Palm crop protoplast gene editing method based on CRISPR / Cas9 system and application of palm crop protoplast gene editing method

Abstract

The invention relates to a palm crop protoplast gene editing method based on a CRISPR / Cas9 system and application of the palm crop protoplast gene editing method, and belongs to the technical field of biology. A carrier containing PDS gene editing targets and Cas9 protein genes of palm crops is successfully delivered to protoplasts of the palm crops such as coconuts and areca nuts through protoplast transformation for the first time, and the carrier contains sgRNA sequences designed according to PAM sequences recognized by Cas9 protein. The sgRNA and Cas9 compound formed after expression in palm crop protoplast cells can be edited at a PDS gene editing target. According to the method disclosed by the invention, an editing carrier based on the CRISPR / Cas system can be delivered into the palm crop protoplast, the method is used for gene editing technology research of palm crops such as coconuts, betel nuts, oil palms, date palms and the like, and the feasibility of the method for editing the palm crop protoplast genome target gene based on the CRISPR / Cas 9 system is verified; and a rapid and effective method is provided for subsequently establishing an efficient palm crop protoplast gene editing technical system.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a protoplast gene editing method applicable to palm crops such as coconut, betel nut, and oil palm based on a CRISPR / Cas9 system and an application thereof. Background Art

[0002] Coconut (scientific name: Cocos nucifera L.), Areca catechu (scientific name: Areca catechu L.), Elaeagnus oleifera (scientific name: Elaeis guineensis Jacq.) are palm trees, mainly produced in Malaysia, Indonesia in Asia, and western and central Africa. At present, the selection and breeding of new varieties of palm crops such as coconut, betel nut, and oil palm is still mainly based on traditional hybrid breeding, which has problems of low efficiency and long cycle, seriously hindering the process of high-yield and high-quality breeding. With the development of biotechnology, the application of molecular technologies such as genetic transformation and gene editing based on protoplasts as the main platform in a variety of crops has promoted the research and development of new breeding technologies, but related research on palm crops such as coconut, betel nut, and oil palm has yet to be carried out.

[0003] Plant protoplasts are cell morphological structural units composed of cell membrane, cytoplasm, nucleus and organelles in addition to cell walls, and have the characteristics of rapid expression of exogenous genetic material. Therefore, transient expression analysis based on protoplasts is convenient and fast, and has been widely used in various fields of genetic research. In recent years, protoplast transformation technology has been greatly improved and has been widely used in the verification of gene editing systems and vector activity, which is of great significance for the directional transformation and precise editing of plant genomes.

[0004] Genome editing technology is an important tool for studying gene function. It can accurately modify genes at specific sites on the chromosomes of recipient cells, efficiently produce functionally inactive mutants of specific genes, and provide high-quality genetic materials for biological functional genomic research. sgRNA and Cas9 are two necessary components of this technology system, among which sgRNA plays a role in targeting and binding to the target gene site during the CRISPR / Cas9 genome editing process.

[0005] Although CRISPR / Cas9 genome editing technology has been widely used in many species, there are no reports on gene editing technology for coconut, betel nut, and oil palm, especially protoplast gene editing technology has yet to be developed. Therefore, the development of a palm crop protoplast gene editing method based on the CRISPR / Cas9 system has positive significance for the development of gene editing technology for palm crops such as coconut, betel nut, and oil palm. Summary of the invention

[0006] Therefore, the technical problem to be solved by the present invention is to provide a gene editing method and application suitable for palm crop protoplasts.

[0007] In order to solve the above technical problems, the present invention provides a palm crop protoplast gene editing method based on the CRISPR / Cas9 system and its application.

[0008] First, the present invention provides a vector of palm crop PDS gene sgRNA.

[0009] Specifically, the palm crop protoplast editing vector containing the CRISPR / Cas9 system provided by the present invention contains two palm crop PDS genes sgRNA1 and sgRNA2, and the nucleotide sequences of sgRNA1 and sgRNA2 are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0010] SEQ ID NO.1: sgRNA1: cactttgagtttaagtggaa; SEQ ID NO. 2: sgRNA2: atgaaacttgagatttcaag.

[0011] The constructed editing vector was delivered to palm crop protoplasts by protoplast transformation. After culturing for 4-5 days, DNA was extracted and PCR was performed using bridge primers. The PCR products were sequenced by Hi-TOM method to detect the editing site, editing type and editing efficiency, thus completing the gene target editing.

[0012] The present invention also provides an expression cassette or recombinant bacteria comprising the palm crop protoplast editing vector, and applications thereof in the fields of palm crop protoplast gene editing and palm crop breeding.

[0013] Beneficial effects of the present invention: The present invention is the first to deliver a gene editing vector containing two palm crop PDS gene sgRNAs based on the CRISPR / Cas9 system to palm crop protoplasts, detect the editing sites, editing types and editing efficiency by Hi-TOM sequencing, verify the feasibility of the method of editing the target gene of the palm crop protoplast genome based on the CRISPR / Cas9 system, and provide a fast and effective method for the subsequent establishment of an efficient palm crop protoplast gene editing technology system. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Betel nut AcPDS Schematic diagram of gene editing vector construction; A: AcPDS A: Gene structure, B: Editing target design, C: Schematic diagram of editing vector.

[0015] Figure 2 Positive control for transient transformation of protoplasts (35s-GFP expression vector).

[0016] Figure 3 Hi-TOM sequencing results of betel nut editing target sites.

[0017] Figure 4 coconut PdS Schematic diagram of gene editing vector construction; A: PdS A: Gene structure, B: Editing target design, C: Schematic diagram of editing vector.

[0018] Figure 5 Hi-TOM sequencing results of coconut editing target sites. DETAILED DESCRIPTION

[0019] In the following examples of the present invention, unless otherwise specified, all methods are conventional. The plant expression vector p35s-GFP in the following examples is preserved in this laboratory. AcPDS and CnPd The sgRNA of the gene editing vector was designed by our laboratory and then constructed by Yunzhou Biotechnology (Guangzhou) Co., Ltd. The PCR product sequencing was completed by the Hi-TOM sequencing platform of the Chinese Academy of Rice Research. The above biological materials are only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0020] Example 1

[0021] This embodiment provides a gene editing method applicable to betel nut protoplasts, and the specific steps are as follows: Step 1: Betel nut AcPDS Gene mining and target design. The PDS genes of palm crops were identified in the betel nut genome by homologous sequence alignment, such as Figure 1 A; Design two sgRNAs on the first exon according to the PAM sequence rules required by the CRISPR / Cas9 system, such as Figure 1 B. Construction of an editing vector based on the CRISPR / Cas9 system with two sgRNAs driven by the AtU6-26 promoter, such as Figure 1 C.

[0022] Step 2, preparing betel nut protoplasts. Take young leaves of betel nut seedlings that have not been exposed to light as materials, and separate and purify protoplasts according to a protoplast separation kit or other conventional methods.

[0023] Step 3: Transient transformation method was used to deliver the editing vector to betel nut protoplasts. The purified protoplasts were adjusted to a concentration of 2×10 5 / mL; first take 40 μL of the vector with a concentration of 1 μg / μL and add it to a new 2 mL round-bottom centrifuge tube, then add 100 μL of the protoplast solution with the adjusted concentration and mix; add 140 μL of the newly prepared PEG solution to the solution, mix well and let it stand at 28°C for 30 min; add 1 mL of W5 culture medium to terminate the transformation reaction, centrifuge at 150 g for 3 min, and the centrifuge speed is 3 for both acceleration and deceleration; then wash once with 1 mL of W5 culture medium, centrifuge to remove the supernatant, and finally add 1 mL of W5 culture medium and place the centrifuge tube flat at 28°C for dark culture for 16 h.

[0024] Step 4: Fluorescence observation. Slowly lift the centrifuge tube and let it stand for 30 min, then centrifuge at 150 g, 3% acceleration, 3% deceleration for 3 min, remove the supernatant, retain about 100 μL of culture medium and mix with protoplasts, and observe with a confocal microscope or fluorescence microscope. In this step, the transformation of 35s-GFP vector is used as a positive control to analyze the transformation efficiency.

[0025] Step 5: The remaining protoplasts were cultured in the dark at 28°C for 4-5 days, and the protoplast DNA was extracted and PCR was performed using a bridge primer. The primer sequences were as follows: Ac-Hi F2:ggagtgagtacggtgtgcACTAGGGTAGAACTGCCAGG Ac-Hi R2:gagttggatgctggatggCTGAAGAGGGCTGACTTTAT The length of the PCR fragment was 257 bp, the reaction system was 50 μL, and the reaction program was: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 57°C for 15 s, extension at 72°C for 5 s, 35 cycles, and final extension at 72°C for 5 min.

[0026] After the reaction is completed, 5 μL is taken for agarose gel electrophoresis verification, and the fragment size is 257 bp and can be sent for sequencing.

[0027] Step six: The PCR product is sent to the Hi-TOM platform of the Chinese Academy of Rice Research in Hangzhou for sequencing. The results can provide information such as editing sites, editing types, and editing efficiency.

[0028] Betel nut AcPDS The schematic structure of gene structure, target design and vector construction is shown in Figure 1 .

[0029] The fluorescence detection results are shown in Figure 2 , protoplasts were transformed with the expression vector driven by 35s promoter and GFP, which was used as a positive control to evaluate the transformation efficiency of each batch; Figure 3 is the Hi-TOM sequencing result. AcPDS An editing event occurred at target 2, and the editing type was base deletion, of which the GAAA deletion type was 1.55%, the GAA deletion type was 1.27%, and the total editing efficiency was 2.82%.

[0030] Example 2

[0031] This embodiment provides a gene editing method applicable to coconut protoplasts, and the specific steps are as follows: Step 1: Coconut PdS Gene mining and target design. The palm crop PDS genes were identified in the coconut genome by homologous sequence alignment, such as Figure 4 A; Design an sgRNA on the first exon according to the PAM sequence rules required by the CRISPR / Cas9 system, such as Figure 4 B. Construction of an editing vector based on the CRISPR / Cas9 system with an AtU6-26 promoter driving an sgRNA, such as Figure 4 C.

[0032] Step 2: preparing coconut protoplasts. Take young leaves of embryo culture seedlings that have not been exposed to light as materials, and separate and purify protoplasts using a protoplast separation kit or other conventional methods.

[0033] Step 3: Transient transformation method was used to deliver the editing vector to coconut protoplasts. The purified protoplasts were adjusted to a concentration of 2×10 5 / mL; first take 40 μL of the vector with a concentration of 1 μg / μL and add it to a new 2 mL round-bottom centrifuge tube, then add 100 μL of the protoplast solution with the adjusted concentration and mix; add 140 μL of the newly prepared PEG solution to the solution, mix well and let it stand at 28°C for 30 min; add 1 mL of W5 culture medium to terminate the transformation reaction, centrifuge at 150 g for 3 min, and the centrifuge speed is 3 for both acceleration and deceleration; then wash once with 1 mL of W5 culture medium, centrifuge to remove the supernatant, and finally add 1 mL of W5 culture medium and place the centrifuge tube flat at 28°C for dark culture for 16 h.

[0034] Step 4: Fluorescence observation. Slowly lift the centrifuge tube and let it stand for 30 min, then centrifuge at 150 g, 3% acceleration, 3% deceleration for 3 min, remove the supernatant, retain about 100 μL of culture medium and mix with protoplasts, and observe with a confocal microscope or fluorescence microscope. In this step, the transformation of 35s-GFP vector is used as a positive control to analyze the transformation efficiency.

[0035] Step 5: The remaining protoplasts were cultured in the dark at 28°C for 4-5 days, and the protoplast DNA was extracted and PCR was performed using a bridge primer. The primer sequences were as follows: Cn-Hi F1:ggagtgagtacggtgtgcCAAGGTATACATCGATCGAC Cn-Hi R2:gagttggatgctggatggGGCTTGATCTTGTTCCTTTG The length of the PCR fragment was 219 bp, the reaction system was 50 μL, and the reaction program was: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 57°C for 15 s, extension at 72°C for 5 s, 35 cycles, and final extension at 72°C for 5 min.

[0036] After the reaction, 5 μL was taken for agarose gel electrophoresis verification, and the fragment size was 219 bp and could be sent for sequencing.

[0037] Step six: The PCR product is sent to the Hi-TOM platform of the Chinese Academy of Rice Research in Hangzhou for sequencing. The results can provide information such as editing sites, editing types, and editing efficiency.

[0038] coconut CnPd The schematic structure of gene structure, target design and vector construction is shown in Figure 4 .

[0039] Figure 5 is the Hi-TOM sequencing result. PdS The target site underwent an editing event, the editing type was GG base deletion, and the editing efficiency was 4.05%. Therefore, the method of the present invention can be used for protoplast gene editing of palm crops such as betel nut and coconut, thereby providing a reference for the subsequent establishment of an efficient protoplast gene editing technology system applicable to palm crops.

[0040] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

[0041] Of course, the above description is not a limitation of the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by ordinary technicians in this technical field within the essential scope of the present invention should fall within the protection scope of the present invention.

Claims

1. A palm crop protoplast editing vector based on the CRISPR / Cas9 system, characterized in that: It contains two palm crop PDS genes sgRNA1 and sgRNA2, and the nucleotide sequences of sgRNA1 and sgRNA2 are shown as SEQ ID NO.1 and SEQ ID NO.2, respectively.

2. An expression cassette or recombinant bacterium comprising the palm crop protoplast editing vector according to claim 1.

3. Use of the editing vector according to claim 1 in gene editing of palm crop protoplasts.

4. Use of the editing vector according to claim 1 in the field of palm crop breeding.

5. Use of the expression cassette or recombinant bacteria according to claim 2 in gene editing of palm crop protoplasts.

6. Application of the expression cassette or recombinant bacteria according to claim 2 in the field of palm crops and palm crop breeding.

Images