Construction method and application of pru delta pp2a-c of toxoplasma gondii attenuated strain
By knocking out the Toxoplasma TgPP2A-C gene to construct a weak strain PruΔpp2a-c, the problem of poor protection effect of existing vaccines is solved, effective immune protection against Toxoplasma is achieved, and it is suitable for Toxoplasma live vaccine.
Patent Information
- Application Number
- CN202211569357.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-07
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2042-12-07
AI Technical Summary
The immune protection effect of existing toxoplasma vaccines is not ideal, and attenuated vaccines such as the S48 attenuated strain of Toxoplasma gondii have unclear genetic backgrounds and reversion toxins, making them unable to effectively prevent and control human toxoplasma infection.
By knocking out the TgPP2A-C gene in Toxoplasma gondii, the CRISPR-Cas9 technology was used to construct the attenuated Toxoplasma strain PruΔpp2a-c, affecting its starch metabolism and cyst formation, and obtaining a attenuated strain with immune protection.
The attenuated strain of Toxoplasma gondii with the TgPP2A-C gene deleted significantly reduces pathogenicity in mice, provides a high level of immune protection, prevents acute and chronic infections, and is highly safe, making it suitable for Toxoplasma live vaccine.
Smart Images

Figure CN116103156B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application relates to the technical field of biological medicine, in particular to a construction method and application of a weak strain of Toxoplasma PruDeltaPP2a-c. BACKGROUND
[0002] Toxoplasma gondii is an obligate intracellular opportunistic pathogen that can infect almost all warm-blooded animals including humans. About one-third of the world's population is infected with Toxoplasma. When humans ingest raw meat containing Toxoplasma tissue cysts or water, food contaminated with oocysts from cat feces, the tissue cysts or oocysts rupture, the tachyzoites released from the tissue cysts or the sporozoites released from the oocysts invade the intestinal mucosal cells, and the sporozoites eventually distribute to various parts of the body, causing host infection with Toxoplasma. After normal immune people are infected with Toxoplasma, the host does not show obvious clinical symptoms under the action of the immune system of the body. However, for patients with low immune function, such as organ transplant patients and AIDS patients, Toxoplasma infection has a high risk and can even lead to host death. The existing drug treatment only acts on the tachyzoite stage of the worm, and has little effect on the bradyzoite in the cyst, and the use of the drug has certain toxic side effects.
[0003] In recent years, domestic and foreign scholars believe that developing a vaccine to immunize the host may be an effective measure to prevent and control Toxoplasmosis. At present, the development of Toxoplasma vaccines mainly focuses on inactivated vaccines, subunit vaccines, nucleic acid vaccines and the like, but such vaccines can only provide partial immune protection for the immune body, and cannot achieve complete protection, and the immune protection effect is not ideal. Attenuated vaccines have the advantages of good immunogenicity and long immune period, and have become one of the best choices for the prevention and control of Toxoplasmosis. However, at present, only one strain of S48 Toxoplasma attenuated live vaccine is allowed to be used in the prevention of abortion of goats and sheep, but this vaccine is only limited to use in New Zealand and the like, and the genetic background is unknown, and the phenomenon of returning to toxicity is easy to occur. Therefore, searching for a new effective vaccine candidate antigen for the development of an anti-Toxoplasma vaccine has become an important task for protecting human health. SUMMARY
[0004] Therefore, the application aims to provide a construction method and application of a weak strain of Toxoplasma PruDeltaPP2a-c. By knocking out the TgPP2A-C gene in Toxoplasma, a weak strain of Toxoplasma with a deleted TgPP2A-C gene is finally obtained. It is found that after knocking out TgPP2A-C, a large number of starch granules are aggregated between the worms and the worms cannot form cysts in mice. Immunization of mice with the weak strain of Toxoplasma PruDeltaPP2a-c can provide immune protection against acute and chronic infection with Toxoplasma.
[0005] In order to achieve the above-mentioned purpose, the application provides the following technical solutions.
[0006] The application provides a construction method of a weak strain of Toxoplasma PruDeltaPP2a-c, and the construction method is used for constructing the weak strain of Toxoplasma by knocking out a TgPP2A-C gene to affect starch metabolism, virulence and cyst formation of Toxoplasma; and the nucleotide sequence of the TgPP2A-C gene is shown as SEQ ID NO. 1.
[0007] Preferably, the knockout of the TgPP2A-C gene is performed by using a CRISPR-Cas9 mediated technology.
[0008] Preferably, the nucleotide sequence of the sgRNA of the CRISPR / Cas9 system is shown as SEQ ID NO. 2.
[0009] The application further provides the weak strain of Toxoplasma PruDeltaPP2a-c constructed by the construction method of the weak strain of Toxoplasma PruDeltaPP2a-c.
[0010] The application further provides application of the weak strain of Toxoplasma PruDeltaPP2a-c in a medicine for preventing or treating Toxoplasma infection.
[0011] The application further provides a live attenuated vaccine of Toxoplasma, which comprises the weak strain of Toxoplasma PruDeltaPP2a-c.
[0012] Beneficial technical effects: the application provides the construction method and application of the weak strain of Toxoplasma PruDeltaPP2a-c, the TgPP2A-C gene in Toxoplasma is knocked out, and finally the weak strain of Toxoplasma with the TgPP2A-C gene deleted is obtained; compared with a wild strain, the in-vitro proliferation speed of the weak strain of Toxoplasma with the TgPP2A-C gene deleted is significantly reduced, and the pathogenicity is significantly reduced. Mice infected with the TgPP2A-C gene deleted strain show no disease and no death, and no cysts are detected in brain tissues of the mice, and the host has high safety. Meanwhile, after the mice are immunized by the weak strain of Toxoplasma with the TgPP2A-C gene deleted, high IgG antibody levels are generated, and the mice can provide significant immune protection efficacy for high-dose Toxoplasma RH tachyzoite and Pru cyst re-infection, and can be used for preventing re-infection of Toxoplasma, and are live attenuated vaccines with great application value. BRIEF DESCRIPTION OF DRAWINGS
[0013] Figure 1 FIG. 1 is a schematic diagram of construction of the weak strain of Toxoplasma PruDeltaPP2a-c, wherein A is a schematic diagram of knockout of the TgPP2A-C gene; and B is a PCR identification result diagram of the PruDeltaPP2a-c strain, wherein PCR1 and PCR3 respectively represent 5' and 3' integration of a homologous fragment, and PCR2 represents whether the TgPP2A-C gene is successfully replaced;
[0014] Figure 2The plaque images of wild-type strains Pru and PruΔpp2a-c are shown;
[0015] Figure 3 Figure 2 shows the results of starch granule staining experiments of wild-type Pru and PruΔpp2a-c;
[0016] Figure 4 Figure 2 is the result of bradyzoite transformation experiment of wild-type Pru and PruΔpp2a-c;
[0017] Figure 5 Infect mice with 2×10 4 The survival rates of the Pru and PruΔpp2a-c attenuated strains;
[0018] Figure 6 is the survival rate of immunized mice infected with RH Toxoplasma gondii;
[0019] Figure 7 The survival rate of mice after oral gavage of the cysts;
[0020] Figure 8 is the number of brain cysts in mice 30 days after cyst infection;
[0021] Figure 9 Antibody levels of IgG, IgG1, and IgG2a in the sera of immunized or control mice;
[0022] in, Figures 5 to 9 "ns" means p>0.05, the difference is not significant, and "***" means p<0.001, the difference is extremely significant. DETAILED DESCRIPTION
[0023] The present invention provides a method for constructing a toxoplasma gondii attenuated strain PruΔpp2a-c, wherein the attenuated toxoplasma gondii strain PruΔpp2a-c is constructed by knocking out the TgPP2A-C gene to affect starch metabolism and cyst formation of Toxoplasma gondii; the nucleotide sequence of the TgPP2A-C gene is shown in SEQ ID NO.1.
[0024] In the present invention, the method for constructing a toxoplasma gondii attenuated strain lacking the TgPP2A-C gene comprises the following steps:
[0025] (1) Construction of knockout plasmid: Replace UPRT in pSAG1-Cas9-SgUPRT with TgPP2A-C, i.e., construct plasmid pSAG1-Cas9-SgTgPP2A-C; construct a homologous fragment DHFR containing TgPP2A-C, design 5′ homology arm and 3′ homology arm primers near the start codon and stop codon of the TgPP2A-C gene, and design universal amplification primers of pUPRT-DHFR-D and pUC19, and connect them; finally, amplify the DHFR plasmid that has been successfully sequenced.
[0026] (2) Construction of a weak strain of Toxoplasma gondii: The pSAG1-Cas9-SgTgPP2A-C knockout plasmid and the resistance fragment containing the TgPP2A-C homology arm were electroporated into Toxoplasma gondii. After screening and identification, a weak strain of Toxoplasma gondii was obtained, which was recorded as PruΔpp2a-c.
[0027] In the present invention, the TgPP2A-C gene is preferably knocked out using CRISPR-Cas9 technology.
[0028] In the present invention, the nucleotide sequence of the sgRNA of the CRISPR / Cas9 system is shown in SEQ ID NO.2.
[0029] The present invention also provides a Toxoplasma gondii attenuated strain PruΔpp2a-c constructed by the above-mentioned construction method of the Toxoplasma gondii attenuated strain PruΔpp2a-c.
[0030] The present invention also provides a use of the attenuated Toxoplasma gondii strain PruΔpp2a-c in a drug for preventing or treating Toxoplasma gondii infection.
[0031] The present invention has no particular limitation on the dosage form of the drug, and any dosage form of a medically acceptable attenuated strain of Toxoplasma gondii can be used. The present invention has no particular limitation on the preparation method of the drug, and any preparation method of the corresponding dosage form can be used.
[0032] The present invention also provides a toxoplasma gondii attenuated live vaccine, comprising the above-mentioned toxoplasma gondii attenuated strain PruΔpp2a-c.
[0033] For a better understanding of the present application, the following further describes the present application with reference to the examples, but the present application is not limited to the following examples. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available unless otherwise specified. The methods used in the present application examples and test examples are conventional methods unless otherwise specified. The Toxoplasma strain used in the present application is disclosed in (Fox BA, Falla A, Rommereim LM, Tomita T, Gigley JP, Mercier C, Cesbron-Delauw MF, Weiss LM, Bzik DJ. Type II Toxoplasma gondii KU80 knockout strains enable functional analysis of genes required for cyst development and latent infection. Eukaryot Cell. 2011 Sep; 10(9): 1193-206. doi: 10.1128 / EC.00297-10.).
[0034] Example 1
[0035] Construction of the attenuated strain of Toxoplasma PruΔpp2a-c is shown as follows, including the following steps: Figure 1
[0036] (1) Construction of knockout plasmid:
[0037] According to the TgPP2A-C gene (TGME49_224220) in the Toxoplasma genome website ToxoDB (https: / / toxodb.org / ), an sgRNA was designed, and the nucleotide sequence thereof is shown as SEQ ID NO. 2. The UPRT in pSAG1-Cas9-SgUPRT was replaced with TgPP2A-C using a Q5 site-directed mutagenesis kit, i.e., the plasmid pSAG1::Cas9::SgTgPP2A-C was constructed. The construction of the TgPP2A-C homologous fragment DHFR, the 5' end homologous arm and 3' end homologous arm primers were designed near the start codon and stop codon of the TgPP2A-C gene, wherein the nucleotide sequence of the upstream primer of the 5' end homologous arm primer is shown as SEQ ID NO. 3, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 4; the nucleotide sequence of the upstream primer of the 3' end homologous arm primer is shown as SEQ ID NO. 5, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 6.
[0038] The amplification primer of DHFR and pUC19 amplification primer were designed, wherein the nucleotide sequence of the upstream primer of the DHFR universal amplification primer amplified from the pUPRT-DHFR-D vector is shown as SEQ ID NO. 7, the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 8; the nucleotide sequence of the upstream primer of pUC19 is shown as SEQ ID NO. 9, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 10
[0039] According to The ligation was performed by using MultiS One Step Cloning Kit, wherein the ligation system was as follows:
[0040]
[0041] Then, the ligation product was transformed into DH5α competent cells, and finally, the DHFR plasmid PUC19-TgPP2A-C-DHFR with successful sequencing was amplified, i.e. the homologous fragment DHFR was amplified, wherein the nucleotide sequence of the upstream primer of the amplification primer is shown as SEQ ID NO. 11, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 12.
[0042] The reaction system for the amplification was as follows:
[0043]
[0044] The reaction conditions were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 3 min, a total of 30 cycles; and finally 72℃ extension for 8 min.
[0045] The specific nucleotide sequences of SEQ ID NO. 2 to SEQ ID NO. 12 are shown as follows:
[0046] SEQ ID NO. 2: GCCGACTTTCATGATTGCCT;
[0047] SEQ ID NO. 3:
[0048] GGTTTTCCCAGTCACGACGTTATCTGTTTCGGAGCATCAAGG;
[0049] SEQ ID NO. 4:
[0050] GGATTTACAGCCTGGCGAAGCTTCCCAAGTAATGGTCAGGCAAG;
[0051] SEQ ID NO. 5:
[0052] CTATGCACTTGCAGGATGAATTCCTTACGCCGTCGAGAAATCAC;
[0053] SEQ ID NO.6:
[0054] GAGCGGATAACAATTTCACACTCAGTCCCGAAACGAAATCA;
[0055] SEQ ID NO.7: AAGCTTCGCCAGGCTGTAAATCC;
[0056] SEQ ID NO.8: GAATTCATCCTGCAAGTGCATAG;
[0057] SEQ ID NO.9: TGTGAAATTGTTATCCGCTC;
[0058] SEQ ID NO.10: AACGTCGTGACTGGGAAAACC;
[0059] SEQ ID NO.11: ATCTGTTTCGGAGCATCAAGG;
[0060] SEQ ID NO. 12: CTCAGTCCCGAAACGAAATCA.
[0061] (2) Construction of the PruΔpp2a-c strain:
[0062] HFF cells were seeded into 75T cell culture flasks and incubated in a 37°C CO2 incubator with 16 mL of DMEM medium supplemented with 10% FBS. Once fully grown, the medium was replaced with 16 mL of DMEM medium supplemented with 2% FBS, and 1 mL of freshly released Pru tachyzoites was added. After 60 hours of incubation, the tachyzoites were collected and purified for electroporation of Toxoplasma gondii. The pSAG1-Cas9-SgTgPP2A-C plasmid and a DHFR-resistant fragment containing the TgPP2A-C homology arms were electroporated into Toxoplasma gondii. Monoclonal strains were obtained by limiting dilution using pyrimethamine and 96-well plate culture. After amplification, genomic DNA was extracted and the 5' and 3' homology arms and CDS open reading frame of the TgPP2A-C gene were amplified to verify TgPP2A-C gene knockout. The nucleotide sequences of the amplification primers are shown in SEQ ID NOs. 13 to 18. SEQ ID NO.13 to SEQ ID NO.14 are the upstream primer and downstream primer for amplifying the 5' homology arm, respectively; wherein the reaction system is:
[0063]
[0064] Reaction condition: 95℃ pre-denaturation 4 min; 95℃ denaturation 30 S, 56℃ annealing 30 S, 72℃ extension 1 min, 30 cycles in total; finally 72℃ extension 8 min.
[0065] SEQ ID NO. 15-SEQ ID NO. 16 are respectively the upstream primer and the downstream primer for amplifying the 3' homologous arm; wherein the amplification reaction system is as follows:
[0066]
[0067] Reaction condition: 95℃ pre-denaturation 3 min; 95℃ denaturation 30 S, 56℃ annealing 30 S, 72℃ extension 2 min, 30 cycles in total; finally 72℃ extension 5 min.
[0068] SEQ ID NO. 17-SEQ ID NO. 18 are respectively the upstream primer and the downstream primer for amplifying the PP2A-C open reading frame. Wherein, the reaction system is as follows:
[0069]
[0070] Reaction condition: 95℃ pre-denaturation 3 min; 95℃ denaturation 30 S, 56℃ annealing 30 S, 72℃ extension 20 S, 30 cycles in total; finally 72℃ extension 5 min.
[0071] SEQ ID NO. 13: TGCCCCTTCCTTGCCTCCGCGCGC;
[0072] SEQ ID NO. 14: GCCAAAGTAGAAAGGAATTAGCAT;
[0073] SEQ ID NO. 15: TGACGCAGATGTGCGTGTATCCAC;
[0074] SEQ ID NO. 16: GATATTTACACAATTCGTATCC;
[0075] SEQ ID NO. 17: AACAAGATCCGTGAAGACAAC;
[0076] SEQ ID NO. 18: TAGAAGAAGGAGGAAACCAGA;
[0077] The PCR identification result of the PruΔpp2a-c insect strain is shown in Fig. B, which is obtained by Figure 1 B Figure 1B can be seen, PCR1 and PCR3 have specific bands, PCR2 has no specific band, confirming that TgPP2A-C has been knocked out.
[0078] Test:
[0079] (1) Basic phenotype analysis:
[0080] Plaque assay: a small amount of completely escaped wild strain Pru and PruΔpp2a-c insect strains were taken from 25T cell bottles, and after counting, the final concentration was made to be 2x10 3 μL per well, and the tachyzoites were evenly distributed in the well by gently shaking. Finally, the cells were placed in the cell incubator; cultured for 7 days, the supernatant was discarded, and PBS solution was added to wash the bottom of the well for 5 times; 1 mL of tissue fixative was added for 20 min, the supernatant was discarded, and PBS solution was washed for 5 times; 1 mL of 0.25% crystal violet was added to each well for 20 min, the supernatant was discarded, and PBS solution was washed for 8 times. The remaining liquid on the well periphery was absorbed with a water-absorbing paper, and after air drying, the size and number of insect plaques were observed by taking pictures.
[0081] Glycogen PAS staining test: a small amount of completely escaped wild strain Pru and PruΔpp2a-c insect strains were taken from 25T cell bottles, and the final concentration was diluted to 10 4 μL per well. After 36 h of culture in the confocal dish, the DMEM culture solution was discarded, and 600 μL of tissue fixative was added for 20 min at room temperature. The cell culture dish was washed with PBS solution for 5 times, 600 μL of 0.2% Triton X-100 was added for 20 min at room temperature, 500 μL of PAS oxidant was added for 20 min, the supernatant was discarded, and the cell culture dish was washed with PBS solution for 5 times. 500 μL of Schiff staining solution was added for 20 min, and the cell culture dish was washed with PBS solution for 6 times. The prepared primary antibody was added to each dish, and it was incubated overnight in the refrigerator at 4°C: the primary antibody was rabbit anti-IMC1 (1:500); the prepared secondary antibody was added to each dish, and it was incubated for 1 h in the incubator at 37°C in the dark: the secondary antibody was A1exa Fluor 488 goat anti-rabbit IgG (H+L) (1:1000); the cell culture dish was observed under the laser confocal microscope after washing with PBS solution for 4 times.
[0082] Tachyzoite transformation test of Toxoplasma bradyzoite: a small amount of completely escaped wild strain Pru and PruΔpp2a-c insect strains were taken from 25T cell bottles, and after counting, the final concentration was diluted to 1x10 5100 μL of each solution was added to a small dish filled with HFFs and cultured in normal culture medium for 4 h. Non-invading tachyzoites were then washed away with prewarmed DMEM solution. The medium was changed to pH 8.2 and cultured for another 4 days (the medium was changed daily to maintain high alkalinity). After 4 days of culture, the supernatant was discarded, the cells were fixed with tissue fixative for 20 min, and washed four times with PBS. 0.2% Triton X-100 was added for permeabilization for 20 min. The cells were washed four times with PBS and blocked with 3% BSA for 60 min. The cells were washed four times with PBS and rabbit anti-Toxoplasma gondii IMC1 monoclonal antibody (1:500) was added and incubated at 4°C overnight. The cells were washed four times with PBS and AlexaFluor 594 goat anti-rabbit IgG (H+L) (1:1000) and FITC-labeled Dolichos biflorus lectin (DBL) (1:500) were added and incubated at 37°C for 1 h. The cells were washed four times with PBS and the proportion of DBL-positive plaques was recorded and counted under a fluorescence microscope.
[0083] (2) Preparation of live attenuated vaccines:
[0084] HFF cells were inoculated into a 75T cell culture flask, 16 mL of DMEM medium containing 10% FBS was added, and the cells were cultured in a 37°C CO2 incubator. After the cells were fully grown, 16 mL of DMEM medium containing 2% FBS was replaced with 1 mL of PruΔpp2a-c strain. The cells were cultured in a 37°C CO2 incubator until the parasites escaped from the cells, and PruΔpp2a-c tachyzoites were collected. The collected parasite suspension was filtered with a 3 μm filter to remove cell debris, and the tachyzoite concentration was adjusted to 10 with sterile PBS. 4 / 100μL; the PruΔpp2a-c live attenuated vaccine was prepared.
[0085] (3) Toxicity test in mice:
[0086] Before vaccination, the purchased Kunming female mice were raised for one week to reduce stress response. The mice were divided into two groups. One group was the immunization group: each mouse was injected intraperitoneally with 200 μL (about 2×10 4 The other group was the control group: each mouse was intraperitoneally injected with 200 μL (about 2×10 4 The survival of the mice was observed, and the surviving mice were killed after 30 days, and the cysts in the brain tissue were counted.
[0087] (4) Immunization of mice:
[0088] The mice were divided into two groups. One group was the immunization group: each mouse was injected intraperitoneally with 200 μL (about 2×104 The other group is blank control group: each mouse is injected with 200 μL sterile PBS in the abdominal cavity.
[0089] Acute Toxoplasma infection test: on the 45th day after immunization, 10 Kunming mice from each of the PruΔpp2a-c immunization group and the blank control group are taken, a small amount of wild strain RH tachyzoite that has completely escaped from the 25T cell bottle is counted with a hemocytometer, and the final concentration is diluted to 500 per 100 μL. 200 μL of RH tachyzoite is taken to inject the mice in the abdominal cavity, and the abdominal injection amount is about 10 3 per mouse. The day of the attack is recorded as day 0, and the health status of the mice is observed every day after infection, and the survival time is recorded. On the 30th day after infection, the surviving mice are euthanized.
[0090] Chronic Toxoplasma infection test: on the 45th day after immunization, 10 Kunming mice from each of the PruΔpp2a-c immunization group and the blank control group are taken, and the active type II strain Pru cysts prepared in advance are administered to each mouse at a dose of 20 for gavage infection. The health status of the mice is observed every day after the attack, and the survival time is recorded. On the 30th day after the Pru cyst infection, the surviving mice are euthanized, and the number of cysts in the brain tissue is detected.
[0091] (5) Evaluation of immunization effect:
[0092] Antibody monitoring between different groups: the sera of 6 immunized mice and blank mice are collected on the 45th day after immunization for detection of IgG antibody and IgG1 and IgG2a antibody subclass levels.
[0093] Results:
[0094] (1) Basic phenotype analysis:
[0095] ① Plaque test: the results of the plaque test are shown in Table 1, and it can be seen from Table 1 that the plaques formed by PruΔpp2a-c are extremely significantly lower in size and number than the plaques formed by the wild strain Pru, and PruΔpp2a-c is almost unable to form plaques. Figure 2 Figure 2 ② Glycogen PAS staining test: the results of the glycogen staining test are shown in Table 2, and it can be seen from Table 2 that a large number of starch granules are aggregated in and between the PruΔpp2a-c worms.
[0096] ③ Toxoplasma bradyzoite transformation test: the results of the Toxoplasma bradyzoite transformation test are shown in Table 3, and it can be seen from Table 3 that the number of bradyzoite cysts in the PruΔpp2a-c worms is extremely significantly lower than that in the wild strain Pru. Figure 3 Figure 3
[0097] ③ Toxoplasma bradyzoite transformation test: the results of the Toxoplasma bradyzoite transformation test are shown in Table 3, and it can be seen from Table 3 that the number of bradyzoite cysts in the PruΔpp2a-c worms is extremely significantly lower than that in the wild strain Pru. Figure 4 Figure 4 It can be seen that the absence of TgPP2A-C results in the inability of Toxoplasma gondii to encyst after alkaline induction in vitro.
[0098] (2) Toxoplasma gondii toxicity test: The results of the Toxoplasma gondii toxicity test on wild-type Pru and PruΔpp2a-c tachyzoites are as follows: Figure 5 As shown by Figure 5 It can be seen that mice infected with wild-type tachyzoites died within 9 days, with a final survival rate of 40%, while mice infected with PruΔpp2a-c tachyzoites did not die. The survival time of mice infected with PruΔpp2a-c tachyzoites was significantly different from that of the control group (p < 0.01).
[0099] (3) Immunization mouse test:
[0100] ① Toxoplasma RH strain acute infection test: The results of Toxoplasma RH strain acute infection test are as follows Figure 6 As shown by Figure 6 It can be seen that all mice in the control group died within 9 days after infection with RH tachyzoites, while the mice in the PruΔpp2a-c immunization group died within 10 3 No mortality occurred after RH tachyzoites were detected, and the survival time of mice infected with PruΔpp2a-c tachyzoites was significantly different from that of the control group (p < 0.001).
[0101] ② Chronic Toxoplasma infection test: The results of the chronic Toxoplasma infection test are as follows: Figure 7 As shown by Figure 7 It can be seen that mice in the control group began to become ill and some died on the 7th day after infection, with a survival rate of 40%, while mice immunized with PruΔpp2a-c did not become ill or die.
[0102] The comparison results of the number of cysts in the brain tissue of surviving mice are as follows Figure 8 As shown by Figure 8 It can be seen that the number of cysts in the brain tissue of the control group mice was 2027, and the number of cysts in the brain tissue of the immunized group mice was 49. The number of cysts in the brain tissue of the immunized group mice was significantly different from that in the control group (p < 0.001).
[0103] (4) Immune effect evaluation:
[0104] The antibody levels in the sera of immunized mice and blank mice were as follows Figure 9 As shown by Figure 9 It can be seen that the levels of IgG, IgG1 and IgG2a in mice immunized with PruΔpp2a-c were significantly higher than those in the control group (p < 0.001).
[0105] The above merely describes the preferred embodiments of the present application, and it should be pointed out that, for those skilled in the art, several improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered as falling within the protection scope of the present application.
Claims
1. A method for constructing a toxoplasma gondii attenuated strain PruΔpp2a-c, characterized in that: A weak strain of Toxoplasma gondii was constructed by knocking out the TgPP2A-C gene to affect the starch metabolism, virulence and cyst formation of Toxoplasma gondii; the nucleotide sequence of the TgPP2A-C gene is shown in SEQ ID NO.
1.
2. The method for constructing the attenuated Toxoplasma gondii strain PruΔpp2a-c according to claim 1, characterized in that: The TgPP2A-C gene is knocked out using CRISPR-Cas9-mediated technology.
3. The method for constructing the attenuated Toxoplasma gondii strain PruΔpp2a-c according to claim 2, characterized in that: The nucleotide sequence of the sgRNA of the CRISPR / Cas9 system is shown in SEQ ID NO.
2. A attenuated Toxoplasma gondii strain PruΔpp2a-c constructed by the construction method of any one of claims 1 to 3. 5 . Use of the attenuated Toxoplasma gondii strain PruΔpp2a-c according to claim 4 in the preparation of a drug for preventing Toxoplasma gondii infection.
6. A toxoplasma gondii attenuated live vaccine, characterized in that: It includes the Toxoplasma gondii attenuated strain PruΔpp2a-c as described in claim 4.