Rice tillering regulation gene TR4 and application of protein coded by rice tillering regulation gene TR4

Abstract

The invention relates to the field of plant genetic engineering, in particular to a rice tillering regulation gene TR4, a protein coded by the rice tillering regulation gene TR4 and application of the rice tillering regulation gene The invention discloses application of a gene TR4 in regulation and control of rice tillering. The nucleotide sequence of the gene TR4 is shown as Seq ID No: 1. Overexpression of the TR4 promotes increase of effective tillering of the rice and increase of per unit yield. Knockout of the TR4 leads to reduction of the effective tiller number of the rice.

Description

Technical Field

[0001] The invention relates to the field of plant genetic engineering, and in particular to a rice tillering regulating gene TR4 and a protein encoded by the gene and application thereof. Background Art

[0002] Rice is one of the most important food crops. More than half of the world's population uses it as their main food source. It is also one of the food crops that my country actively advocates and supports, with the largest planting area and yield. Since the 21st century, the area of ​​rice cultivation in my country has been relatively stable, with an annual planting area of ​​about 30 million hectares and an annual rice output of more than 200 million tons. The rice yield is relatively stable (Wu Yuanyuan. The current situation and development trend of rice production in my country [J]. New Agriculture, 2018 (7): 27-28). However, in recent years, due to the continuous increase in population, the reduction in cultivated land area, the frequent occurrence of extreme weather, and the slow growth of crop yields, the yields of about 24% to 39% of the world's corn, rice, wheat and soybean planting areas are stagnant or even declining. Therefore, high yield remains the unremitting goal of agricultural production (Wei S, Li X, Lu Z, Zhang H, Ye X, Zhou Y, Li J, Yan Y, Pei H, Duan F, Wang D, Chen S, Wang P, Zhang C, Shang L, Zhou Y, Yan P, Zhao M, Huang J, BockR, Qian Q, Zhou W. A transcriptional regulator that boosts grain yields and shortens the growth duration of rice. Science, 2022, 377(6604):eabi8455).

[0003] Rice yield is determined by a variety of factors, including the number of effective tillers, the number of grains per panicle, and grain weight. Among them, the number of effective tillers is generally considered to be the key factor affecting rice yield. The tillering period of rice is an important stage in the growth and development of rice, which has a significant impact on the yield and quality of rice. Tillering refers to the development of axillary buds at the base of the main stem of rice into new stems under suitable environmental conditions, thus forming multiple branches. The occurrence of rice tillering is a very complex process, and factors such as natural conditions, plant nutrition, plant hormones, and genetics can affect its occurrence (Liu Yang, Wang Qiangsheng, Ding Yanfeng, Wang Shaohua. Research progress on the mechanism of rice tillering [J]. Chinese Agricultural Science Bulletin, 2011, 27(3):5). In-depth research on the mechanism of rice tillering and more effective regulation of tillering will further increase rice yield and have important significance for rice production.

[0004] At present, some progress has been made in the research of tillering-related QTL positioning, gene cloning and molecular regulation mechanism. MOC1 encodes a GRAS family protein located in the nucleus, which controls the formation of axillary meristems in the vegetative and reproductive growth stages. This is the first key gene cloned in rice to control tillering (Li X, Qian Q, Fu Z, Wang Y, Xiong G, Zeng D, Wang X, Liu X, Teng S, Hiroshi F, Yuan M, Luo D, Han B, Li J. Control of tillering in rice. Nature, 2003, 422 (6932): 618-621). The genes that control tillering bud growth mainly include genes involved in strigolactone biosynthesis and signaling pathways. For example, the HTD1 gene encoding the carotene cleavage enzyme dioxygenase CCD7 inhibits tillering and negatively regulates the tiller number of rice (Wang Y, Shang L, Yu H, Zeng L, Hu J, Ni S, Rao Y, Li S, Chu J, Meng X, Wang L, Hu P, Yan J, Kang S, Qu M, Lin H, Wang T, Wang Q, HuX, Chen H, Wang B, Gao Z, Guo L, Zeng D, Zhu X, Xiong G, Li J, Qian Q. A Trigolactone Biosynthesis Gene Contributed to the Green Revolution in Rice. Molecular Plant, 2020, 13(6): 923-932).D14 and D53 are two key components in the signal transduction process of strigolactones in rice. D14 is the receptor of strigolactones, which can sense strigolactones and trigger the ubiquitination of D53 by D14-SCF ubiquitin ligase. Subsequently, D53 protein is degraded by 26S proteasome, leading to the transmission of strigolactone signals and various downstream reactions, thereby regulating the tiller number of rice (Zhou F, Lin Q, Zhu L, Ren Y, Zhou K, Shabek N, Wu F, Mao H, Dong W, Gan L, Ma W, Gao H, Chen J, Yang C, Wang D, Tan J, Zhang X, Guo X, Wang J, Jiang L, LiuX, Chen W, Chu J, Yan C, Ueno K, Ito S, Asami T, Cheng Z, Wang J, Lei C, Zhai H, Wu C, Wang H, Zheng N, Wan J. D14-SCF (D3)-dependent degradation of D53 regulates strigolactone signalling. Nature, 2013, 504 (7480): 406-410). Mining rice tillering regulatory genes is not only conducive to analyzing the genetic basis of rice tillering formation, but also can enrich rice gene resources and provide a theoretical basis for high-yield breeding.

[0005] The invention of 202411133265.9 "Application of positive regulation of OsNRT2-P2 gene in improving crop yield" informs that overexpression of OsNRT2-P2 gene can significantly increase the aboveground plant height and biomass of rice, the overall growth is significantly better than the wild type, and the rice yield will also be significantly improved; it can also increase the protein content and nitrogen utilization efficiency of crop fruits or seeds. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide application of rice tillering regulating gene TR4 and its encoded protein.

[0007] In order to solve the above technical problems, the present invention provides a rice tillering regulating gene TR4 (OsNAR2.2), and the nucleotide sequence of the gene TR4 (OsNAR2.2) is shown in Seq ID No: 1 (9311).

[0008] As an improvement of the rice tillering regulating gene TR4 of the present invention: the cDNA nucleotide sequence of gene TR4 is shown in Seq ID No: 2 (9311) and Seq ID No: 3 (Peiai 64S).

[0009] The present invention also provides a protein encoded by the gene TR4, the amino acid sequence of which is shown in Seq ID No: 4 (9311).

[0010] The present invention also provides a knockout vector pYLCRISPR / Cas9-MH-TR4 containing the above-mentioned gene TR4: pYLCRISPR / Cas9-MH is used as a basic vector, and the editing target site sequence (i.e., SeqIDNo: 7) located in the exon of gene TR4 is inserted between the BsaI-BsaI restriction sites of the basic vector.

[0011] The present invention also provides an overexpression vector containing the gene TR4, which is obtained by taking pCAMBIA1300-UBi as a basic vector and inserting the coding sequence (CDS) (Seq ID No: 2) of the 9311 gene TR4 between the SacI restriction sites of the basic vector.

[0012] The present invention also provides a host cell containing the above gene, wherein the host cell is an Escherichia coli cell or an Agrobacterium cell.

[0013] The present invention also provides the use of gene TR4: overexpression of TR4 promotes the increase of effective tillering of rice and increases the yield per unit area.

[0014] As an improvement on the use of the gene TR4 of the present invention, the knockout vector or the overexpression vector is transformed into monocotyledonous plant (eg, rice) cells, and the transformed monocotyledonous plant cells are then cultured into plants.

[0015] The present invention also provides a method for regulating rice tillering:

[0016] The knockout vector pYLCRISPR / Cas9-MH-TR4 was transformed into rice cells to obtain knockout mutants, and the number of effective tillers of the resulting rice was reduced;

[0017] The overexpression vector pCAMBIA1300-UBi-TR4 was transformed into rice cells, and the number of effective tillers of the resulting rice increased.

[0018] The technical solution provided by the present invention is specifically as follows:

[0019] The rice tillering regulatory gene TR4 of the present invention has the sequences shown in (a) and (b):

[0020] (a) The genomic nucleotide sequence shown in Seq ID No: 1;

[0021] (b) 9311 and Pei'ai 64S cDNA nucleotide sequences shown in Seq ID No: 2 and Seq ID No: 3;

[0022] The 9311 genomic nucleotide sequence shown in Seq ID No: 1 has a total of 998 nucleotides (including the terminator TGA), the cDNA sequence of 9311 shown in Seq ID No: 2 has a total of 633 nucleotides (including the terminator TGA), and the cDNA sequence of PA64S shown in Seq ID No: 3 has a total of 633 nucleotides (including the terminator TGA). There are 3 single nucleotide polymorphisms (SNPs) in Seq ID No: 2 and Seq ID No: 3.

[0023] Another object of the present invention is to provide a protein encoded by the above gene, having the sequence shown in (A):

[0024] (A) amino acid sequence shown in Seq ID No: 4 (9311);

[0025] The protein shown by Seq ID No: 4 belongs to a tillering regulatory protein and has 210 amino acids.

[0026] The present invention also aims to provide a knockout and overexpression vector containing the rice tillering regulatory gene TR4. Figure 4 pYLCRISPR / Cas9-MH-TR4 shown in A, TR4-KO1 undergoes insertion mutation after gene editing, resulting in a frameshift of the TR4 protein sequence starting from position 109, as shown in Seq ID No: 5; TR4-KO2 undergoes two base deletion mutation after gene editing, resulting in a frameshift of the TR4 protein sequence starting from position 109, as shown in Seq ID No: 6; the overexpression vector is Figure 4 B shows pCAMBIA1300-UBi-TR4, which can improve the expression of TR4. The present invention also aims to provide a host cell containing the rice gene TR4, wherein the host cell is an Escherichia coli cell, an Agrobacterium cell or a plant cell.

[0027] The purpose of the present invention also includes using the above-mentioned rice tillering regulatory gene TR4 to regulate the number of rice tillers, including transforming rice cells with knockout and overexpression vectors constructed with genes having the nucleotide sequence shown by the above-mentioned rice tillering regulatory gene TR4, and then cultivating the transformed rice cells into plants.

[0028] The rice tillering regulatory gene TR4 can be used to regulate the number of rice tillers and increase the rice yield per unit area.

[0029] The specific technical steps for implementing the present invention are as follows:

[0030] 1. Screening and identification of candidate genes

[0031] The present invention found that there was a significant difference in the number of effective tillers between the two parents of the rice recombinant inbred line (RIL) population, 9311 and Pei'ai 64S ( Figure 1 A, B). In the RIL population, the number of effective tillers in rice was continuously normally distributed, indicating that the number of effective tillers in rice is a quantitative genetic trait and can be subjected to QTL analysis. The constructed rice high-density SNP map of the RIL population (Gao ZY, Zhao SC, He WM, Guo LB, Peng YL, Wang JJ, Guo XS, Zhang XM, Rao YC, Zhang C, Dong GJ, Zheng FY, Lu CX, Hu J, Zhou Q, Liu HJ, Wu HY, Xu J, Ni PX, Zeng DL, Liu DH, Tian P,Gong LH,Ye C,Zhang GH,Wang J,Tian FK,Xue DW,Liao Y,Zhu L,Chen MS,Li JY,Cheng SH,Zhang GY,Wang J,Qian Q.Dissecting yield-associated lociin super hybrid rice byresequencing recombinant inbred lines and improving parental genomesequences.Proceedings of the National Academy of Sciences USA, 2013, 110(35):14492-14497) conducted QTL positioning analysis and found a major QTL on rice chromosome 4 with a LOD value of 2.92, located between markers SNP4-271 and SNP4-290.

[0032] In order to precisely locate the major QTL, the present invention constructed a BC4F2 population with 9311 and Pei'ai 64S as parents, analyzed the sequence between the two molecular markers SNP4-271 and SNP4-290, developed new molecular markers, and finally precisely located the major QTL within a physical distance of about 43.5 kb between the insertion and deletion (InDel) markers INDEL4-3 and INDEL4-4 ( Figure 2 ), and the candidate gene TR4 ( Figure 3 ).

[0033] 2. Identification and functional analysis of TR4 gene

[0034] Through transgenic technology, the present invention obtains TR4 gene knockout and overexpression plants ( Figure 4 ). The effective tiller number statistics determined that the present invention obtained rice plants with a change in the effective tiller number of rice. The effective tiller number of the knockout plant was significantly reduced, and the yield per plant decreased; the effective tiller number of the overexpression plant was significantly increased, thereby increasing the yield per plant ( Figure 5 ). This result proves the tillering regulatory gene TR4 cloned by the present invention.

[0035] The present invention adopts the map-based cloning technology, further locates the BC4F2 population of Pei'ai 64S and 9311, combines gene annotation and gene sequencing, determines the tillering regulatory gene TR4, and identifies the gene function through transgenic knockout and overexpression experiments. The cloning and application of the TR4 gene provide valuable genetic resources for the cultivation of high-yield varieties.

[0036] It should be emphasized that: At present, only the sequences described in Seq ID No: 1 to Seq ID No: 4 are published on NCBI; in previous gene family analysis, it was found that it was predicted to encode a nitrate transporter chaperone protein (Xu N, Yu B, Chen R, Li S, Zhang G, Huang J. OsNAR2.2 plays a vital role in the root growth and development by promoting nitrate uptake and signaling in rice. Plant Physiology and Biochemistry, 2020, 149: 159-169), but there is no report on this gene regulating rice tillering.

[0037] Most of the currently known genes related to rice tillering regulation are genes involved in the biosynthesis and signaling pathways of strigolactones (Takai T. Potential of rice tillering for sustainable food production. Journal of Experimental Botany, 2024, 75(3): 708-720), but the rice tillering regulation gene TR4 of the present invention is involved in the nitrate metabolism pathway.

[0038] In summary, the prior art cannot provide the present invention with technical inspiration. The research on the regulation of rice tillering by gene TR4 of the present invention can provide an important basis for breeding high-yield varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0040] Figure 1(A) shows the phenotypes of rice varieties 9311 and Peiai 64S plants, and the scale bar is 20 cm; (B) shows the comparison of the effective tiller numbers of 9311 and Peiai 64S. * indicates that there is a highly significant difference in the t-test at the 0.01 < P < 0.05 level.

[0041] Figure 2 It is the fine mapping map of the TR4 gene.

[0042] Figure 3 It is the difference of the CDS of the TR4 gene between 9311 and Peiai 64S.

[0043] Figure 4 They are vector schematic diagrams, transgenic molecular identification, and plant phenotypes; Figure 4 Among them: (A) pYLCRISPR / Cas9-MH-TR4 knockout vector; (B) pCAMBIA1300-UBi-TR4 overexpression vector; (C) sequencing sequences near the editing sites of wild-type Nipponbare and the TR4 gene knockout lines; (D) relative expression levels of the transcription level of the TR4 gene in Nipponbare and the knockout lines (TR4-KO1, TR4-KO2). (E) Relative expression levels of the transcription level of the TR4 gene in Nipponbare and the overexpression lines (TR4-OE1, TR4-OE2). The values represent the mean and standard deviation of three biological replicates; ** indicates that there is a highly significant difference in the t-test at the 0.001 < P < 0.01 level.

[0044] Figure 5 They are the comparisons of the mature plant phenotypes (A), effective tiller numbers (B), and per-plant yields (C) of Nipponbare, the TR4 gene knockout mutants (TR4-KO1, TR4-KO2), and the overexpression plants (TR4-OE1, TR4-OE2). The scale bar is 20 cm; the values represent the mean and standard deviation of three biological replicates; a, b, c indicate that there is a significant difference in the t-test at the P < 0.05 level. Detailed implementation manners

[0045] The present invention will be further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0046] Example 1: QTL mapping and candidate gene determination

[0047] 1. Rice materials

[0048] The indica rice varieties are (Oryza sativa L. indica) "9311" and "Peiai 64S". A recombinant inbred line (RIL) population is constructed with 9311 and Peiai 64S as parents, and a BC4F2 segregation population obtained by backcrossing and selfing Peiai 64S with 9311.

[0049] 2. Location of the effective tiller number QTL qTR4

[0050] Preliminary localization of qTR4: The present invention found that the effective tiller numbers of the two parents of the rice RIL population, 9311 and Pei'ai 64S, were significantly different ( Figure 1 A, B). A RIL population of 9311 and Pei'ai 64S composed of 131 lines was used as a QTL mapping population. Based on the high-resolution genetic map created from the published indica rice 9311 and Pei'ai 64S, a QTL mapping analysis was performed. It was found that there was a major tillering regulation QTL qTR4 ( Figure 2 A), the LOD value is 2.92.

[0051] Fine positioning of qCR4: The BC4F2 population of backcrossing between Pei'ai 64S and 9311 was used as the fine positioning population. The sequence between the two markers SNP4-271 and SNP4-290 was analyzed. Six InDel markers were developed based on the sequences of indica rice 9311 and Pei'ai 64S (as shown in Table 1). Finally, the major effect QTL was precisely located within the physical distance of about 43.5 kb between markers INDEL4-3 and INDEL4-4 ( Figure 2 B, C).

[0052] Table 1. Molecular markers for fine mapping development

[0053]

[0054] *F: forward primer; R: reverse primer.

[0055] 3. Gene prediction and comparative analysis:

[0056] Screening the annotated genes related to tillering in the 43.5 kb interval, we found a gene OsNAR2.2 predicted to encode a nitrate transporter chaperone protein. Since it is located on chromosome 4, it was named TR4 (Tillering Regulation 4) ( Figure 2 C). Comparison of genomic DNA and cDNA showed (sequences such as Seq ID No: 1 and Seq ID No: 2) that the gene contained 1 intron and 2 exons. Comparison with the whole genome sequence of 9311 revealed that the gene was a single copy.

[0057] The present invention designs the sequencing primers of the gene, and adopts the PCR method to amplify the TR4 gene from the genome of 9311 and Pei'ai 64S for sequencing analysis. Sequence comparison shows that there are three SNPs in the coding region of 9311 and Pei'ai 64S, among which one site causes the change of amino acid, which is alanine in 9311. 605, in Pei'ai 64S it is valine 605 ( Figure 3 ). This differential site may lead to changes in protein function, and the TR4 gene is very likely to be a candidate gene for qTR4.

[0058] Example 2: Plant transformation and functional analysis

[0059] 1. Obtaining TR4 gene knockout mutants

[0060] 1. TR4 was knocked out using the pYLCRISPR / Cas9-MH gene editing vector (provided by Liu Yaoguang's research group at South China Agricultural University). The sequence CGACGACCTGAGCAAGGACA in the CDS region of the TR4 gene was selected as the editing target site (i.e., the editing target site sequence located in the second exon of the gene TR4) ( Figure 4 C). The primer sequences related to vector construction are as follows:

[0061] TR4-sgRNA-F: TGCATGTCCTGCTCAGGTCGTCG

[0062] TR4-sgRNA-R: AAACCGACGACCTGAGCAAGGACA

[0063] FR-F:CTCCGTTTTACCTGTGGAATCG

[0064] FR-R: CGGAGGAAAATTCCATCCAC

[0065] B1-F:TTCAGAGGTCTCTCTCGCACTGGAATCGGCAGCAAAGG

[0066] B1-R: GCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC

[0067] SP1: CCCGACATAGATGCAATAACTTC

[0068] SP2: GCGCGGTGTCATCTATGTTACT

[0069] The concentration of the above primers was 10uM.

[0070] 2. Steps for constructing TR4 gene knockout vector:

[0071] Preparation of target linker: 10 μl of each TR4-sgRNA-F and TR4-sgRNA-R primers were added to 80 μl of water, incubated at 94°C for 1 min, and cooled to room temperature to form primer dimers.

[0072] The reaction system for preparing the sgRNA expression cassette was as follows: 1 μl pYLgRNA-U3 plasmid (provided by Liu Yaoguang's research group at South China Agricultural University); 1 μl target linker; 0.5 μl restriction endonuclease BsaI (NEB); 0.5 μl T4 ligase (NEB); 1 μl T4Buffer; 6 μl ddH2O.

[0073] The reaction procedure for preparing the sgRNA expression cassette was as follows: (1) 37°C, 5 minutes; (2) 20°C, 5 minutes; steps (1)-(2) were repeated for 7 cycles.

[0074] The PCR reaction system for the first round of amplification of sgRNA expression cassette: 25 μl 2×Phanta Flash Master Mix (Nanjing Novogene); 2 μl sgRNA expression cassette; 1 μl each of primers FR-F and FR-R; 21 μl ddH2O.

[0075] The first round of amplification program was: (1) 95°C, 3 minutes; (2) 98°C, 10 seconds; (3) 60°C, 5 seconds; (4) 72°C, 20 seconds; (5) 72°C, 5 minutes; (6) 12°C, hold; steps (2)-(4) were repeated for 25 cycles.

[0076] The PCR reaction system for the second round of amplification of sgRNA expression cassette: 25 μl 2×Phanta Flash Master Mix (Nanjing Novogene); 2 μl first round amplification product; 1 μl each of primers B1-F and B1-R; 21 μl ddH2O.

[0077] The second round amplification program was: (1) 95°C, 3 minutes; (2) 98°C, 10 seconds; (3) 60°C, 5 seconds; (4) 72°C, 20 seconds; (5) 72°C, 5 minutes; (6) 12°C, hold; steps (2)-(4) were repeated for 25 cycles.

[0078] The sgRNA and pYLCRISPR / Cas9-MH gene editing vector were digested with restriction endonuclease BsaI at 37°C for 15 minutes. The digestion reaction system included: 1 μl of the second-round amplified sgRNA expression cassette; 1 μl of pYLCRISPR / Cas9-MH plasmid; 0.5 μl of restriction endonuclease BsaI (NEB); and 12.5 μl of ddH2O.

[0079] 0.5 μl of T4 ligase and 1.7 μl of T4 buffer were added to the product to carry out ligation-by-cleavage reaction. The reaction procedure was as follows: (1) 37°C, 5 minutes; (2) 10°C, 5 minutes; (3) 20°C, 5 minutes; (4) 12°C, hold; steps (1)-(3) were repeated for 20 cycles.

[0080] The above reaction products were transformed into Escherichia coli cells, and the transformed single colonies were identified by PCR. The reaction system was: 5 μl 2×Rapid Taq Master Mix (Nanjing Novozymes); a single colony was picked; 0.2 μl of primers SP1 and SP2 respectively; 4.6 μl ddH2O.

[0081] The amplification program was as follows: (1) 95°C, 3 minutes; (2) 95°C, 15 seconds; (3) 60°C, 15 seconds; (4) 72°C, 20 seconds; (5) 72°C, 5 minutes; (6) 12°C, hold; steps (2)-(4) were repeated for 35 cycles.

[0082] Primer SP2 sequencing was used to screen single colonies containing the TR4 gene-specific target sequence (ie, Seq ID No: 7), and the plasmid obtained by extraction was the desired recombinant knockout vector pYLCRISPR / Cas9-MH-TR4.

[0083] 3. The pYLCRISPR / Cas9-MH-TR4 with the TR4-specific target site was transformed into the rice variety Nipponbare, and the sequences at both ends of the target site were amplified using knockout identification primers and then sequenced for identification.

[0084] The knockout identification primer sequences are as follows:

[0085] TR4-CRISPR-F1:ATGGCTCGGTTTGGGGCGG

[0086] TR4-CRISPR-R1:TCTTCTTCTTGTTCTCGAGGAC

[0087] PCR reaction system for identification of mutant transgenic plants: 5 μl 2×Phanta Flash Master Mix (Nanjing Novogene); 2 μl transgenic plant leaf DNA; 0.2 μl each of primers TR4-CRISPR-F1 and TR4-CRISPR-R1; 2.6 μl ddH2O.

[0088] The amplification program was as follows: (1) 94°C, 4 minutes; (2) 98°C, 30 seconds; (3) 60°C, 30 seconds; (4) 68°C, 60 seconds; (5) 68°C, 5 minutes; (6) 12°C, hold; steps (2)-(4) were repeated for 35 cycles.

[0089] By comparing with Seq ID No: 1, the TR4 gene knockout mutants were obtained. The obtained gene knockout mutants TR4-KO1 and TR4-KO2 had insertion and deletion mutations, respectively ( Figure 4C), the amino acid sequences of the gene knockout mutants are shown in Seq ID No: 5 and Seq ID No: 6. The pYLCRISPR / Cas9 vector was used to identify primers to screen the plants without Cas9 tags in the offspring, thereby obtaining the rice TR4-KO1 and TR4-KO2 mutant plants with stable inheritance.

[0090] PCR reaction system for Cas9 tag identification of mutant transgenic plants: 5 μl 2×Rapid Taq Master Mix (Nanjing Novozymes); 2 μl transgenic plant leaf DNA; 0.2 μl each of primers Cas9-F and Cas9-R; 2.6 μl ddH2O.

[0091] The sequences of primers for Cas9 tag amplification are as follows:

[0092] Cas9-F:ACCAGACACGAGACGACTAA

[0093] Cas9-R:ATCGGTGCGGGCCTCTTC

[0094] The amplification program was as follows: (1) 95°C, 3 minutes; (2) 95°C, 15 seconds; (3) 60°C, 15 seconds; (4) 72°C, 20 seconds; (5) 72°C, 5 minutes; (6) 12°C, hold; steps (2)-(4) were repeated for 35 cycles.

[0095] When the amplification result shows that the positive control is present but the identification sample is not present, it is a stably inherited mutant rice and the offspring do not contain the Cas9 tag.

[0096] 2. Obtaining TR4 gene overexpression strains

[0097] The CDS sequence of the TR4 gene of 9311 (Seq ID No: 2) was amplified and ligated between the SacI restriction sites of the vector pCAMBIA1300-UBi (provided by Aibiwei Biotechnology Co., Ltd.) to obtain the pCAMBIA1300-UBi-TR4 fusion expression vector ( Figure 4 B) The correctly sequenced plasmid was transformed into the rice variety Nipponbare, and two overexpression transgenic lines were obtained through quantitative expression detection ( Figure 4 E). The primer sequences involved are as follows:

[0098] TR4-OVER-F: TGTTACTTCTGCAGGAGCTCATGGCTCGGTTTGGGGCG

[0099] TR4-OVER-R: CTCACCATGGATCCGGTACCCTTGTTCTTCTTCTTGTTCTCGAGG

[0100] TR4-F:ATGGCTCGGTTTGGGGCG

[0101] GFP-R: CTTCATGTGGTCGGGGTAGC

[0102] The PCR reaction system for amplifying the CDS sequence of the TR4 gene was as follows: 25 μl 2×Phanta Flash Master Mix (Nanjing Novogene); 2 μl cDNA obtained by reverse transcription of 9311 aerial total RNA; 1 μl each of primers TR4-OVER-F and TR4-OVER-R; and 21 μl ddH2O.

[0103] The amplification program was as follows: (1) 95°C, 3 minutes; (2) 98°C, 10 seconds; (3) 58°C, 5 seconds; (4) 72°C, 20 seconds; (5) 72°C, 5 minutes; (6) 12°C, hold; steps (2)-(4) were repeated for 35 cycles.

[0104] PCR reaction system for identification of overexpressing transgenic plants: 5 μl 2×Rapid Taq Master Mix (Nanjing Novozymes); 2 μl DNA from leaves of transgenic plants; 0.2 μl each of primers TR4-F and GFP-R; 2.6 μl ddH2O.

[0105] The amplification program was as follows: (1) 95°C, 3 minutes; (2) 95°C, 15 seconds; (3) 58°C, 15 seconds; (4) 72°C, 20 seconds; (5) 72°C, 5 minutes; (6) 12°C, hold; steps (2)-(4) were repeated for 35 cycles.

[0106] 3. Determination of TR4 gene expression in TR4 knockout mutants and overexpression strains

[0107] Through sequencing, it was found that the knockout transgenic strains had base insertion and deletion mutations after gene editing ( Figure 4 C). Compared with the wild type, the transcriptional expression level of the TR4 gene in the knockout plants was significantly decreased ( Figure 4 D), the transcriptional expression level of TR4 gene in overexpression plants increased significantly ( Figure 4 E).

[0108] IV. Investigation on the effective tiller number and yield per plant of TR4 gene knockout mutants and overexpression lines

[0109] The effective tiller number and yield per plant of TR4 gene knockout mutants and overexpression lines at maturity were determined in the transgenic nursery in Fuyang, Hangzhou. Figure 5 A). The results showed that the number of effective tillers of the TR4 gene knockout mutant was significantly reduced compared with the control Nipponbare ( Figure 5B), the yield per plant decreased significantly ( Figure 5 C); The effective tiller number of the TR4 gene overexpression strain was significantly increased compared with the control Nipponbare ( Figure 5 B), the yield per plant increased significantly ( Figure 5 C). This indicates that the TR4 gene can regulate rice tillering and yield.

[0110] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. The application of gene TR4 in rice tillering regulation is characterized by: The nucleotide sequence of gene TR4 is shown in Seq ID No:

1.

2. The use according to claim 1, characterized in that: The cDNA nucleotide sequences of gene TR4 are shown in Seq ID No: 2 and Seq ID No:

3.

3. The use according to claim 1 or 2, characterized in that: Overexpression of TR4 promotes the increase of effective tillers and yield per unit area of ​​rice.

4. The use according to claim 1 or 2, characterized in that: Knocking out TR4 results in a decrease in the number of effective tillers in rice.

5. A method for regulating rice tillering, characterized in that: The knockout vector and overexpression vector corresponding to the TR4 gene are transformed into monocotyledonous plant cells, and then the transformed monocotyledonous plant cells are cultivated into plants.

6. The method for regulating rice tillering according to claim 5, characterized in that: The knockout vector pYLCRISPR / Cas9-MH-TR4 was transformed into rice cells to obtain knockout mutants, and the number of effective tillers of the resulting rice was reduced; The overexpression vector pCAMBIA1300-UBi-TR4 was transformed into rice cells, and the number of effective tillers of the resulting rice increased.

Images