Application of soybean GmSTM17 gene in regulation and control of soybean cotyledonary node organogenesis

Abstract

The invention discloses application of a soybean GmSTM17 gene in regulation and control of soybean cotyledonary node organogenesis, and belongs to the technical field of biological breeding. In order to improve the regeneration potential in the soybean cotyledonary node organ generation process, the invention provides a method for regulating and controlling soybean cotyledonary node organ generation, the method comprises regulating and controlling receptor soybean cotyledonary node organ generation by regulating and controlling the expression of a GmSTM17 protein coding gene in receptor soybean, and the amino acid sequence of the GmSTM17 protein is sequence 3. The invention also provides an application of the GmSTM17 protein in regulating and controlling the regeneration capacity of plant tissues. The invention discloses that the GmSTM17 gene has an inhibiting effect on the growth and development of cluster bud meristem cells, so that the regeneration potential, the regeneration efficiency and the regeneration rate of soybean cotyledonary node explants are regulated and controlled in a negative feedback manner. And a theoretical basis is provided for further analyzing a soybean regeneration mechanism and cultivating a soybean variety with high regeneration capacity.

Description

Technical Field

[0001] The invention belongs to the technical field of biological breeding, and in particular relates to application of a soybean SHOOT MERISTEMLESS gene (GmSTM17) in regulating the occurrence of soybean cotyledon node organs. Background Art

[0002] Soybean is currently recognized as one of the crops that is difficult to genetically transform. The main reason affecting its genetic transformation is that the regeneration of soybean explants is difficult. Similarly, how to obtain a stable and efficient regeneration system is also a prerequisite for genetic transformation. The tissue culture regeneration system of soybean mainly has two induction pathways: organogenesis and somatic embryogenesis. The two pathways have different genetic bases and need to be combined with different genetic transformation methods for transgenic work. Among them, organogenesis refers to the process of regenerating adventitious roots or adventitious buds on the organs of plants that have been separated or injured. Organogenesis is divided into direct organogenesis pathway and indirect organogenesis pathway. The main difference between the two is whether there is the formation of non-embryonic callus: in the indirect organogenesis pathway, non-embryonic callus develops into root apex or stem apex meristem, and then develops into root apex or stem apex. The indirect organogenesis pathway is more commonly used in plant tissue culture such as Arabidopsis. The direct organogenesis pathway does not form callus. For example, in the direct organogenesis of the root, the root founder cell directly develops into the root primordium, and then develops into adventitious roots or lateral roots. The direct organogenesis pathway is often adopted in soybean organogenesis. Therefore, how to select receptor materials with high-efficiency regeneration ability under the existing technical background of soybean genetic transformation is one of the effective ways to improve the efficiency of soybean genetic transformation.

[0003] STM is a type of KNOX protein. STM protein was first detected in the stem meristem in 1996. Studies have shown that STM genes are expressed in the stem meristem, including stem cells, OCs, and amplified daughter cells that are in transition before forming organ primordia. STM genes have been widely studied in Arabidopsis, but less studied in soybean. Therefore, it is necessary to study the function of soybean STM genes to further clarify the mechanism of soybean regeneration. Summary of the invention

[0004] The technical problem to be solved by the present invention is: how to improve the regeneration potential in the process of soybean cotyledon node organogenesis.

[0005] In order to solve the above technical problems, in a first aspect, the present invention provides a method for regulating the occurrence of soybean cotyledonary node organs, the method comprising regulating the occurrence of the recipient soybean cotyledonary node organs by regulating the expression of a GmSTM17 protein encoding gene in a recipient soybean or regulating the activity or content of the GmSTM17 protein,

[0006] The GmSTM17 protein is any one of the following proteins a1)-a3):

[0007] a1) the amino acid sequence is the protein shown in SEQ ID No.3;

[0008] a2) a protein obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in a1) and having more than 80% identity with the amino acid sequence shown in a1) and related to the GmSTM17 protein;

[0009] a3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a1) or a2).

[0010] Furthermore, in the method described above, the GmSTM17 protein is derived from soybeans.

[0011] SEQ ID No. 3 consists of 375 amino acid residues.

[0012] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0013] The protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a Flag protein tag, a His protein tag, an MBP protein tag, an HA protein tag, a myc protein tag, a GST protein tag and / or a SUMO protein tag, etc.

[0014] Furthermore, the method comprises promoting the cotyledon node organogenesis of the recipient soybean by down-regulating, reducing or inhibiting the expression of the GmSTM17 protein encoding gene or the activity or content of the GmSTM17 protein in the recipient soybean.

[0015] To solve the above technical problems, in a second aspect, the present invention provides a method for preparing soybeans with improved regeneration ability, the method comprising down-regulating, reducing or inhibiting the expression of the GmSTM17 protein encoding gene or the activity or content of the GmSTM17 protein in the recipient soybean, thereby obtaining the target soybeans with higher regeneration ability than the recipient soybeans.

[0016] Furthermore, the method includes introducing a sgRNA gene targeting the gene encoding the above-mentioned GmSTM17 protein and a gene encoding the Cas protein into the recipient soybean to downregulate, reduce or inhibit the expression of the GmSTM17 protein encoding gene or the activity or content of the GmSTM17 protein in the recipient soybean, so as to promote the occurrence of cotyledon node organs of the recipient soybean or obtain the target soybean with higher regeneration ability than the recipient soybean.

[0017] Furthermore, in the method, the target sequence of the sgRNA gene is SEQ ID No. 1, positions 1514-1533 (5'-ACAAAACCAGCACTAACACT-3').

[0018] Furthermore, the method in the embodiment of the present invention can be implemented by any of the following methods M1)-M8):

[0019] M1), replacing 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 1 positions 1514-1533) in the GmSTM17 gene in the soybean genome with 5'-ACAAAACCAGCACACT-3' (SEQ ID No. 4), thereby knocking out the GmSTM17 gene;

[0020] M2), replacing 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome with 5'-ACAAAACCAGCACTAAACT-3' (SEQ ID No. 5), thereby knocking out the GmSTM17 gene;

[0021] M3), replacing 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 1 positions 1514-1533) in the GmSTM17 gene in the soybean genome with 5'-ACAAAACCAGCACAACT-3' (SEQ ID No. 6), thereby knocking out the GmSTM17 gene;

[0022] M4), replacing 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 1 positions 1514-1533) in the GmSTM17 gene in the soybean genome with 5'-ACAAAACCAGCGACTAACACT-3' (SEQ ID No. 7), thereby knocking out the GmSTM17 gene;

[0023] M5), replacing 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 1 positions 1514-1533) in the GmSTM17 gene in the soybean genome with 5'-ACAAAACCAGCACACT-3' (SEQ ID No. 8), thereby knocking out the GmSTM17 gene;

[0024] M6), replacing 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome with 5'-ACAAACT-3', thereby knocking out the GmSTM17 gene;

[0025] M7), replacing 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 1 positions 1514-1533) in the GmSTM17 gene in the soybean genome with 5'-ACAAAACCAGCTT-3' (SEQ ID No. 9), thereby knocking out the GmSTM17 gene;

[0026] M8), replacing 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 1 positions 1514-1533) in the GmSTM17 gene in the soybean genome with 5'-ACAACAACAACACT-3' (SEQ ID No. 10), thereby knocking out the GmSTM17 gene.

[0027] In order to solve the above technical problems, in a third aspect, the present invention provides the use of GmSTM17 protein or a biomaterial related to the GmSTM17 protein in any of the following items:

[0028] A1) Application in regulating the regeneration capacity of plant tissues;

[0029] A2) Application in the preparation of products for regulating the regeneration capacity of plant tissues;

[0030] A3) Application in regulating the occurrence of cotyledonary node organs in soybean plants;

[0031] A4) Application in the preparation of products for regulating the occurrence of cotyledonary node organs in soybean plants;

[0032] A5) Application in plant breeding or plant assisted breeding.

[0033] Furthermore, in the application, the purpose of plant breeding described in A5) is to cultivate plants with improved tissue regeneration ability, such as soybeans with improved tissue regeneration ability or soybeans with higher cotyledon node organogenesis potential or regeneration efficiency.

[0034] Furthermore, in the application, the substance that regulates the expression of the protein encoding gene or the substance that regulates the activity or content of the protein is a biological material, and the biological material is any one of the following:

[0035] B1), a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the GmSTM17 protein or the activity or content of the GmSTM17 protein;

[0036] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0037] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0038] B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0039] B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0040] B6), transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0041] B7), a transgenic plant organ containing the nucleic acid molecule described in B1), a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3);

[0042] B8), a nucleic acid molecule encoding the above-mentioned GmSTM17 protein;

[0043] B9), an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ containing the nucleic acid molecule described in B8).

[0044] Furthermore, in the application, the nucleic acid molecule in B1) may be a DNA molecule expressing an sgRNA targeting the above-mentioned protein-coding gene or an sgRNA targeting the above-mentioned protein-coding gene.

[0045] B8) The nucleic acid molecule is a DNA molecule as shown in any one of g1) to g3) below:

[0046] g1), a DNA molecule whose coding sequence of the coding strand is SEQ ID No.2;

[0047] g2), a DNA molecule whose nucleotide sequence of the coding strand is SEQ ID No.1;

[0048] g3) A DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and encodes the GmSTM17 protein.

[0049] Furthermore, in the application, the expression cassette described in B2) refers to DNA capable of expressing the sgRNA gene targeting the gene encoding the above-mentioned GmSTM17 protein and the gene encoding the Cas protein in the host cell.

[0050] Furthermore, in the application, the recombinant vector in B3) is a recombinant expression vector PGES401-GmSTM17-Target.

[0051] Furthermore, in the application, the recombinant microorganism in B4) can specifically be yeast, bacteria, algae and fungi.

[0052] Furthermore, in the application, the plant tissue in B6) may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos and anthers.

[0053] Furthermore, in the application, the transgenic plant organ in B7) can be the root, stem, leaf, flower, fruit and seed of the transgenic plant.

[0054] Furthermore, in the application, the transgenic plant cell line, transgenic plant tissue and transgenic plant organ described in B5) may or may not include propagation materials.

[0055] Further, in the application, the identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST webpage on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting the Gap existence cost, Per residue gapcost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences for calculation, the identity value (%) can be obtained.

[0056] In the above applications, the above 80% identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0057] Furthermore, in the application, the plant is selected from any one of the following:

[0058] C1), dicotyledonous plants;

[0059] C2), Leguminosae;

[0060] C3) Soybean plants

[0061] C4) soybeans.

[0062] In order to solve the above technical problems, in a fourth aspect, the present invention provides the GmSTM17 protein in the above application and / or the biomaterial in the above application.

[0063] In the present invention, the regulation of soybean cotyledon node organogenesis or regulation of soybean tissue regeneration capacity can specifically be to improve or promote soybean cotyledon node organogenesis or improve or promote soybean tissue regeneration capacity. Specifically, the evaluation indexes of soybean cotyledon node organogenesis (or soybean regeneration capacity) include: regeneration potential (RP), regeneration efficiency (RE) and / or regeneration rate (RR). Among them, the identification standard of regeneration potential (RP) is the proportion of explants that produce obvious clustered bud primordia in the explants; the identification standard of regeneration efficiency (RE) is the ratio of the number of elongated clustered buds produced by the explants to the number of explants; the identification standard of regeneration rate (RR) is the ratio of the number of rooted clustered buds to the total number of explants.

[0064] The beneficial technical effects achieved by the present invention are as follows:

[0065] 1. This study found that the regeneration potential, regeneration efficiency and regeneration rate of mutant explants were significantly improved. At the same time, scanning electron microscopy analysis of the clustered bud meristem cells of mutant explants at the SIM14 stage showed that the size of clustered bud meristem cells was significantly increased after editing the GmSTM17 gene.

[0066] 2. This study shows that the GmSTM17 gene has an inhibitory effect on the growth and development of cluster shoot meristem cells, thereby negatively feedback-regulating the regeneration potential, regeneration efficiency and regeneration rate of soybean cotyledonary node explants, providing a theoretical basis for further analyzing the soybean regeneration mechanism and cultivating soybean varieties with high regeneration ability.

[0067] 3. In order to break through the bottleneck of soybean genetic transformation and deeply reveal and explore the soybean regeneration regulation mechanism and influencing factors, this study took the soybean STM gene family member GmSTM17 (Glyma.15g111900) as the research object, and used CRISPR / Cas9 technology to obtain T2 generation homozygous gene knockout mutants (stm17-2, stm17-6 and stm17-7). The phenotypes related to the organogenesis of soybean cotyledon nodes were identified, and the wild-type soybean Dongnong 50 was used as the control (CK). The results showed that the regeneration potential, regeneration efficiency and regeneration rate of the GmSTM17 gene-edited mutant soybean line were significantly improved. These results show that the GmSTM17 gene negatively feedbacks the regeneration potential, regeneration efficiency and regeneration rate in the process of soybean cotyledon node organogenesis, and can be used to cultivate new soybean materials that are not genotype-restricted. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] Figure 1 To analyze the expression pattern of GmSTM17 gene during the critical period of soybean cotyledon node organogenesis;

[0069] Figure 2 for soybean genetic transformation process;

[0070] Figure 3 For T0 generation transformation event detection;

[0071] Figure 4 Screening of primer limit annealing temperature for mutant detection;

[0072] Figure 5 For T1 generation homozygous mutant detection;

[0073] Figure 6 These are soybean GmSTM17 mutant explants at the SIM14 stage;

[0074] Figure 7 To identify the regeneration potential of soybean GmSTM17 mutant;

[0075] Figure 8 These are soybean explants at the SEM14 stage of cotyledon node organogenesis;

[0076] Fig. 9 To identify the regeneration efficiency of soybean GmSTM17 mutant;

[0077] Fig.10 To identify the regeneration rate of soybean GmSTM17 mutant;

[0078] Fig.11 Scanning electron microscopy analysis of the shoot meristem cells of the soybean GmSTM17 mutant. DETAILED DESCRIPTION

[0079] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0080] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0081] Soybean seeds Dongnong 50 (also known as DN50) are kept in our laboratory and are described in the literature “Ying Zhao etc. Enhanced production of seed oil with improved fatty acid composition by overexpressing NAD + -dependent glycerol-3-phosphate dehydrogenase in soybean. Journal of Integrative Plant Biology (IF9.106) Pub Date: 2021-03-26, DOI: 10.1111 / jipb.13094" (recorded as DN50 in the document). The public can obtain the above-mentioned biomaterial from the applicant. The obtained biomaterial can only be used for the verification of the embodiments of this application and cannot be used for other purposes.

[0082] Soybean seeds Suinong 14 (also known as SN14) are preserved in our laboratory and are listed in the literature “Haiyang Zheng etc Construction of Chromosome Segment Substitution Lines and Inheritance of Seed-Pod Characteristics in Wild Soybean. Front. Plant Sci. (IF5.6) Pub Date: 2022-6-17, DOI: 10.3389 / fpls.2022.869455”

[0083] The gene editing vector PGES401 was donated by Guan Yuefeng's research group at Fujian Agriculture and Forestry University and was disclosed in the document "Mengyan Baietc Combination of two multiplex genome-edited soybean varieties enables customization of protein functional properties Molecular Plant (IF21.949) PubDate: 2022-5-27, DOI: 10.1016 / j.molp.2022.05.011". The public can obtain the above-mentioned biological materials from the applicant. The obtained above-mentioned biological materials are only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0084] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.

[0085] SPSS 16.0 (SPSS Inc, Chicago, IL, USA) software was used for statistical analysis. One-way ANOVA was used to compare whether the gene expression differences between the untransformed control plants and the transformed plants were significant (P<0.05, one-way ANOVA). * indicates a significant difference (P<0.05), ** indicates an extremely significant difference (P<0.01), and *** indicates an extremely significant difference (P<0.001).

[0086] Example 1: Analysis of the expression pattern of the GmSTM17 gene at various stages of cotyledon node organogenesis

[0087] 1.1. Phenotypic identification of soybean cotyledon node organogenesis

[0088] 1.1.1 Seed sterilization

[0089] 90 seeds of Dongnong 50 and Suinong 14 with full seeds and no disease spots were selected. First, 75% ethanol was used to stand in a 150mL conical bottle for 5 minutes, then 15% H2O2 was used to sterilize at 28℃ shaker at 100rpm for 15 minutes, and finally ddH2O was used to wash until the water was clear. 50mL ddH2O was added and cultured at 4℃ for 1-2 days.

[0090] 1.1.2. Cluster bud induction culture

[0091] Take the seed material cultivated in the previous step, divide the seed into two explants along the cotyledon, keep 3-5mm at the connection between the hypocotyl and the cotyledon, cut off the excess hypocotyl, and remove the true leaves at the connection between the cotyledon and the hypocotyl. Inoculate the treated explants in a cluster bud induction medium (B-5 medium + 0.60g / L MES + 3.00% sucrose + 0.80% agar + B5 vitamins + 1.67mg / L 6-BA; pH = 5.7) and culture for 14 days. Inoculate 20 explants per dish according to the "4-6-6-4" principle and use it as a replicate. Set 3 replicates for each material.

[0092] 1.1.3. Cluster bud elongation culture

[0093] Explants cultured in SIM medium for 14 days were screened, and explants with obvious clustered bud primordia were selected, and cotyledons, hypocotyls, and primary stems and leaves were removed. The explants were inoculated in clustered bud elongation medium (SEM) (MS medium + 0.6g / L MES + 3% sucrose + 0.8% agar + B5 vitamins + 0.5mg / L GA3 + 0.10mg / L IAA + 1.00mg / L Zeatin-R + 100mg / L Glu + 100mg / L Asp; pH = 5.7) and cultured for 28 days. Five explants were inoculated per dish according to the "2-1-2" principle, and subcultured every 14 days.

[0094] 1.1.4. Cluster bud rooting culture

[0095] During the elongation culture of clustered shoots, the clustered shoots that have grown to more than half the height of the culture dish are cut off with surgical scissors, 1 mg / mL IBA is applied to the wound, and the shoots are inserted into rooting medium (RM) (1 / 2B5 medium + 0.59 g / L MES + 2.00% sucrose + 0.80% agar + 250 mg / L cephalosporin; pH = 5.8) and cultured for 7-10 days.

[0096] 1.1.5 Phenotypic identification during organogenesis of soybean cotyledonary nodes

[0097] During the organogenesis of soybean cotyledon nodes, the number of explants that induced obvious bud primordia was recorded on the 14th day of cluster bud induction. The number of cluster bud elongation was recorded during the cluster bud elongation culture. And during the cluster bud rooting culture, the cluster buds that had taken root were counted. The differences in the regeneration indices of each material were evaluated by calculation according to the indices in Table 1.

[0098] Table 1 Phenotypic identification criteria for soybean cotyledon node organogenesis

[0099]

[0100] 1.2 Analysis of GmSTM17 expression pattern during soybean cotyledon node organogenesis

[0101] In order to verify the expression pattern of GmSTM17 at different stages during the cotyledonary node organogenesis of soybean, we selected the high regeneration variety Dongnong 50 and the low regeneration variety Suinong 14 as materials to detect the expression level of GmSTM17 at the key stages of soybean cotyledonary node organogenesis. The key stages (SIM0 (cultured on the 0th day in cluster bud induction medium), SIM3 (cultured on the 3rd day in cluster bud induction medium), SIM7 (cultured on the 7th day in cluster bud induction medium), SIM14 (cultured on the 14th day in cluster bud induction medium), SEM3 (cultured on the 3rd day in cluster bud elongation medium), SEM7 (cultured on the 7th day in cluster bud elongation medium), SEM10 (cultured on the 10th day in cluster bud elongation medium), SEM14 (cultured on the 14th day in cluster bud elongation medium), SEM30 (cultured on the 30th day in cluster bud elongation medium)) were selected during the process, and total RNA was extracted using TRIzol reagent (Invitrogen). Each sample was repeated three times. qRT-PCR conditions were in accordance with ChamQTM Universal The qPCR Master Mix (Vazame) kit was used according to the instructions. The instrument used was Roche AppliedScience LightCyclerTM 480. The internal reference gene was Actin 4. The reaction system was as follows:

[0102] Table 2 qRT-PCR reaction system

[0103]

[0104] qRT-PCR reaction conditions (40 cycles):

[0105]

[0106] The primer information required for qRT-PCR reaction is as follows:

[0107] Table 3 qRT-PCR primer sequences

[0108]

[0109] The GmSTM17 genome is a DNA molecule whose nucleotide sequence is SEQ ID No.1, and its coding sequence is a DNA molecule whose nucleotide sequence is SEQ ID No.2, encoding the GmSTM17 protein whose amino acid sequence is SEQ ID No.3.

[0110] 1.3 Results

[0111] The results are as follows Figure 1 As shown in the figure, the relative expression level of GmSTM17 was significantly different in all key periods of soybean cotyledon node organogenesis. In all periods of soybean cotyledon node organogenesis, the relative expression level of GmSTM17 gene in Suinong 14 was significantly higher than that in Donnong 50. Since Donnong 50 is a high regeneration variety and Suinong 14 is a low regeneration variety, GmSTM17 may negatively regulate soybean cotyledon node organogenesis.

[0112] Example 2: Obtaining GmSTM17 mutant material

[0113] 2.1. Construction of PGES401-GmSTM17 gene editing vector

[0114] The gene editing vector PGES401 is used. This vector uses the PM4 promoter, can efficiently express Cas9 protein, and is effectively used in dicotyledons. At the same time, the vector carries the screening gene Bar. First, the target gene Target sequences are designed and selected. The genome sequence of GmSTM17 is designed using the CRISPR-GE website (http: / / skl.scau.edu.cn / ). Targets with high target scores, low off-target probability, and suitable positions are selected. The corresponding target sequence is synthesized and constructed into the gene editing vector of PGES401 by enzyme digestion and ligation to obtain the recombinant expression vector PGES401-GmSTM17-Target. The target sequence of the GmSTM17 genome (GmSTM17-Target) is as follows:

[0115] GmSTM17-Target(5'-3'): ACAAAACCAGCACTAACACT().

[0116] 2.2. Soybean genetic transformation 2.2.1. Transformation of Agrobacterium EHA105 competent cells

[0117] (1) Wash the electric shock cup repeatedly with anhydrous ethanol three times and blow dry it in a clean bench.

[0118] (2) Place the electroporation cuvette in an ice bath for 20 min and thaw the competent EH105 on ice.

[0119] (3) Add 1 μL of the correctly sequenced expression vector plasmid to the competent medium and add the Agrobacterium competent cells to the electroporation cuvette for electroporation.

[0120] (4) Resuspend the competent cells after electroporation in 1 mL of liquid YEP medium, and apply 100 μL of the suspension to a solid YEP plate containing 100 mg / L spectinomycin and 100 mg / L rifampicin.

[0121] (5) Incubate the plate in a 28°C incubator for 48 h and pick a single colony for PCR identification.

[0122] 2.2.2. Soybean genetic transformation

[0123] (1) Explant preparation

[0124] Take mature Dongnong 50 soybean seeds with smooth surface and no disease spots, first use 75% ethanol to stand in a 150mL conical bottle for 5 minutes, then use 15% H2O2 to sterilize at 28℃ shaker at 100rpm for 15 minutes, and finally use ddH2O to wash until the water is clear. Add 50mL ddH2O and culture at 4℃ for 1-2 days.

[0125] (2) Preparation of engineered bacterial solution

[0126] Streak the Agrobacterium culture liquid and invert it for 2-3 days at 28℃. Select a single colony and inoculate it into 3mL YEP liquid medium (50mg / L kanamycin, 25mg / L rifampicin), and culture it at 28℃ for about 24-48h. The next day, expand the culture (50mYEP) until the OD600nm is 0.6-0.8. Centrifuge the bacteria at 3000rpm for 10min and resuspend them in liquid co-culture medium (B5 salts, B5 vitamins, sucrose 30g / L, MES 3.9g / L, BAP 1.67mg / L, GA3 0.25mg / L, cysteine ​​400mg / L, DTT 154.2mg / L, AS200μmol / L, pH=5.4), adjust the OD 600nm To 0.5 for later use.

[0127] (3) Agrobacterium infection and co-cultivation

[0128] Use a scalpel to split the soybean seeds along the soybean hilum, peel them, and make slight scratches at the cotyledon node. Then place the prepared explants in the resuspended Agrobacterium for infection for 30 minutes. Transfer the infected explants to a co-culture medium (B5 salts, B5 vitamins, sucrose 30g / L, MES 3.9g / L, BAP 1.67mg / L, GA3 0.25mg / L, cysteine ​​400mg / L, DTT154.2mg / L, AS 200umol / L, agar powder 5g / L, pH=5.4) at 23°C and culture in the dark for 4 days.

[0129] (4) Recovery culture and screening culture

[0130] After 4 days of co-cultivation of the explants, the explants were transferred to the induction medium (B5 salts, B5 vitamins, sucrose 30g / L, MES 0.59g / L, BAP 1.67mg / L, cephalosporin 250mg / L, Timentin 100mg / L, glufosinate 5-6mg / L, agar powder 8g / L, pH = 5.7). The cotyledon nodes and hypocotyls of the explants were inserted into the culture medium at 45° to the horizontal plane, with the adaxial surface facing upward. Cultured for about 2 weeks at 25°C and 16 / 8h light and dark conditions (16 hours of light, 8 hours of darkness). Then the explants were removed, the excess hypocotyls were cut off, leaving only 5mm, and then the explants were transferred to fresh induction medium for continued culture for 2 weeks, with the same culture conditions.

[0131] (5) Bud elongation culture

[0132] The induced clustered shoots (partial tissue of cotyledons removed) were transferred to shoot elongation medium (MS salts, MS vitamins, sucrose 30 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L-glutamic acid 50 mg / L, IAA 0.1 mg / L, GA3 0.5 mg / L, zeatin riboside 1.0 mg / L, cephalosporin 250 mg / L, Timentin 100 mg / L, glufosinate 5-6 mg / L, agar powder 8 g / L, pH = 5.7) for culture at 25°C, 16 / 8 h light-dark cycle, subculture once every 2 weeks.

[0133] (6) Rooting

[0134] When the clustered shoots grow to 3-5 cm, they are cut off and soaked in IBA (1 mg / L) for 30 seconds, then transferred to rooting medium (MS salt, sucrose 20 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L-glutamic acid 50 mg / L, IBA 1.0 mg / L, plant gel 3 g / L, pH = 5.6) for further cultivation. When strong roots grow, they are transplanted to the greenhouse for growth and hardening.

[0135] (7) Mutant plant detection

[0136] Take the unfolded trifoliate leaves of soybean regeneration seedlings and test them with bar test strips (Aojin Biotechnology, AG-002-GSLF). Figure 3 A), and extract the transformed seedling DNA for specific PCR detection. PCR detection was performed on the mutant plants that tested positive, and the Bar gene was detected according to the primers shown in Table 4. Specific primers were designed according to the upstream 200bp and downstream 100bp of the GmSTM17 target sequence (Table 4). PCR reaction was performed with reference to the system shown in Table 5, and the PCR reaction program is shown in Table 6.

[0137] Table 4 PCR reaction primers

[0138]

[0139] Table 5 PCR reaction system

[0140]

[0141] Table 6 PCR reaction program (30 cycles)

[0142]

[0143] The results are as follows Figure 3 In B, a total of 8 independent T0 generation transformation events (lines) were identified, namely Figure 3 The first lane is the wild type, and lanes 2-9 are 8 independent T0 generation transformation events (lines) identified.

[0144] 2.3 Screening of homozygous mutant plants

[0145] 2.3.1. Using the DNA of the receptor material Dongnong 50 (WT) as the template and the annealing temperature of 63°C to 69°C, the extreme annealing temperature of the primers was identified by gradient PCR. The results are as follows: Figure 4 As shown, the ultimate annealing temperature is 67°C.

[0146] The extreme annealing temperature was used to identify homozygous mutants of GmSTM17. Seeds of T0 generation mutant plants were harvested and sown to obtain T1 generation mutant plants. The first trifoliate compound leaf of T1 generation mutant plants was taken for ACT-PCR. PCR reaction was performed as shown in Table 5 and Table 6 to detect homozygous mutant plants. There were 95 materials of T1 generation mutant plants to be detected. Figure 5 It can be seen that among the 95 mutant plants to be tested, there are 22 materials that are homozygous mutant plants (no bands or light bands). The remaining 73 materials are heterozygous mutant plants or non-mutant plants. After gene editing and second-generation sequencing, 8 homozygous mutant materials were finally obtained (Table 8), and the ACT-PCR reaction primer information is as shown in Table 7.

[0147] Table 7 Mutant detection primer information

[0148]

[0149] Table 8 Gene editing types of homozygous mutants in the T1 generation of GmSTM17

[0150]

[0151] Compared with the wild-type soybean Dongnong 50, the mutant stm17-1 underwent the following mutation in the GmSTM17 gene in the soybean genome in two homologous chromosomes: 5'-ACAAAACCAGCACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome was replaced with 5'-ACAAAACCAGCACACT-3' (SEQ ID No. 4), thereby knocking out the GmSTM17 gene.

[0152] Compared with the wild-type soybean Dongnong 50, the mutant stm17-2 underwent the following mutation in the GmSTM17 gene in the soybean genome in two homologous chromosomes: 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome was replaced with 5'-ACAAAACCAGCACTAAACT-3' (SEQ ID No. 5), thereby knocking out the GmSTM17 gene.

[0153] Compared with the wild-type soybean Dongnong 50, the mutant stm17-3 underwent the following mutation in the GmSTM17 gene in the soybean genome in two homologous chromosomes: 5'-ACAAAACCAGCACAACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome was replaced with 5'-ACAAAACCAGCACAACT-3' (SEQ ID No. 6), thereby knocking out the GmSTM17 gene.

[0154] Compared with the wild-type soybean Dongnong 50, the mutant stm17-4 underwent the following mutation in the GmSTM17 gene in the soybean genome in two homologous chromosomes: 5'-ACAAAACCAGCGACTAACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome was replaced with 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 7), thereby knocking out the GmSTM17 gene.

[0155] Compared with the wild-type soybean Dongnong 50, the mutant stm17-5 underwent the following mutation in the GmSTM17 gene in the soybean genome in two homologous chromosomes: 5'-ACAAAACCAGCACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome was replaced with 5'-ACAAAACCAGCACACT-3' (SEQ ID No. 8), thereby knocking out the GmSTM17 gene.

[0156] Compared with the wild-type soybean Dongnong 50, the mutant stm17-6 underwent the following mutation in the GmSTM17 gene in the soybean genome in two homologous chromosomes: 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome was replaced with 5'-ACAAACT-3', thereby knocking out the GmSTM17 gene.

[0157] Compared with the wild-type soybean Dongnong 50, the mutant stm17-7 underwent the following mutation in the GmSTM17 gene in the soybean genome in two homologous chromosomes: 5'-ACAAAACCAGCACTAACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome was replaced with 5'-ACAAAACCAGCTT-3' (SEQ ID No. 9), thereby knocking out the GmSTM17 gene.

[0158] Compared with the wild-type soybean Dongnong 50, the mutant stm17-8 underwent the following mutation in the GmSTM17 gene in the soybean genome in two homologous chromosomes: 5'-ACAACAACAACACT-3' (SEQ ID No. 1, positions 1514-1533) in the GmSTM17 gene in the soybean genome was replaced with 5'-ACAACAACAACACT-3' (SEQ ID No. 10), thereby knocking out the GmSTM17 gene.

[0159] Example 3: Identification of organogenesis in soybean cotyledon nodes of homozygous mutant plants of T2 generation

[0160] 3.1 Test methods

[0161] 3.1.1 Seed sterilization

[0162] The seeds of the homozygous plants of the T1 generation are homozygous mutants of the T2 generation. 90 seeds of the wild-type Dongnong 50 (hereinafter also referred to as wild-type DN50 or WT) with full seeds and no lesions and 90 seeds of the T2 generation mutants (stm17-2, stm17-6 and stm17-7) of the genotypes shown in Table 8 were selected. First, 75% ethanol was used to stand for 5 minutes in a 150mL conical flask, and then 15% H2O2 was used to sterilize at 100rpm at 28℃ for 15 minutes, and finally ddH2O was used to wash until the water was clear. 50mL ddH2O was added and cultured at 4℃ for 1-2 days.

[0163] 3.1.2. Cluster bud induction culture

[0164] Take the seed material cultivated in the previous step, divide the seed into two explants along the cotyledon, retain 3-5mm at the junction of the hypocotyl and cotyledon, cut off the excess hypocotyl, and remove the true leaf at the junction of the cotyledon and hypocotyl. Inoculate the treated explants in SIM (B-5 medium + 0.60g / L MES + 3.00% sucrose + 0.80% agar + B5 vitamins + 1.67mg / L 6-BA; pH = 5.7) medium and culture for 14 days. Inoculate 20 explants per dish according to the "4-6-6-4" principle and use it as a replicate. Set up 3 biological replicates for each material.

[0165] 3.1.3. Cluster bud elongation culture

[0166] Explants cultured in SIM medium for 14 days were screened, and explants with obvious clustered bud primordia were selected, and cotyledons, hypocotyls, and primary stems and leaves were removed. They were inoculated in SEM (MS medium + 0.6g / L MES + 3% sucrose + 0.8% agar + B5 vitamins + 0.5mg / L GA3 + 0.10mg / L IAA + 1.00mg / L Zeatin-R + 100mg / L Glu + 100mg / L Asp; pH = 5.7) medium and cultured for 28 days. Five explants were inoculated per dish according to the "2-1-2" principle, and subcultured every 14 days.

[0167] 3.1.4. Cluster bud rooting culture

[0168] During the elongation culture of cluster buds, the cluster buds that have elongated to more than half the height of the culture dish are cut off with surgical scissors, 1 mg / mL IBA is dipped into the wound, and the buds are inserted into RM (1 / 2B5 medium + 0.59 g / L MES + 2.00% sucrose + 0.80% agar + 250 mg / L cephalosporin; pH = 5.8) medium and cultured for 7-10 days.

[0169] 3.1.5 Phenotypic identification during organogenesis of soybean cotyledonary nodes

[0170] During the organogenesis of soybean cotyledon nodes, the number of explants that induced obvious bud primordia was recorded on the 14th day of cluster bud induction. The number of cluster bud elongation was recorded during the cluster bud elongation culture. And during the cluster bud rooting culture, the cluster buds that had taken root were counted. The differences between the regeneration indices of each material were evaluated by calculation according to the indices in Table 9.

[0171] Table 9 Phenotypic identification criteria for soybean cotyledon node organogenesis

[0172]

[0173] 3.2. Phenotypic identification results of soybean cotyledon node organogenesis in GmSTM17 mutant material

[0174] The soybean cotyledon node organogenesis experiment was conducted on the wild-type DN50 (WT) and the GmSTM17 gene-edited mutant. Figure 6 As shown in the figure, during the SIM14 period of soybean cotyledon node organogenesis, the number of explants induced to produce clustered buds per culture dish and the number of clustered buds induced by explants were all better than those of WT. The regeneration potential of stm17-2, stm17-6, and stm17-7 was significantly higher than that of WT ( Figure 7 ), indicating that the GmSTM17 gene negatively regulates the regeneration potential during soybean cotyledon node organogenesis.

[0175] The regeneration efficiency (RE) and regeneration rate (RR) of WT and GmSTM17 gene-edited mutants were identified during the SEM14 period of soybean cotyledonary node organogenesis. Figure 8 It can be seen that compared with WT, stm17-2, stm17-6 and stm17-7 are better than WT in both the number and speed of cluster bud elongation. In terms of regeneration efficiency and regeneration rate, stm17-2 and stm17-7 are significantly higher than WT. stm17-6 is extremely significantly higher than WT in regeneration efficiency and regeneration rate ( Fig. 9 , Fig.10 ).

[0176] Example 4: Scanning electron microscopy examination of soybean cotyledon node organogenesis explants

[0177] 4.1 Test methods

[0178] 4.1.1 SEM sample collection and fixation

[0179] The soybean cotyledonary node explants cultured in SIM medium for 14 days and the shoot tips of elongated clustered shoots cultured in SEM medium for 28 days in Example 3 were fixed in pentanediol (pH=6.8) and placed at 4°C for 1.5 hours.

[0180] 4.12. Cleaning and dehydration of SEM samples

[0181] The samples were rinsed three times with 0.1 mol PBS buffer (pH=6.8), each time for 10 min. After the washing was completed, the samples were dehydrated with 50%, 70%, and 90% ethanol respectively, and the samples were dehydrated with anhydrous ethanol for 2-3 times, each time for 10-15 min.

[0182] 4.1.3 SEM sample replacement and drying

[0183] The completely dehydrated samples in 1.5.2 were replaced once with replacement solution (anhydrous ethanol: pure tert-butyl alcohol = 1:1), and then replaced twice with pure tert-butyl alcohol, each time for 15 minutes. The replaced samples were placed in -20℃ low temperature freezer for 30 minutes, and placed in ES-2030 (HITACHI) freeze dryer to dry the samples for 4 hours.

[0184] 4.14. Scanning electron microscope sample coating and loading

[0185] The dried sample was adhered to the SEM sample stage with conductive tape, and a 100-150 angstrom metal film was coated on the sample surface with an ion sputtering coater, and then detected using a desktop SEM (TM4000).

[0186] 4.2 Scanning electron microscopy of soybean cotyledon node organogenesis explants of GmSTM17 mutant material

[0187] Depend on Fig.11 From AH, we can see that the size and fullness of the cluster shoot meristem cells of stm17-2, stm17-6 and stm17-7 explants are better than those of WT. Fig.11 As shown in Figure 1, the size of the clustered shoot meristem cells of the explants of the stm17-6 mutant at the SIM14 period is significantly larger than that of the WT. The size of the clustered shoot meristem cells of the explants of the stm17-2 and stm17-7 mutants at the SIM14 period is significantly larger than that of the WT. This indicates that the GmSTM17 gene has an inhibitory effect on the growth and development of clustered shoot meristem cells.

[0188] in conclusion:

[0189] The regeneration potential, regeneration efficiency, regeneration rate and cluster bud meristem cells of mutant materials after GmSTM17 gene editing were identified and statistically analyzed. This study found that the regeneration potential, regeneration efficiency and regeneration rate of mutant explants were significantly improved. At the same time, scanning electron microscopy analysis of cluster bud meristem cells of mutant explants during SIM14 period showed that the size of cluster bud meristem cells was significantly increased after editing the GmSTM17 gene. This study shows that the GmSTM17 gene has an inhibitory effect on the growth and development of cluster bud meristem cells, thereby negatively feedback regulating the regeneration potential, regeneration efficiency and regeneration rate of soybean cotyledon node explants. This conclusion provides a theoretical basis for further analyzing the soybean regeneration mechanism and cultivating soybean varieties with high regeneration ability.

[0190] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A method for regulating the occurrence of soybean cotyledonary node organs, characterized in that: The method comprises regulating the cotyledon node organogenesis of the recipient soybean by regulating the expression of a GmSTM17 protein encoding gene in the recipient soybean or regulating the activity or content of the GmSTM17 protein. The GmSTM17 protein is any one of the following proteins a1)-a3): a1) the amino acid sequence is the protein shown in SEQ ID No.3; a2) a protein obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in a1) and having more than 80% identity with the amino acid sequence shown in a1) and related to the GmSTM17 protein; a3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a1) or a2).

2. The method according to claim 1, characterized in that: The method comprises promoting the cotyledon node organogenesis of the recipient soybean by down-regulating, reducing or inhibiting the expression of the GmSTM17 protein encoding gene or the activity or content of the GmSTM17 protein in the recipient soybean.

3. A method for preparing soybeans with improved regeneration ability, the method comprising obtaining target soybeans with higher regeneration ability than the recipient soybeans by down-regulating, reducing or inhibiting the expression of the GmSTM17 protein encoding gene or the activity or content of the GmSTM17 protein in the recipient soybeans.

4. The method according to claim 2 or 3, characterized in that: The method comprises introducing a sgRNA gene targeting the gene encoding the GmSTM17 protein and a Cas protein encoding gene into a recipient soybean to downregulate, reduce or inhibit the expression of the GmSTM17 protein encoding gene or the activity or content of the GmSTM17 protein in the recipient soybean, so as to promote the occurrence of cotyledon node organs of the recipient soybean or obtain the target soybean with higher regeneration ability than the recipient soybean.

5. The method according to claim 4, characterized in that: The target sequence of the sgRNA gene is SEQ ID No. 1, positions 1514-1533.

6. Use of the GmSTM17 protein or a biomaterial related to the GmSTM17 protein in the use according to claim 1 in any of the following: A1) Application in regulating the regeneration capacity of plant tissues; A2) Application in the preparation of products for regulating the regeneration capacity of plant tissues; A3) Application in regulating the occurrence of cotyledonary node organs in soybean plants; A4) Application in the preparation of products for regulating the occurrence of cotyledonary node organs in soybean plants; A5) Application in plant breeding or plant assisted breeding.

7. The use according to claim 6, characterized in that: The biological material is any of the following: B1), a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the GmSTM17 protein or the activity or content of the GmSTM17 protein; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6), transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7), a transgenic plant organ containing the nucleic acid molecule described in B1), a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3); B8), a nucleic acid molecule encoding the GmSTM17 protein according to claim 1; B9), an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ containing the nucleic acid molecule described in B8).

8. The use according to claim 7, characterized in that: B1) the nucleic acid molecule may be a DNA molecule expressing an sgRNA targeting the above protein-coding gene or an sgRNA targeting the above protein-coding gene; B8) The nucleic acid molecule is a DNA molecule as shown in any one of g1) to g3) below: g1), a DNA molecule whose coding sequence of the coding strand is SEQ ID No.2; g2), a DNA molecule whose nucleotide sequence of the coding strand is SEQ ID No.1; g3) A DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and encodes the GmSTM17 protein.

9. The use according to any one of claims 6 to 8, characterized in that: The plant is selected from any one of the following: C1), dicotyledonous plants; C2), Leguminosae; C3) Soybean plants C4) soybeans.

10. The protein for use according to any one of claims 6 to 9 and / or the biomaterial for use according to any one of claims 7 to 9.

Images