent dosage and operation are the same as those for measuring the sample.

[0043] (3) Before distillation, you need to prepare 40% NaOH solution, H2SO4 standard solution, 2% boric acid-mixed indicator, and methyl red-bromocresol green mixed indicator. Before formal nitrogen determination, you need to start the machine and use water to steam twice to check whether the liquid in and out is normal.

[0044] (4) Take 10 mL of the above test solution and inject it into the distillation tube of the Kjeldahl nitrogen analyzer. The wide-mouthed conical flask receives the indicator and the absorption liquid (the solution in the conical flask should be wine red before the absorption liquid is added). After setting the parameters, measure the test solution. Titrate the absorption liquid with sulfuric acid standard solution and record the titration volume. Calculate the total nitrogen content in the sample.

[0045] (5) Calculate nitrogen accumulation: nitrogen accumulation = nitrogen content × biomass.

[0046] The aboveground and root phenotypes of the seedlings Picture 4 As shown, under high nitrogen and low nitrogen conditions, BnaNRT1.1 The overexpression lines all grew larger than the wild type. Picture 5 As shown, under high nitrogen and low nitrogen conditions, BnaNRT1.1 The aboveground and underground biomass and nitrogen accumulation of the overexpression strain were significantly higher than those of the wild type. BnaNRT1.1 It is involved in regulating nitrate absorption by rapeseed and can promote the growth of rapeseed seedlings.

[0047] At the same time, non-invasive ion micro-test was used for physiological function analysis. The main roots of rapeseed treated with 0.3 mM and 15 mM nitrate for 21 days were placed in a culture dish, and 10 mL of test solution (0.3 mM and 10 mM KNO3) was added for pretreatment for 30 minutes. The main root meristem was selected as the test site, and then the non-invasive ion measurement technology (NMT) was used to detect the NO3 in the root. - The real-time flow rate is as follows: Picture 6 As shown, under high nitrogen and low nitrogen conditions, BnaNRT1.1 NO3 overexpression strains - The real-time flow rate of the mutant was significantly higher than that of the wild type, which indicates that the nitrate transporter of the present invention is indeed involved in the absorption of nitrate.

[0048] The above results show that overexpression of nitrate transporter genes in rapeseed BnaNRT1.1 The gene and its nitrate transporter can regulate rapeseed nitrate absorption and promote rapeseed seedling growth, which indicates that rapeseed nitrate transport gene BnaNRT1.1 The gene and its nitrate transporter can increase the nitrate absorption rate and biomass of rapeseed, providing an effective method for reducing nitrogen fertilizer and increasing its efficiency in field production applications, and providing a basis for providing genes and germplasm resources for further improving the quality of rapeseed through genetic breeding.

Claims

1. A nitrate transport gene in rapeseed BnaNRT1.1 , characterized in that, The nucleotide sequence thereof is shown in SEQ ID NO:

1.

2. A nitrate transport gene of rapeseed according to claim 1 BnaNRT1.1 The encoded nitrate transporter is characterized in that Its amino acid sequence is shown in SEQ ID NO:

2.

3. A rapeseed nitrate transport gene as claimed in claim 1 BnaNRT1.1 Or the use of the nitrate transporter as claimed in claim 2 in regulating rapeseed growth.

4. The use according to claim 3, characterized in that Specifically, the steps include: amplifying the rapeseed nitrate transport gene by PCR method: BnaNRT1.1 The CDS sequence was then cloned into the expression vector by homologous recombination to obtain a gene containing BnaNRT1.1 The target vector is then transformed into Agrobacterium by heat shock transformation, and then cloned into rapeseed by genetic transformation for expression to obtain a vector containing the nitrate transport gene. BnaNRT1.1 overexpression strains.

5. The use according to claim 4, characterized in that The expression vector is pCAMBIA1300.

6. The use according to claim 4 or 5, characterized in that The primers used for PCR amplification of the CDS sequence of the rapeseed nitrate transporter BnaNRT1.1 were OE:: BnaNRT1.1 The sequences of the forward primer and the reverse primer are shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

7. A nitrate transport gene for rapeseed according to claim 1 BnaNRT1.1 The amplification primer is characterized in that The amplification primer is G:: BnaNRT1.1 The sequences of the forward primer and the reverse primer are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

8. A nitrate transport gene for rapeseed according to claim 1 BnaNRT1.1 The amplification primer is characterized in that The amplification primer is OE:: BnaNRT1.1 The sequences of the forward primer and the reverse primer are shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

9. A nitrate transport gene for rapeseed according to claim 1 BnaNRT1.1 The amplification primer is characterized in that The amplification primer is OE:: BnaNRT1.1-GFP The sequences of the forward primer and the reverse primer are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively.

Images