Construction method and application of a Toxoplasma gondii gene knockout vaccine strain

Abstract

The invention belongs to the technical field of genetic engineering, and specifically discloses a method for constructing a Toxoplasma gondii gene knockout vaccine strain and an application thereof. The TGGT1_202920 gene of Toxoplasma gondii is directly knocked out by gene editing technology to obtain a ΔTGGT1_202920 strain, which has the characteristics of being able to be normally cultured in vitro and being almost non-toxic in vivo. After animals are immunized with the ΔTGGT1_202920 strain, good immune protection can be generated, the strain can resist infection by wild-type Toxoplasma gondii, and the strain can be used to prepare an anti-toxoplasmosis vaccine to prevent Toxoplasma infection.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, in particular to a method for constructing a Toxoplasma gondii gene knockout vaccine strain and its application. Background Art

[0002] Toxoplasma gondii is an obligate intracellular parasite that can infect almost all warm-blooded animals. It has a complex life cycle and multiple transmission routes, posing a serious threat to human health, especially pregnant women, fetuses and people with immunodeficiency. Infection of pregnant animals with Toxoplasma gondii may lead to miscarriage, stillbirth, malformed fetuses, and even death, causing huge economic losses to the livestock industry. Currently, only one Toxoplasma vaccine, Toxovax, is approved for the prevention of toxoplasmosis in sheep, but the vaccine has the risk of reversion to virulence and restoration of oocyst formation, which limits its widespread use.

[0003] With the increasing maturity of methods such as gene editing, gene-deficient live vaccines have shown good prospects. The constructed ΔompdcΔuprt strain can grow normally in the presence of uracil, but cannot establish acute infection in mice; immunization with this strain can resist infection with a variety of Toxoplasma tachyzoites and produce good immune protection; but immunization with this strain cannot completely block the discharge of oocysts in the terminal host, and there is a risk of pathogen spread. In addition, the constructed Δldh strain lacking lactate dehydrogenase LDH1 and LDH2 can be cultured normally in vitro, but cannot reproduce in vivo, and its virulence is significantly reduced. Immunization with the Δldh strain can resist reinfection with wild-type Toxoplasma tachyzoites and cysts, and is a highly potential candidate vaccine strain. However, the immune protection effect of this strain has been mainly evaluated in mice, and its immune protection effect on other hosts needs further evaluation.

[0004] Although some candidate vaccine strains of Toxoplasma gondii have been reported in recent years, there is genetic diversity between Toxoplasma gondii strains of different genotypes, and the cross-immunity protection effect of a single vaccine strain is not ideal. Therefore, it is still necessary to dig out more vaccine design targets and develop more candidate vaccine strains to effectively supplement the Toxoplasma gondii candidate vaccine strain library. The present invention uses gene editing technology and in vitro and in vivo experiments to reveal the biological role of the TGGT1_202920 gene and its potential as a vaccine target, which is of great significance to the development of Toxoplasma vaccines. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a method for constructing a Toxoplasma gondii gene knockout vaccine strain and its application.

[0006] To achieve the above object, the present invention is implemented according to the following technical solutions:

[0007] One of the purposes of the present invention is to provide a method for constructing a Toxoplasma gondii gene knockout vaccine strain, comprising the following steps:

[0008] (1) According to the principle of CRISPR / Cas9 gene editing, the target sgRNA sequence of the target gene TGGT1_202920 was designed; the nucleotide sequence of the TGGT1_202920 gene is shown in SEQ ID NO.1;

[0009] (2) Integrate the sgRNA sequence in (1) into the linearized CRISPR / Cas9 backbone by homologous recombination to construct the TGGT1_202920 gene-specific CRISPR / Cas9 plasmid pCas9-gRNA-TGGT1_202920;

[0010] (3) Using pTub-YFP-DHFR* plasmid as template, amplify the homologous template Tub::YFP::DHFR*-TGGT1_202920;

[0011] (4) The pCas9-gRNA-TGGT1_202920 plasmid and homologous recombination template were co-electroporated into the parental strain DiCre, and the Toxoplasma gondii gene knockout vaccine strain ΔTGGT1_202920 with the TGGT1_202920 gene knocked out was obtained through pyrimethamine screening, PCR and IFA identification.

[0012] The second purpose of the present invention is to provide a Toxoplasma gondii gene knockout vaccine strain for use in the preparation of an anti-toxoplasmosis vaccine.

[0013] Furthermore, the anti-toxoplasmosis vaccine contains the Toxoplasma gondii gene knockout vaccine strain ΔTGGT1_202920.

[0014] Furthermore, the anti-toxoplasmosis vaccine also contains a medically acceptable vaccine adjuvant.

[0015] Compared with the prior art, the present invention directly knocks out the TGGT1_202920 gene of Toxoplasma gondii through gene editing technology to obtain the ΔTGGT1_202920 strain. Knocking out the TGGT1_202920 gene will weaken the reproductive ability of the parasite in the body, but the ΔTGGT1_202920 strain can still be cultured normally in vitro. After mice are immunized with ΔTGGT1_202920, the vaccine strain can produce good immune protection, can resist infection by wild-type Toxoplasma, and can be used to prepare anti-toxoplasmosis vaccines to prevent Toxoplasma infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a schematic diagram of the construction of Toxoplasma gondii ΔTGGT1_202920.

[0017] Figure 2 These are the PCRs identification results of the ΔTGGT1_202920 monoclonal strain.

[0018] Figure 3 These are the results of the plaque assay of the ΔTGGT1_202920 insect strain.

[0019] Figure 4 These are the results of the virulence experiment on the ΔTGGT1_202920 insect strain.

[0020] Figure 5 These are the results of the immune protection experiment after mice were immunized with the ΔTGGT1_202920 strain. DETAILED DESCRIPTION

[0021] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0022] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0023] In this example, a Toxoplasma gondii vaccine strain ΔTGGT1_202920 lacking the TGGT1_202920 gene was first constructed, as shown in the schematic diagram. Figure 1 The results are shown in Figure 1. Gene knockout was performed on the basis of the parent strain DiCre (kindly donated by Huazhong Agricultural University). The TGGT1_202920 gene (ToxoDB annotation: p-aminobenzoic acid synthase, gene ID: TGGT1_202920) in the ToxoDB (www.toxodb.org) website was searched in the ToxoDB type I strain. The nucleotide sequence of TGGT1_202920 is:

[0024]

[0025] 1. Construction of pCas9-gRNA-TGGT1_202920 plasmid

[0026] (1) Design of gRNA sequence

[0027] The gRNA sequence was designed through the gRNA website (http: / / www.e-crisp.org / E-CRISP / designcrispr.html) and the TGGT1_202920 gene-specific gRNA primers were synthesized as shown in Table 1 below;

[0028] Table 1 Specific gRNA primers

[0029]

[0030] (2) Template plasmid linearization

[0031] Using pSAG1-Cas9-TgU6-sgTgUPRT plasmid (kindly donated by Huazhong Agricultural University, of course, it can also be purchased from the platform: http: / / www.addgene.org, sequence see SEQ ID NO.3) as a template, amplification backbone primers were designed, as shown in Table 2, and linearized backbone fragments were amplified according to the system and procedure (as shown in Tables 3 and 4) of the instruction manual of Novogene high-fidelity enzyme (P505, Nanjing Novogene Biotechnology Co., Ltd., Nanjing), and then the above PCR product was digested with restriction enzyme Dpn1 (1609, Baoriyi Biotechnology Co., Ltd., Dalian) to remove the template plasmid, and then agarose gel electrophoresis was performed, and finally the target fragment was purified using Novogene product purification kit (DC301-01, Nanjing Novogene Biotechnology Co., Ltd., Nanjing).

[0032] The pSAG1-Cas9-TgU6-sgTgUPRT plasmid sequence is as follows:

[0033] CAAGTAAGCAGAAGCACGCTGTATTTCCGGGAGGGTGCGACGAGACAAAGTGCGCGAGTTGAA

[0034] ATCGTCGTGGGGACGATTGCACCGCGGCCACATGTTGGAGACACTGAGGACACACGGGAAACGCGA

[0035] AAGATTTCAAATTAACGTACCCAAGCGCGAAAGCTTGCGCAGCATACACTCGAAGCGAACATCCCGA

[0036] ACCATCGAGAGGCGGAGAGCGATAAGTCTTTCACGCTGCGAAGTGTTGCGACGGCTGCGCCGCTGCA

[0037] CTGTGAATTGGGCGCCAATATTGCATCCTAGGCCTGACGCGCCTCCTGCAGAACGCGAGACACTGGGA

[0038] TATGTAGAGCCAAGGGGGAAACCTTCGAACTCTCGAATGTCTTCTCTGACAAGAATCATATTTCCATC

[0039] AGTTCTGTCAGATTTTCAAATGGCGACCTGCAGAGGCCTGCTTCCTCCCTGTGCGCTCTTCGAAGGGG

[0040] CTTTCTGTCGCGCAGGGTCACCTCGTCCCCGAAGGGGGTGTTTGCCTTCTGGTAAATGGGGATGTCAA

[0041] GTTGGCGTCTCGATTGTGAGAGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTA

[0042] TCAACTTGAAAAGTGGCACCGAGTCGGTGCTTTTTTGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGT

[0043] TAATTTCGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCC

[0044] ACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACA

[0045] TTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAAT

[0046] CGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCG

[0047] CTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCAC

[0048] AGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTA

[0049] AAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACG

[0050] CTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCC

[0051] CTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGC

[0052] GTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGG

[0053] CTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA

[0054] ACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTA

[0055] TGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTG

[0056] GTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAA

[0057] ACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTC

[0058] AAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATT

[0059] TTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCA

[0060] ATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCA

[0061] GCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAG

[0062] GGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATC

[0063] AGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATC

[0064] CAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTT

[0065] GCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAA

[0066] CGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGAT

[0067] CGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTAC

[0068] TGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTG

[0069] TATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTT

[0070] TAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGA

[0071] TCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCT

[0072] GGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTG

[0073] AATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACA

[0074] TATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCT

[0075] AAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCA

[0076] ATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTC

[0077] CAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTA

[0078] TCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAG

[0079] CACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGG

[0080] CGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACG

[0081] CTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCCCATTCGCCATTCAG

[0082] GCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGG

[0083] GGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGA

[0084] CGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTACCGGGCCCCCCCTCGAGGT

[0085] CGACGGTATCGATAAGCTTTTACATCCGTTGCCTTTTCCACGGTCCGTGATTTCATGTGCGTGCAGCTT

[0086] CAAAGACTGGTCGTTGCGACTAATAAGACTGCAGTGACAGGTCGAATGGTGGGCACCTTGCTGATGA

[0087] CTATCTACTGCAAAGTCTGAGACAACGAACGAAACTTCCCACACGAGGCATTTGAAACTGACGGTGT

[0088] CTAGGTAATATGCACTGCAAGACACGGTACTGGGGCCTCGCTGAATTAGGGGCCGATCTCGTTGCCCT

[0089] ATCAGTGCTCACAGTGCCGCAACGTAACACCAGGGCAGGTTCTTGACAGTGGCAACAATGTGCGACG

[0090] GGCGTGTGAACGTTTCGTAGTCATAGCGCTAGCACGTACCTAGCCACATGGTCGTGAGGAGCTTTACC

[0091] ATGCGTCTAGAAGGTGGATGCGGGACACGCCTTCCTGGCCTTTGGCTCCCGAGACGCGTGTTCTAACC

[0092] ACAAACCTTGAGACGCGTGTTCCAACCACGCACCCTGACACGCGTGTTCCAACCACGCACCCTGAGA

[0093] CGCGTGTTCTAACCACGCACCCTGAGACGCGTGTTCTAACCACGCACCCTGAGACGCGTGTTCTGCC

[0094] GCACAATGTGCACCTGTAGGAAGCTGTAGTCACTGCTGATTCTCACTGTTCTCGGCAAGGGCCGACG

[0095] ACCGGAGTACAGTTTTTGTGGGCAGAGCCGTTGTGCAGCTTTCCGTTCTTCTCGGTTGTGTCACATGT

[0096] GTCATTGTCGTGTAAACACACGGTTGTATGTCGGTTTCGCTGCACCACTTCATTATTTCTTCTGGTTTTT

[0097] TGACGAGTATGCATCTAGACAAAATGGACAAGAAGTACAGCATCGGCCTGGACATCGGCACCAACTC

[0098] TGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCCCAGCAAGAAATTCAAGGTGCTGGGCAA

[0099] CACCGACCGGCACAGCATCAAGAAGAACCTGATCGGCGCCCTGCTGTTCGACAGCGGAGAAACAGC

[0100] CGAGGCCACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGACGGAAGAACCGGATCTGCTA

[0101] TCTGCAAGAGATCTTCAGCAACGAGATGGCCAAGGTGGACGACAGCTTCTTCCACAGACTGGAAGA

[0102] GTCCTTCCTGGTGGAAGAGGATAAGAAGCACGAGCGGCACCCCATCTTCGGCAACATCGTGGACGAG

[0103] GTGGCCTACCACGAGAAGTACCCCACCATCTACCACCTGAGAAAGAAACTGGTGGACAGCACCGAC

[0104] AAGGCCGACCTGCGGCTGATCTATCTGGCCCTGGCCCACATGATCAAGTTCCGGGGCCACTTCCTGAT

[0105] CGAGGGCGACCTGAACCCCGACAACAGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTA

[0106] CAACCAGCTGTTCGAGGAAAACCCCATCAACGCCAGCGGCGTGGACGCCAAGGCCATCCTGTCTGCC

[0107] AGACTGAGCAAGAGCAGACGGCTGGAAAATCTGATCGCCCAGCTGCCCGGCGAGAAGAAGAATGGC

[0108] CTGTTCGGCAACCTGATTGCCCTGAGCCTGGGCCTGACCCCCAACTTCAAGAGCAACTTCGACCTGG

[0109] CCGAGGATGCCAAACTGCAGCTGAGCAAGGACACCTACGACGACGACCTGGACAACCTGCTGGCCC

[0110] AGATCGGCGACCAGTACGCCGACCTGTTTCTGGCCGCCAAGAACCTGTCCGACGCCATCCTGCTGAG

[0111] CGACATCCTGAGAGTGAACACCGAGATCACCAAGGCCCCCCTGAGCGCCTCTATGATCAAGAGATAC

[0112] GACGAGCACCACCAGGACCTGACCCTGCTGAAAGCTCTCGTGCGGCAGCAGCTGCCTGAGAAGTAC

[0113] AAAGAGATTTTCTTCGACCAGAGCAAGAACGGCTACGCCGGCTACATCGATGGCGGAGCCAGCCAGG

[0114] AAGAGTTCTACAAGTTCATCAAGCCCATCCTGGAAAAGATGGACGGCACCGAGGAACTGCTCGTGAA

[0115] GCTGAACAGAGAGGACCTGCTGCGGAAGCAGCGGACCTTCGACAACGGCAGCATCCCCCACCAGAT

[0116] CCACCTGGGAGAGCTGCACGCCATTCTGCGGCGGCAGGAAGATTTTTACCCATTCCTGAAGGACAAC

[0117] CGGGAAAAGATCGAGAAGATCCTGACCTTCCGCATCCCCTACTACGTGGGCCCTCTGGCCAGGGGAA

[0118] ACAGCAGATTCGCCTGGATGACCAGAAAGAGCGAGGAAACCATCACCCCCTGGAACTTCGAGGAAG

[0119] TGGTGGACAAGGGCGCCAGCGCCCAGAGCTTCATCGAGCGGATGACCAACTTCGATAAGAACCTGCC

[0120] CAACGAGAAGGTGCTGCCCAAGCACAGCCTGCTGTACGAGTACTTCACCGTGTACAACGAGCTGACC

[0121] AAAGTGAAATACGTGACCGAGGGAATGAGAAAGCCCGCCTTCCTGAGCGGCGAGCAGAAAAAAGCC

[0122] ATCGTGGACCTGCTGTTCAAGACCAACCGGAAAGTGACCGTGAAGCAGCTGAAAGAGGACTACTTC

[0123] AAGAAAATCGAGTGCTTCGACTCCGTGGAAATCTCCGGCGTGGAAGATCGGTTCAACGCCTCCCTGG

[0124] GCACATACCACGATCTGCTGAAAATTATCAAGGACAAGGACTTCCTGGACAATGAGGAAAACGAGGA

[0125] CATTCTGGAAGATATCGTGCTGACCCTGACACTGTTTGAGGACAGAGAGATGATCGAGGAACGGCTG

[0126] AAAACCTATGCCCACCTGTTCGACGACAAAGTGATGAAGCAGCTGAAGCGGCGGAGATACACCGGCT

[0127] GGGGCAGGCTGAGCCGGAAGCTGATCAACGGCATCCGGGACAAGCAGTCCGGCAAGACAATCCTGG

[0128] ATTTCCTGAAGTCCGACGGCTTCGCCAACAGAAACTTCATGCAGCTGATCCACGACGACAGCCTGAC

[0129] CTTTAAAGAGGACATCCAGAAAGCCCAGGTGTCCCGGCCAGGGCGATAGCCTGCACGAGCACATTGCC

[0130] AATCTGGCCGGCAGCCCGCCCATTAAGAAGGGCATCCTGCAGACAGTGAAGGTGGTGGACGAGCTCG

[0131] TGAAAGTGATGGGCCGGCACAAGCCCGAGAACATCGTGATCGAAATGGCCAGAGAGAACCAGACCA

[0132] CCCAGAAGGGACAGAAACAGCCGCGAGAGAATGAAGCGGATCGAAGAGGGCATCAAAGAGCTG

[0133] GGCAGCCAGATCCTGAAAGAACACCCCGTGGAAAACACCCAGCTGCAGAACGAGAAGCTGTACCTG

[0134] TACTACCTGCAGAATGGGCGGGATATGTACGTGGACCAGGAACTGGACATCAACCGGCTGTCCGACTA

[0135] CGATGTGGACCATATCGTGCCTCAGAGCTTTCTGAAGGACGACTCCATCGATAACAAAGTGCTGACTC

[0136] GGAGCGACAAGAACCGGGGCAAGAGCGACAACGTGCCCTCCGAAGAGGTCGTGAAGAAGATGAAG

[0137] AACTACTGGCGCCAGCTGCTGGAATGCCAAGCTGATTACCCAGAGGAAGTTCGACAATCTGACCAAGG

[0138] CCGAGAGAGGCGGCCTGAGCGAACTGGATAAGGCCGGCTTCATCAAGAGACAGCTGGTGGAAACCC

[0139] GGCAGATCACAAAGCACGTGGCACAGATCCTGGACTCCCGGATGAACACTAAGTACGACGAGAACG

[0140] ACAAACTGATCCGGGAAGTGAAAGTGATCACCCTGAAGTCCAAGCTGGTGTCCGATTTCCGGAAGGA

[0141] TTTCCAGTTTTACAAAGTGCGCGAGATCAACAACTACCACCACGCCCACGACGCCTACCTGAACGCC

[0142] GTCGTGGGAACCGCCCTGATCAAAAAGTACCCTAAGCTGGAAAGCGAGTTCGTGTACGGCGACTACA

[0143] AGGTGTACGACGTGCGGAAGATGATCGCCAAGAGCGAGCAGGAAATCGGCAAGGCTACCGCCAAGT

[0144] ACTTCTTCTACAGCAACATCATGAACTTTTTCAAGACCGAGATTACCCTGGCCAACGGCGAGATCCGG

[0145] AAGCGGCCTCTGATCGAGACAAACGGCGAAACAGGCGAGATCGTGTGGGATAAGGGCCGGGACTTT

[0146] GCCACCGTGCGGAAAGTGCTGTCTATGCCCCAAGTGAATATCGTGAAAAAGACCGAGGTGCAGACAG

[0147] GCGGCTTCAGCAAAGAGTCTATCCTGCCCAAGAGGAACAGCGACAAGCTGATCGCCAGAAAGAAGG

[0148] ACTGGGACCCTAAGAAGTACGGCGGCTTCGACAGCCCCACCGTGGCCTATTCTGTGCTGGTGGTGGC

[0149] CAAAGTGGAAAAGGGCAAGTCCAAGAAACTGAAGAGTGTGAAAGAGCTGCTGGGGATCACCATCAT

[0150] GGAAAGAAGCAGCTTCGAGAAGAATCCCATCGACTTTCTGGAAGCCAAGGGCTACAAAGAAGTGAA

[0151] AAAGGACCTGATCATCAAGCTGCCTAAGTACTCCCTGTTCGAGCTGGAAAACGGCCGGAAGAGAATG

[0152] CTGGCCTCTGCCGGCGAACTGCAGAAGGGAAACGAACTGGCCCTGCCCTCCAAATATGTGAACTTCC

[0153] TGTACCTGGCCAGCCACTATGAGAAGCTGAAGGGCTCCCCCGAGGATAATGAGCAGAAACAGCTGTT

[0154] TGTGGAACAGCACAAACACTACCTGGACGAGATCATCGAGCAGATCAGCGAGTTCTCCAAGAGAGTG

[0155] ATCCTGGCCGACGCTAATCTGGACAAGGTGCTGAGCGCCTACAACAAGCACAGAGACAAGCCTATCA

[0156] GAGAGCAGGCCGAGAATATCATCCACCTGTTTACCCTGACCAATCTGGGAGCCCCTGCCGCCTTCAAG

[0157] TACTTTGACACCACCATCGACCGGAAGAGGTACACCAGCACCAAAGAGGTGCTGGACGCCACCCTGA

[0158] TCCACCAGAGCATCACCGGCCTGTACGAGACACGGATCGACCTGTCTCAGCTGGGAGGCGACGCCTA

[0159] TCCCTATGACGTGCCCGATTATGCCAGCCTGGGCAGCGGCTCCCCCAAGAAAAAACGCAAGGTGGAA

[0160] GATCCTAAGAAAAAGCGGAAAGTGGACGGCATTGGTAGTGGGAGCAACGGCAGCAGCGGATCCGTG

[0161] AGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAAC

[0162] GGCCACAAGTTCAGCGTGCGCGGCGAGGGCGAGGGCGATGCCACCAACGGCAAGCTGACCCTGAAG

[0163] TTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGT

[0164] GCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAA

[0165] GGCTACGTCCAGGAGCGCACCATCTCCTTCAAGGACGACGGCACCTACAAGACCCGCGCCGAGGTG

[0166] AAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGC

[0167] AACATCCTGGGGCACAAGCTGGAGTACAACTTCAACAGCCACAACGTCTATATCACGGCCGACAAGC

[0168] AGAAGAACGGCATCAAGGCGAACTTCAAGATCCGCCACAACGTCGAGGACGGCAGCGTGCAGCTCG

[0169] CCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCT

[0170] GAGCACCCAGTCCAAGCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTT

[0171] CGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAGTTAATTAATCACCGTTGTG

[0172] CTCACTTCTCAAATCGACAAAGGAAACACACTTCGTGCAGCATGTGCCCCATTATAAAGAAACTGAGT

[0173] TGTTCCGTTGTGGCTTGCAGGTGTCACATCCACAAAAACCGGCCGACTCTAAATAGGAGTGTTTCGCA

[0174] GCAAGCAGCGAAAGTTTATGACTGGGTCCGAATCTCTGAACGGATGTGTGGCGGACCTGGCTGATGT

[0175] TGATCGCCGTCGACACACGCGCCACATGGGTCAATACACAAGACAGCTATCAGTTGTTTTAGTCGAAC

[0176] CGGTTAACACAATTCTTGCCCCCCCGAGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGG

[0177] AGCT (SEQ ID NO. 3)

[0178] Table 2 Primers for amplifying CRISPR / Cas9 backbone

[0179]

[0180] Table 3 PCR system used to amplify CRISPR / Cas9 backbone

[0181]

[0182] Table 4 PCR program used to amplify the CRISPR / Cas9 backbone

[0183]

[0184] (3) Connection conversion

[0185] According to the ligation system required by Novagen ligase (C112-01, Nanjing Novagen Biotech Co., Ltd., Nanjing) (as shown in Table 5), the specific primer sequence SEQ ID NO.2 designed in (1) and the CRISPR / Cas9 backbone fragment in (2) were reacted at 37°C for 30 min, and then the ligation product was added to competent cells (TCS-C01-100, Beijing Qingke Biotech Co., Ltd., Beijing), cooled on ice for 5 min, reacted at 42°C for 1 min, and then cooled on ice for 2 min before being coated on Amp + Solid medium, culture overnight at 37℃ for 16h, pick 5 single colonies and expand the culture until the bacterial solution is turbid, pick 2 of them for sequencing, and correct sequencing indicates that the plasmid is successfully constructed;

[0186] Table 5 Construction of the connection system of pCas9-gRNA-TGGT1_202920 plasmid

[0187]

[0188] 2. Amplify the Tub::YFP::DHFR*-TGGT1_202920 homologous template fragment

[0189] Using Tub-YFP-DHFR* plasmid as a template (sequence see SEQ ID NO.6), according to the system and procedure of the instruction manual of Novagen high-fidelity enzyme (P505, Nanjing Novagen Biotech Co., Ltd., Nanjing) (as shown in Tables 3 and 4), the homologous template was amplified using the primers in Table 6, and the amplified product was purified using the Novagen product purification kit (DC301-01, Nanjing Novagen Biotech Co., Ltd., Nanjing).

[0190] The sequence of the Tub-YFP-DHFR* plasmid is:

[0191]

[0192] Table 6 Primers for amplifying Tub::YFP::DHFR*-TGGT1_202920 homologous template fragments

[0193]

[0194] 3. Construction and identification of the Toxoplasma gondii knockout strain ΔTGGT1_202920

[0195] (1) Enrichment of parental insect strains

[0196] The type I parent strain DiCre was inoculated into HFF cells and cultured in a constant temperature incubator at 37°C and 5% CO2. When the parasites escaped from the intracellular vesicles, the extracellular parasites were first washed with PBS, and then all the intracellular parasites were scraped off and blown 10 times with a 5mL syringe, transferred to a 15mL centrifuge tube, and centrifuged at 1000rpm for 3min; the supernatant was collected, and the parasites were filtered and purified using a high-pressure sterilized filter (420200, Whatman, UK) and a filter membrane with a pore size of 3μm (10418306, Whatman, UK), and centrifuged at 3000rpm for 8min; the supernatant was discarded, and 8mL of Cytomix (120mM KCl, 0.15mM CaCl2, 10mM K2HPO4 / KH2PO4, 25mM HEPES, 2mM EGTA, 5mM MgCl2, pH = 7.6) to resuspend the worms, centrifuge again at 3000 rpm for 8 min, and resuspend in 300 μL Cytomix;

[0197] (2) Add the resuspended worms in step (1), 1500 ng of Tub::YFP::DHFR*-TGGT1_202920 homologous fragment and 7500 ng of pCas9-gRNA-TGGT1_202920 plasmid into a sterile 1.5 mL EP tube and mix evenly. Transfer all of them into a 4 mm electroporation cup and place them in a BTX electroporator (ECM630, USA) for 2 min. Electroporate once at 1600 V, 25 μF, 50 Ω, and 4 mm. Electroporate twice at 1500 V, 25 μF, 50 Ω, and 4 mm. After the electroporation, add all of the mixed solution into a T25 culture flask containing HFF cells for culture and observation.

[0198] (3) Since the strain carries a YFP tag, when larger green fluorescent vesicles are seen under a fluorescence microscope, DMEM medium containing 1 μM pyrimethamine and 2% FBS can be used for drug screening. When the positive rate is high and the strain is stable, a monoclonal strain can be selected;

[0199] (4) A portion of the worm bodies screened in the previous step was subcultured for future use, and the other portion was enriched and counted: ① Scrape all the cells with a cell scraper, mix them evenly with a 5 mL syringe, transfer them to a 15 mL centrifuge tube, and centrifuge them at 1000 rpm for 3 min; ② Take an appropriate amount of supernatant, dilute it with DMEM medium containing 2% FBS to a 1.5 mL sterile centrifuge tube, mix it evenly, take 10 μL and add it to a counting plate (177-112C, Whatson, Japan), let it stand for 2 min, and then place it on a light microscope. 3. According to the counting results, take an appropriate amount of the supernatant containing the worms and add it to 20 mL of DMEM medium containing 2% FBS, so that the number of worms in the medium is 100, mix well, and then add 200 μL / well to a 96-well plate, and culture in an incubator at 37°C and 5% CO2; 4. After 7 days of culture, observe under a microscope and select the worm strains that show single spots under both optical and fluorescent microscopes, collect half of them to extract DNA for worm strain identification, and subculture and expand the other half;

[0200] (5) The construction model of TGGT1_202920 gene knockout strain is shown in the figure below. Figure 1 As shown in Table 7, the monoclonal insect strains selected in the above steps were subjected to PCR identification, and the results were as follows: Figure 2 As shown, the band sizes shown by PCR1 and PCR2 of the monoclonal strain are consistent with expectations, and there is no band in PCR3. However, there is no band in PCR1 and PCR2 of the parent DiCre, and the band size amplified by PCR3 is consistent with expectations, indicating that the TGGT1_202920 gene in the parent strain has been successfully knocked out, that is, the ΔTGGT1_202920 monoclonal strain has been successfully constructed.

[0201] Table 7 PCR primers for identification of monoclonal strains of ΔTGGT1_202920

[0202]

[0203]

[0204] Furthermore, in order to verify whether the Toxoplasma gondii vaccine strain ΔTGGT1_202920 lacking the TGGT1_202920 gene constructed in the above example can be used for vaccine preparation, in vitro experiments and in vivo experiments were performed respectively:

[0205] 1. In vitro plaque assay of ΔTGGT1_202920 strain

[0206] (1) Enrichment, purification and counting of parasites

[0207] DiCre and ΔTGGT1_202920 strains were cultured in vitro until a small amount of parasites escaped from the intraparasitic vesicles. The supernatant in the T25 culture flask was discarded, the flask was washed twice with PBS, 2 mL of DMEM medium containing 2% FBS was added, all cells were scraped off with a cell scraper, and then the cells were repeatedly blown with a syringe for 10 times. The liquid in the flask was collected into a 15 mL centrifuge tube and centrifuged at 1000 rpm for 3 min; the parasites were filtered and purified using a high-pressure sterilized filter (420200, Whatman, UK) and a filter membrane with a pore size of 3 μm (10418306, Whatman, UK), 10 μL of the supernatant was added to a counting plate (177-112C, Whatson, Japan), and counted under an optical microscope after standing for 2 min;

[0208] (2) Invasion and cultivation of insects

[0209] According to the counting results, the supernatant was diluted with DMEM medium containing 2% FBS, and DiCre and ΔTGGT1_202920 strains were inoculated into 6-well plates filled with HFF cells at 100 Tg / 3 mL / well, and cultured in a 37°C, 5% CO2 incubator for 7 days;

[0210] (3) Staining and photography

[0211] After 7 days of culture, the supernatant of the 6-well plate was discarded, and 2 mL of PBS was added to each well to wash twice; fixed with 4% paraformaldehyde (1 mL / well) at 37°C for 20 min, and washed twice with PBS; 2 mL of 0.1% crystal violet was added to each well and stained at 37°C for 30 min, and 2 mL of PBS was added to each well to wash three times. After air drying, the 6-well plate was scanned and photographed with a scanner ScanMaker i600 (MICROTEK, Shanghai Zhongjing Technology Co., Ltd.).

[0212] The results are as follows Figure 3 As shown, under normal culture conditions, both the parental strain DiCre and the knockout strain ΔTGGT1_202920 can form plaques of similar size, indicating that the deletion of the TGGT1_202920 gene has almost no effect on the in vitro growth of Toxoplasma gondii.

[0213] 2. In vivo virulence and immune protection experiments of the ΔTGGT1_202920 strain

[0214] 1) In vivo virulence test of ΔTGGT1_202920 strain

[0215] (1) Referring to the method for enriching parasites in the above steps, the DMEM medium containing 2% FBS was replaced with serum-free DMEM medium, and the tachyzoites of the parental strain DiCre and the knockout strain ΔTGGT1_202920 were collected and purified. The parental strain DiCre was cultured at 10 2Eight ICR mice were inoculated with a dose of Tg / 200 μL / mouse as the control group, and the knockout strain ΔTGGT1_202920 was inoculated with 10 2 , 10 3 , 10 4 , 10 5 , 10 6 8, 5, 5, 5, and 5 ICR mice were inoculated at a dose of Tg / 200 μL / mouse;

[0216] (2) After infection, the health status of mice was recorded every day to observe whether clinical symptoms such as rough fur, mental depression, abdominal effusion, and death occurred;

[0217] (3) After 30 days, the results were statistically analyzed, such as Figure 4 As shown, the survival rate of mice inoculated with the parental DiCre strain was only 12.5%; 2 , 10 3 , 10 4 , 10 5 , 10 6 The survival rate of mice inoculated with ΔTGGT1_202920 parasites at a dose of Tg / 200 μL / mouse was 100%, indicating that the ΔTGGT1_202920 parasite strain has almost no toxicity.

[0218] 2) Immune protection of ΔTGGT1_202920 strain

[0219] (1) Cultivating the ΔTGGT1_202920 strain in vitro, enriching, purifying and diluting the ΔTGGT1_202920 strain in serum-free DMEM medium according to the method of enriching and purifying the worms in the above steps. 2 Ten blank mice were immunized with a dose of Tg / 200 μL / mouse. The mouse serum was tested 30 days later, and the test results of six mice were positive, which were used for subsequent experiments.

[0220] (2) When the mice immunized in step (1) were immunized for 72 days, the ME49 strain (kindly donated by Anhui Medical University) was enriched, purified and diluted with serum-free DMEM medium according to the method of enriching and purifying the parasites in the above steps. 4 The 6 immunized mice and 6 blank mice were infected with a dose of Tg / 200 μL / mouse. The health status and survival of the mice were closely monitored, and prism8 was used to draw a mouse survival rate curve.

[0221] The results are as follows Figure 5As shown, all mice in the non-immunized group died within 21 days after infection with ME49, while all mice immunized with ΔTGGT1_202920 survived within 30 days after infection with ME49 and showed no clinical symptoms. This shows that mice immunized with ΔTGGT1_202920 can resist infection with wild-type Toxoplasma gondii to a certain extent.

[0222] In summary, Toxoplasma can still be cultured normally in vitro after knocking out the TGGT1_202920 gene, and its in vitro proliferation rate is similar to that of the parental strain, and it has almost non-toxic characteristics in vivo; further, mice immunized with ΔTGGT1_202920 can produce good immune protection and effectively resist infection by wild-type Toxoplasma.

[0223] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A method for constructing a Toxoplasma gondii gene knockout vaccine strain, characterized in that: The following steps are involved: (1) According to the principle of CRISPR / Cas9 gene editing, the target sgRNA sequence of the target gene TGGT1_202920 was designed; the nucleotide sequence of the TGGT1_202920 gene is shown in SEQ ID NO.1; (2) Integrate the sgRNA sequence in (1) into the linearized CRISPR / Cas9 backbone by homologous recombination to construct the TGGT1_202920 gene-specific CRISPR / Cas9 plasmid pCas9-gRNA-TGGT1_202920; (3) Using pTub-YFP-DHFR* plasmid as template, amplify the homologous template Tub::YFP::DHFR*-TGGT1_202920; (4) The pCas9-gRNA-TGGT1_202920 plasmid and homologous recombination template were co-electroporated into the parental strain DiCre, and the Toxoplasma gondii gene knockout vaccine strain ΔTGGT1_202920 with the TGGT1_202920 gene knocked out was obtained through pyrimethamine screening, PCR and IFA identification.

2. Use of the Toxoplasma gondii gene knockout vaccine strain constructed by the method according to claim 1 in the preparation of an anti-toxoplasmosis vaccine.

3. The use according to claim 2, characterized in that: The anti-toxoplasmosis vaccine contains the Toxoplasma gondii gene knockout vaccine strain ΔTGGT1_202920.

4. The use according to claim 2, characterized in that: The anti-toxoplasmosis vaccine further contains a medically acceptable vaccine adjuvant.

Images