A co-expression recombinant vector, a recombinant strain and a method for enzymatically synthesizing 6-selenoguanine nucleotide

Abstract

The object of the present invention is to provide a co-expression recombinant vector, a recombinant strain and a method for enzymatically synthesizing 6-selenoguanine nucleotides, which belongs to the field of molecular biotechnology. The method provided by the present invention has the advantages of low cost, specificity, simplicity and rapidity, low requirements for reaction conditions, and no environmental pollution. The co-expression recombinant vector provided by the present invention can greatly improve YcfA or YcfA D166R / Y170N The recombinant strains constructed can be used to develop engineering strains for synthesizing 6Se-GTP, 6Se-GDP, 6Se-GMP and other compounds in bacteria, which has broad application prospects.

Description

Technical Field

[0001] The invention relates to the field of molecular biotechnology, and in particular to a co-expression recombinant vector, a recombinant strain and a method for enzymatically synthesizing 6-selenoguanine nucleotides. Background Art

[0002] 6-thioguanine (6-TG) is a widely used antimetabolite in clinical practice. As a prodrug, it can be converted into 6-thioguanine nucleotides (6TGN, including 6T-GTP, 6T-GDP, 6T-GMP, etc.). As an analog of deoxynucleotides, this type of compound participates in the mismatch repair system of DNA synthesis, and ultimately causes cell cycle arrest and apoptosis. Studies have found that compared with 6-TG and 6-thioguanosine (6-TGR), 6-selenoguanine (6-SeG) and 6-selenoguanosine (6-SeGR) have better anti-tumor effects in the treatment of mice with S108 ascites tumor (Sarcoma 180 ascites tumor). At the same time, 6-SeG has also been proven to have an inhibitory effect on lymphomas L1210, L-5178Y and other tumors. Therefore, the research on selenonucleotide compounds has important application prospects.

[0003] Currently, there are two methods to obtain 6-selenoguanosine-5'-phosphate (6-Se-GMP). Method 1: Chemical synthesis, using 6-SeGR as the raw material, and conventional phosphorylation reaction with phosphorus oxychloride and trimethyl phosphate. However, while obtaining the target compound, 2' phosphate, 3' phosphate, diphosphate, purine and other by-products will also be produced. Method 2: Using 6-SeG and 5-phosphoribosyl-pyrophosphate (PRPP, 5-phosphoribosyl pyrophosphate) as substrates, it is catalyzed by hypoxanthine-guaninephosphoribosyl transferase (HGPRT, hypoxanthine-guanine phosphoribosyl transferase) at 37°C overnight. Unfortunately, the substrates (6-SeGR and 6-SeG) required for these two methods are produced by few manufacturers (only AKScientific, Inc.; American Custom Chemicals Corporation.; Research Plus, lnc.; Carbone Scientific Co., LTD.; 3B Scientific Corporation.; Sigma-RBI.; Sigma-Aldrich Co. LLC, etc.), and are expensive. If more conventional compounds are used as starting materials, the entire synthesis path is more complicated and the yield is more inefficient. In addition to 6-Se-GMP, the chemical synthesis path and enzymatic synthesis method of 6-selenoguanosine-5'-triphosphate (6-Se-GTP) and 6-selenoguanosine-5'-diphosphate (6-Se-GDP) have not been found. Summary of the invention

[0004] The object of the present invention is to provide a co-expression recombinant vector, a recombinant strain and a method for enzymatically synthesizing 6-selenoguanine nucleotides, including 6Se-GTP, 6Se-GDP and 6Se-GMP. The method has the advantages of low cost, specificity, simplicity and rapidity, low requirements for reaction conditions, and no pollution to the environment.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a co-expression recombinant vector, comprising an initial vector, YjA Gene, mutant YjA D166R / Y170N Genes and YC Gene;

[0007] The nucleotide sequence of the ycfA gene is shown in SEQ ID NO.2;

[0008] The nucleotide sequence of the ycfC gene is shown in SEQ ID NO.4;

[0009] The mutant YjA D166R / Y170N The nucleotide sequence of the gene is shown in SEQ ID NO.5.

[0010] Preferably, the initial vector is a pET21b vector.

[0011] The present invention also provides a recombinant strain comprising the co-expression recombinant vector.

[0012] Preferably, the initial strain of the recombinant strain is Escherichia coli.

[0013] The present invention also provides the use of the co-expression recombinant vector or recombinant strain in the synthesis of 6-selenoguanine nucleotide.

[0014] The present invention also provides a method for enzymatically synthesizing 6-selenoguanine nucleotides, comprising the following steps:

[0015] YcfA protein or YcfA D166R / Y170N Protein, YcfC protein, L-selenocysteine, ATP and substrate are mixed to carry out enzymatic reaction to obtain 6-selenoguanine nucleotide;

[0016] The substrate is selected from one or more of GTP, GDP and GMP.

[0017] The present invention also provides a method for enzymatically synthesizing 6-selenoguanine nucleotides, comprising the following steps:

[0018] YcfA D166R / Y170N Protein, YcfC protein, L-selenocysteine, ATP and substrate are mixed to carry out enzymatic reaction to obtain 6-selenoguanine nucleotide;

[0019] The substrate is selected from one or more of GTP, GDP and GMP.

[0020] Preferably, the YcfA protein, YcfA D166R / Y170N The protein and / or YcfC protein are expressed and purified by the above-mentioned co-expression recombinant vector or the above-mentioned recombinant strain.

[0021] Preferably, the reaction system of the enzymatic reaction comprises the following components at final concentrations:

[0022] YcfA protein 8-12 μM;

[0023] YcfC protein 4-6 μM;

[0024] ATP 400~600μM;

[0025] L-SeCys 400~600μM;

[0026] Substrate 400~600μM.

[0027] Preferably, the reaction system of the enzymatic reaction comprises the following components at final concentrations:

[0028] Yj Y D166R / Y170N Protein 8~12μM;

[0029] YcfC protein 4-6 μM;

[0030] ATP 400~600μM;

[0031] L-SeCys 400~600μM;

[0032] Substrate 400~600μM.

[0033] Preferably, the temperature of the enzymatic reaction is 0-30° C., and the time of the enzymatic reaction is more than 1 hour.

[0034] The present invention also provides 6-selenoguanine nucleotide synthesized by the method.

[0035] Beneficial effects of the present invention:

[0036] The co-expression recombinant vector provided by the present invention can greatly increase the expression of YcfA or YcfA D166R / Y170N The recombinant strains constructed can be used to develop engineering strains for synthesizing 6Se-GTP, 6Se-GDP, 6Se-GMP and other compounds in bacteria, which has broad application prospects.

[0037] The present invention provides a method for preparing a method for preparing a biopharmaceutical by using YcfA / YcfC double enzyme and YcfA D166R / Y170N -YcfC dual enzyme enzymatic synthesis of 6Se-GTP, 6Se-GDP, 6Se-GMP and other compounds, compared with the existing technical route of chemical synthesis of 6Se-GTP, 6Se-GDP, 6Se-GMP, this enzymatic method has the advantages of low cost, specificity, simplicity and rapidity, low requirements for reaction conditions, and no pollution to the environment. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1The reaction diagram for the production of selenonucleotides by L-SeCys and GTP / GDP / GMP catalyzed by YcfA and YcfC proteins;

[0039] Figure 2 YcfC, YcfA, YcfA D166R / Y170N The results of SDS-PAGE gel testing of protein purity;

[0040] Figure 3 This is the result diagram of the characteristic absorption peak of 6Se-GTP, λ=360nm;

[0041] Figure 4 It is the HPLC detection diagram of the enzymatic reaction product, and the detection wavelength λ=360nm;

[0042] Figure 5 This is the high-resolution mass spectrometry detection result diagram of 6Se-GTP (negative ion mode), in which the molecular ion peak (m / z) is 585.9059; the isotope peaks include 583.9067, 581.9085, 587.9063, 582.9093, 586.9089, 584.9100, etc.;

[0043] Figure 6 This is the high-resolution mass spectrometry detection result of 6Se-GDP (negative ion mode), where the molecular ion peak (m / z) is 505.9390; the isotope peaks include 503.9390, 501.9408, 507.9395, 502.9420, etc.;

[0044] Figure 7 This is the high-resolution mass spectrometry detection result of 6Se-GMP (negative ion mode), in which the molecular ion peak (m / z) is 425.9729; the isotope peaks include 423.9737, 427.9736, 422.9768, 426.9757, 424.9781, etc.

[0045] Figure 8 YcfA D166R / Y170N -YcfC dual enzyme system compared to the ability of YcfA-YcfC dual enzyme system to generate 6-Se-GTP. DETAILED DESCRIPTION

[0046] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0047] The reagents used in the examples are as follows:

[0048] LB liquid medium (1 L): weigh 10 g of tryptone, 10 g of NaCl, and 5 g of yeast extract, add deionized water and make up to 1 L, and sterilize at 121°C for 20 min.

[0049] LB solid medium (100 ml): weigh 1 g of tryptone, 1 g of NaCl, 0.5 g of yeast extract, and 1.5 g of agar into a 100 ml conical flask, add ultrapure water to make up to 100 ml, sterilize at 121 °C for 20 min, take out and cool to about 50 °C, add corresponding antibiotics, pour into a sterile culture dish, and after complete solidification, place at 4 °C for use.

[0050] MHB liquid culture medium (1 L): Weigh 24 g of purchased MH broth (MHB) solid powder, add ultrapure water to make up to 1 L, and sterilize by high pressure at 121°C for 20 min.

[0051] 100mg / ml ampicillin (50ml): Weigh 5g of ampicillin powder, add ultrapure water to make up to 50ml, filter with a 0.22um sterile filter, and store at -20℃.

[0052] 1M IPTG (isopropyl-β-D-thiogalactoside, 50ml): weigh 11.9g IPTG powder, add ultrapure water to 50ml, and store at -20℃.

[0053] 100mM PMSF (phenylmethylsulfonyl fluoride, 50ml): Weigh 0.87g PMSF, dissolve in 50ml anhydrous ethanol, and store at -20℃.

[0054] Resuspension buffer: 200 mM NaCl, 15 mM HEPES pH 8.0, 10% glycerol. After preparation, filter through a 0.22 μm filter membrane and store at 4°C for later use.

[0055] Anion exchange column chromatography buffer A (15 mM HEPES pH8.0, 10% glycerol) and anion exchange column chromatography buffer B (15 mM HEPES pH8.0, 2M NaCl, 10% glycerol) were filtered through a 0.22 μm filter membrane and stored at 4 °C for future use.

[0056] Gel exclusion chromatography buffer: 100 mM NaCl, 15 mM Hepes pH8.0, 10% glycerol, 10 mM MgCl2. After preparation, filter through a 0.22 μm filter membrane and store at 4°C for future use.

[0057] 100mM L-SeCys (L-Selenocysteine, 10ml): Weigh 0.168g Se-Cys, dissolve in ultrapure water and dilute to 10ml, store in aliquots at -80℃.

[0058] 100mM ATP (adenosine-5'-triphosphate disodium salt, 10ml): weigh 0.605g ATP solid powder, dissolve it in ultrapure water and make up to 10ml, divide it into aliquots and store at -80℃.

[0059] 100mM GTP (Guanosine-5'-triphosphate disodium salt, 10ml): Weigh 0.547g GTP solid powder, dissolve in ultrapure water and dilute to 10ml, divide into aliquots and store at -80℃.

[0060] 100mM GDP (guanosine-5'-diphosphate disodium salt, 10ml): Weigh 0.467g GDP solid powder, dissolve in ultrapure water and make up to 10ml, divide into aliquots and store at -80℃.

[0061] 100mM GMP (5'-guanylate disodium salt, 10ml): Weigh 0.387g GMP solid powder, dissolve in ultrapure water and make up to 10ml, divide into aliquots and store at -80℃.

[0062] YcfA / YcfC dual enzyme reaction buffer: 100mM NaCl, 15mM NaAC, 12mM MgCl2.

[0063] HPLC buffer A: Prepare 30mM triethylamine acetate and 10mM tetrabutylammonium hydrogen sulfate in a 1L reagent bottle, and adjust the pH to 7.5 with triethylamine / acetic acid. After preparation, filter through a 0.22μm filter membrane and store at room temperature for later use.

[0064] HPLC buffer B: methanol.

[0065] Protein expression and purification related strains: E. coli BL21(DE3) cells;

[0066] Example 1

[0067] The present invention utilizes YcfA or YcfA D166R / Y170N The reaction equation of protein and YcfC protein catalyzing L-SeCys and GTP / GDP / GMP to generate selenonucleotides is as follows Figure 1 As shown, Figure 1 6Se-GTP, R=(HPO3)3H; 6Se-GDP, R=(HPO3)2H; 6Se-GMP, R=(HPO3)H.

[0068] YcfA (or YcfA D166R / Y170N ) and expression and purification of YcfC protein:

[0069] YjA Original nucleotide sequence of the gene:

[0070] , as shown in SEQ ID NO.1

[0071] YjA Nucleotide sequence after gene codon optimization

[0072] ACCAATCAGTATAGCGTGAAACCGCAGCTGGTGATGTTTACCGGCGGCCGCGATAGCACCCTGGCGGCGTGCTATCTGATGCTGCAAGGCATTCCGGTGCATCTGTGGAGCGGCAACAGCGGCTGCAGCCTGCATCGCGGCATTCTGAGCCATCGCGTGGAAGAAATGAAAAACCGCTTTGGCGATCTGGTGGTGGGCCATACCGTGGCGGATATTAGCGGCGCGTTTCGCAGCATTGCGATTGAAGCGCTGGAACAAGATATTCTGAAATATCGCAAAAACCTGGTGCTGCTGGGCGAAAAACTGGCGATTCATGCGCATCTGGTGGATTTTTGCCGCCGCAACGATATTAACACCATTAACGATGGCATTACCCATTATCAGATGGAATTTCCGGAACAGCGCCTGGTGGCGAAAACCTTTCTGATGGAAATGATGGCGCAGTATGATATTAACTATCAGAGCCCGGTGTATGAATTTGCGCAGAGCGCGGATGATGTGAAATATCGCCTGCTGCAGCTGGGCATTAGCACCAAAAGCCTGGAAGGCATTAGCATTTTTGCGGATAGCTTTAGCACCCCGAGCGATGATGTGGTGCTGGCGTATCTGCGCGAAAAAGCGCCGCTGGCGCATAACATTGTGAACTTTCTGGCGGGCGAAACCCTGAACCCGCCGGTGCTGAACAACAGCGCGGCCGCG, as shown in SEQ ID NO. 2;

[0073] YC The original nucleotide sequence of the gene:

[0074] GATGCCTCCTCCCTTTCCCCGCAGTTGCAGCAGGTGCACGGCGATCGGTTTTATAAGCGAGTCAATATGCTAAAAGACGAACTTCGTGAAGAGCTTACACGGGTATACCGACTACATGATTACGATCTGTTTTTCGTCCAGTCGGTGCGCGTTGGGTTAGTGATCCTTTCACACCTGTTCTACAAGCAGGAAACCTCTTTATGCCTGGCGAAGCATGCGCATTACAAACCCATCAGTGAACTGTTTAACTCATCTTCAGCGCATGCCAGCGTGCCGGGCAGCGTACCGATTATTACCCACGTTAGCCCTTACACGGGGGAAGTTAACAGTCTGCAAGATTGCAAAGGGAAAGGGGTTGTTGATGCGTCTCACAGTTTCGCCACTAATCGCCACGCCGAGCTGATCGCAGAGAGTTCGGTGTTTGTCGCCCCCTTGCATAAACACGCTTCATTGACCGTTGGGCTGGCGATCGTTGCTTTACGCTCTGAACACTTCAGCACGCTGATGCGTAGCGAATTACGCCTGTTTGAAGAGTCCACCTCTTCAGACAAGCCGCTGGAAGAAGCGCTCGACAATGTGCGCAGTCACAGCTGGCAGCCCTTTAATGTTGCCCAGGTTCGGCCGGTTGAAATCAAGGATGCAGCGGGGATGGACTTTTGCTCTATCAGCGCACCGGACTTGCCATTCTGCTGCTTCCCTGTACCCACGCTAAGCGCCACACGGCAACAGCAGGTTAAGAAAGCCGGTGCCACTTATTTCCCCCATACCAACACGGTGCGATTGTCGTGTTGGGTGCGTGGCGATGGCAGTCAGCGGGTGGATATGACCAAACAGGTAGAGCAAGATTTGATTGCATTATGGGAGGGAAAA, as shown in SEQ ID NO.3;

[0075] YC The nucleotide sequence after gene codon optimization:

[0076] GATGCGAGCAGCCTGAGCCCGCAGCTGCAGCAAGTGCATGGCGATCGCTTTTATAAACGCGTGAACATGCTGAAAGATGAACTGCGCGAAGAACTGACCCGCGTGTATCGCCTGCATGATTATGATCTGTTTTTTGTGCAGAGCGTGCGCGTGGGCCTGGTGATTCTGAGCCATCTGTTTTATAAACAAGAAACGAGCCTGTGCCTGGCGAAACATGCGCATTATAAACCGATTAGCGAACTGTTTAACAGCAGTAGCGCGCATGCGAGCGTGCCGGGCAGCGTGCCGATTATTACCCATGTGAGCCCGTATACCGGCGAAGTGAACAGCCTGCAAGATTGCAAAGGCAAAGGCGTGGTGGATGCGAGCCATAGCTTTGCGACCAACCGCCATGCGGAACTGATTGCGGAAAGCAGCGTGTTTGTGGCGCCGCTGCATAAACATGCGAGCCTGACCGTGGGCCTGGCGATTGTGGCGCTGCGTAGCGAGCATTTTAGCACCCTGATGCGCAGCGAACTGCGCCTGTTTGAAGAAAGCACGAGCAGCGATAAACCGCTGGAAGAAGCGCTGGATAACGTGCGCAGCCATAGCTGGCAGCCGTTTAACGTGGCGCAAGTGCGCCCGGTGGAAATTAAAGATGCGGCGGGCATGGATTTTTGCAGCATTAGCGCGCCGGATCTGCCGTTTTGCTGCTTTCCGGTGCCGACCCTGAGCGCGACCCGTCAGCAACAAGTGAAAAAAGCGGGCGCGACCTATTTTCCGCATACCAACACCGTGCGCCTGAGCTGCTGGGTGCGCGGCGATGGCAGTCAGCGCGTGGATATGACCAAACAAGTGGAACAAGATCTGATTGCGCTGTGGGAAGGCAAA as shown in SEQ ID NO.4;

[0077] Mutant YjA D166R / Y170N Nucleotide sequence of the gene:

[0078] As shown in SEQ ID NO.5;

[0079] pET21b was used as YjA (or YjA D166R / Y170N )and YC The expression vectors of the two genes were transformed into the prokaryotic expression system of E. coli BL21 (DE3) by heat shock method. E. coliBL21 (DE3) competent cells were plated on LB solid culture plates containing ampicillin and cultured at 37°C overnight. Several monoclonal colonies were selected and placed in 10ml LB liquid culture medium containing 1mg / ml ampicillin, and cultured at 37°C, 220rpm for about 4h. The above bacterial culture solution was transferred to 1L LB liquid culture medium containing the corresponding antibiotics, cultured at 37°C, 220rpm, and added with a final concentration of 200μM IPTG when OD600=0.6, and cultured at 16°C, 180rpm for 16h. The bacteria were collected using a low-temperature high-speed centrifuge (4°C, 3800rpm, 15min), and resuspension buffer and a final concentration of 1mMPMSF protease inhibitor were added, and the bacteria were fully suspended on a vortex oscillator. The cell suspension was crushed with a high-pressure crusher until it was clear and transparent, and the supernatant was collected by low-temperature high-speed centrifugation (4°C, 15000rpm, 30min). The supernatant was purified by affinity chromatography, anion exchange chromatography, gel exclusion chromatography, etc. The protein purity was tested by SDS-PAGE gel, such as Figure 2 As shown, the size of YcfC protein is 32KDa, and YcfA (or YcfA D166R / Y170N ) The protein size is 26KDa.

[0080] The enzymatic reaction system was prepared according to Table 1 (Note: when GTP was used as substrate, the enzymatic reaction product was 6Se-GTP; when GDP was used as substrate, the enzymatic reaction product was 6Se-GDP; when GMP was used as substrate, the enzymatic reaction product was 6Se-GMP). After reacting at 30°C for 2 h, the enzymatic reaction was terminated with 80% methanol-water (v / v).

[0081] Table 1 Reaction system for generating 6Se-GTP, 6Se-GDP and 6Se-GMP by enzymatic reaction

[0082]

[0083] like Figure 3 As shown, the red line represents the ultraviolet absorption with the participation of all components in Table 1. The 6-selenonucleotide compounds have a characteristic absorption peak at 360nm. After the reaction is completed, the reaction system can be detected by a spectrophotometer at λ=360nm to preliminarily determine whether the target product is generated.

[0084] Identification of 6Se-GTP, -GDP, and -GMP by high performance liquid chromatography and high resolution mass spectrometry.

[0085] High performance liquid chromatography (HPLC) was used to detect YcfC (or YcfA D166R / Y170N The product of the enzymatic reaction catalyzed by YcfA.

[0086] Detection parameters: ①HPLC equipment: Shimadzu LC-2030; ②Chromatographic column: Prodigy ODS-3 (specification 5μm, 100Å, 250×4.6 mm); ③Detection wavelength: λ=360nm; ④Flow rate: 1ml / min; ⑤HPLC elution procedure, 0.5% buffer B for 10min; solution B increased from 0.5% to 70% within 23min; after 5min, solution B increased from 70% to 99%.

[0087] HPLC test results are as follows Figure 4 The high-resolution mass spectrometry results are shown in Figure 5 , 6 7. YcfA-YcfC dual enzyme system and YcfA D16R / Y170N The yield comparison of 6-selenoguanine nucleotide generated by the -YcfC dual enzyme system is shown in Figure 8 .

[0088] Antibacterial ability of 6Se-GTP, -GDP, -GMP

[0089] The broth microdilution method was used to detect the effects of 6Se-GTP, -GDP, -GMP on multiple clinical drug-resistant bacteria (including Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonase aeruginosa, Carbapenem-resistant Escherichia coli, Vancomycin- resistant Enterococcus faecalis ) Whether it has antibacterial function. The minimum inhibitory concentration (MIC) of 6Se-GTP against various clinical drug-resistant bacteria is shown in Table 2. 6Se-GTP can effectively inhibit the growth of various drug-resistant Staphylococcus aureus.

[0090] Table 2 Antibacterial ability of 6Se-GTP against various clinical drug-resistant bacteria

[0091]

[0092] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A co-expression recombinant vector, characterized in that: Including the initial carrier, YjA Genes and YC Gene; Or, the co-expression recombinant vector includes an initial vector, YC Genes and mutants YjA D166R / Y170N Gene; Said YjA The nucleotide sequence of the gene is shown in SEQ ID NO.2; Said YC The nucleotide sequence of the gene is shown in SEQ ID NO.4; The mutant YjA D166R / Y170N The nucleotide sequence of the gene is shown in SEQ ID NO.

5.

2. The co-expression recombinant vector according to claim 1, characterized in that: The initial vector is pET21b vector.

3. A recombinant strain comprising the co-expression recombinant vector according to claim 1 or 2.

4. The recombinant strain according to claim 3, characterized in that The initial strain of the recombinant strain is Escherichia coli.

5. Use of the co-expression recombinant vector according to claim 1 or 2 or the recombinant strain according to claim 3 or 4 in the synthesis of 6-selenoguanine nucleotides; The 6-selenoguanine nucleotide is selected from 6Se-GTP, 6Se-GDP or 6Se-GMP.

6. A method for enzymatically synthesizing 6-selenoguanine nucleotides, characterized in that: The following steps are involved: YcfA protein, YcfC protein, L-selenocysteine, ATP and substrate are mixed to carry out enzymatic reaction to obtain 6-selenoguanine nucleotide; The substrate is selected from one or more of GTP, GDP and GMP; The 6-selenoguanine nucleotide is selected from 6Se-GTP, 6Se-GDP or 6Se-GMP; The YcfA protein and / or YcfC protein is expressed and purified by the co-expression recombinant vector according to claim 1 or 2 or the recombinant strain according to claim 3 or 4.

7. A method for enzymatically synthesizing 6-selenoguanine nucleotides, characterized in that: The following steps are involved: YcfA D166R / Y170N Protein, YcfC protein, L-selenocysteine, ATP and substrate are mixed to carry out enzymatic reaction to obtain 6-selenoguanine nucleotide; The substrate is selected from one or more of GTP, GDP and GMP; The 6-selenoguanine nucleotide is selected from 6Se-GTP, 6Se-GDP or 6Se-GMP; YcfA D166R / Y170N The protein and / or YcfC protein are expressed and purified by the co-expression recombinant vector described in claim 1 or 2 or the recombinant strain described in claim 3 or 4.

8. The method for enzymatically synthesizing 6-selenoguanine nucleotide according to claim 6, characterized in that: The reaction system of the enzymatic reaction includes the following components at final concentrations: YcfA protein 8-12 μM; YcfC protein 4-6 μM; ATP 400~600μM; L-SeCys 400~600μM; Substrate 400~600μM; And / or, the temperature of the enzymatic reaction is 0-30° C., and the time of the enzymatic reaction is more than 1 hour.

9. The method for enzymatically synthesizing 6-selenoguanine nucleotide according to claim 7, characterized in that: The reaction system of the enzymatic reaction includes the following components at final concentrations: Yj Y D166R / Y170N Protein 8~12μM; YcfC protein 4-6 μM; ATP 400~600μM; L-SeCys 400~600μM; Substrate 400~600μM; And / or, the temperature of the enzymatic reaction is 0-30° C., and the time of the enzymatic reaction is more than 1 hour.

Images