Substitute virus infection model capable of simulating symptoms of human Marburg virus disease under BSL-2 as well as establishment method and application of substitute virus infection model

Abstract

The invention discloses an alternative virus infection model capable of being used for simulating human Marburg virus disease symptoms under BSL-2 as well as an establishment method and application of the alternative virus infection model, and belongs to the technical field of biology. According to the invention, firstly, a recombinant vesicular stomatitis virus (VSV-MARV / GP) for expressing Marburg virus glycoprotein is constructed, and the VSV-MARV / GP is used as an alternative virus to cause lethal infection of a narrative hamster. The pathogenicity of the VSV-MARV / GP has species specificity, age correlation, gender correlation and attack pathway dependency. After infection of VSV-MARV / GP, female narrative hamsters of 5 weeks old show weight loss, multiple organ failure, high virus load and other symptoms and develop into serious systemic diseases similar to those observed by human MARV patients, and all animals die within two to three days after infection. The model provided by the invention can be used as an effective tool for carrying out rapid preclinical evaluation on medical countermeasures of MARV under the BSL-2 condition.

Description

Technical Field

[0001] The present invention relates to the field of virus detection, and in particular to an alternative virus infection model that can be used to simulate symptoms of human Marburg virus disease under BSL-2, and a method for establishing the model and application thereof. Background Art

[0002] Marburg virus disease (MVD) is one of the highly contagious diseases caused by Marburg virus (MARV) characterized by fever and bleeding. Since its outbreak in 1967, Marburg virus disease has been spreading sporadically, mainly in Central Africa, with a mortality rate of up to 90%, posing a major threat to humans. The attention paid to MARV has increased significantly at home and abroad, and the research on corresponding MARV vaccines and antibodies is also progressing in an orderly manner. At present, there is no internationally approved MVD vaccine or treatment plan.

[0003] The difficulty and challenge of studying MARV is that it is classified as a biosafety level 4 (BSL-4) pathogen and needs to be studied in a BSL-4 laboratory, which requires strict experimental conditions and a lot of funding. Therefore, there is an urgent need for operable and practical animal models to advance the prevention and treatment strategies of MARV.

[0004] Vesicular Stomatitis Virus (VSV) reverse genetics technology has been widely used in recombinant viruses. It is highly safe and easy to package exogenous glycoproteins on the virus surface. VSV recombinant virus can replace the original virus for neutralizing antibody detection.

[0005] The purpose of this study is to construct an alternative animal model based on the VSV reverse genetics platform that can be used to evaluate MARV vaccines and antibodies in a biosafety level 2 (BSL-2) laboratory. Summary of the invention

[0006] One of the purposes of the present invention is to provide a method for establishing a surrogate virus infection model that can be used to simulate the symptoms of human Marburg virus disease under BSL-2, wherein the surrogate virus is a recombinant VSV virus, and the recombinant VSV virus is a recombinant vesicular stomatitis virus in which the G gene of VSV is replaced with the glycoprotein GP gene of MARV, referred to as VSV-MARV / GP; the infected animal of the infection model is a 5-week-old female Syrian hamster, and the infection dose is 10 7 TCID 50 , the route of infection is intraperitoneal infection.

[0007] Furthermore, the construction method of the VSV recombinant virus is as follows: the G gene in the VSV infectious clone full-length plasmid carrying the eGFP tag is replaced with the GP gene of MARV to obtain the MARV recombinant VSV full-length plasmid; the MARV recombinant VSV full-length plasmid is co-transfected with 4 VSV helper plasmids into BSR cells to rescue the MARV GP VSV carrying the eGFP tag, namely VSV-MARV / GP.

[0008] Furthermore, the Marburg virus is selected from the Angola strain.

[0009] A second object of the present invention is to provide an alternative virus infection model established using the above method that can be used to simulate the symptoms of human Marburg virus disease under BSL-2.

[0010] A third object of the present invention is to provide the use of the above-mentioned alternative virus infection model that can be used to simulate the symptoms of human Marburg virus disease under BSL-2 as an animal model for evaluating the effects of MARV antibodies or MARV vaccines.

[0011] Furthermore, the application environment is a biosafety level 2 laboratory.

[0012] Compared with the prior art, the technical effects of the present invention are:

[0013] The present invention first constructs a recombinant vesicular stomatitis virus (VSV-MARV / GP) expressing Marburg virus glycoprotein (GP), and uses it as a surrogate virus to cause lethal infection in Syrian hamsters. After infection with VSV-MARV / GP, 5-week-old female Syrian hamsters showed symptoms such as weight loss, multiple organ failure and high viral load, and developed severe systemic diseases similar to those observed in human MARV patients, and all animals died within two to three days after infection. Through experiments, the present invention also found that the pathogenicity of VSV-MARV / GP is species-specific, age-related, gender-related and attack route-dependent. Finally, the therapeutic effect of MR191 monoclonal antibody was verified in this model. In summary, the surrogate virus infection model for simulating human Marburg virus disease symptoms provided by the present invention can be used as an effective tool for rapid preclinical evaluation of medical countermeasures for MARV under BSL-2 conditions, avoiding the harsh experimental conditions and high costs required for experiments in biosafety level 4 (BSL-4) laboratories, thereby promoting the development of MARV vaccines and MARV antibodies. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For ordinary technicians in this field, other drawings can also be obtained based on these drawings.

[0015] Figure 1 This is a structural diagram of the MARV recombinant VSV full-length plasmid provided in an embodiment of the present invention.

[0016] Figure 2 The results of restriction enzyme digestion and identification of the MARV recombinant VSV full-length plasmid provided in the embodiment of the present invention. In the figure, 1 is p3.1-VSVΔG-eGFP-AngolaGP, and M1 is a DNA Marker.

[0017] Figure 3 Fluorescence micrographs of the rescue and subculture of the recombinant VSV virus provided in the embodiments of the present invention.

[0018] Figure 4 The RT-PCR identification results of the recombinant VSV virus provided in the embodiment of the present invention. In the figure, 1 is VSV-MARV / GP, 4 is WT-VSV, and M1 is DNA Marker.

[0019] Figure 5 The Western-blot identification results of the recombinant VSV virus provided in the embodiment of the present invention. In the figure, 1 is VSV-MARV / GP, 4 is WT-VSV, and M is a protein marker.

[0020] Figure 6 The results of indirect immunofluorescence test for recombinant VSV provided in the embodiment of the present invention are shown in Figure 1. In the figure, c is VSV-MARV / GP, and d is WT-VSV.

[0021] Figure 7 The morphological observation results of the recombinant VSV virus provided in the embodiment of the present invention under a transmission electron microscope. In the figure, a is VSV-MARV / GP, and b is WT-VSV.

[0022] Figure 8 The growth kinetics curves of the recombinant VSV virus and the parent VSV virus provided in the embodiments of the present invention.

[0023] Fig. 9 The weight changes and survival rates of different small rodents infected with VSV-MARV / GP provided in the embodiments of the present invention are shown in Figure 1. A is SD rat, B is BALB / c mouse, C is Hartley guinea pig, and D is Syrian hamster.

[0024] Fig.10 The weight change and survival rate of Syrian hamsters infected with different doses of VSV-MARV / GP provided in the embodiments of the present invention.

[0025] Fig.11 Blood biochemical indicators and blood cell counts of Syrian hamsters infected with VSV-MARV / GP provided in the embodiments of the present invention.

[0026] Fig.12 The viral load of VSV-MARV / GP in Syrian hamster tissue provided in the embodiment of the present invention.

[0027] Fig.13 Histopathology and immunohistochemistry of liver, spleen, lung and kidney of Syrian hamsters infected with VSV-MARV / GP provided in the examples of the present invention.

[0028] Fig.14 The weight changes and survival rates of Syrian hamsters of different genders infected with VSV-MARV / GP provided in the embodiments of the present invention.

[0029] Fig.15 The changes in blood indexes of Syrian hamsters of different genders infected with VSV-MARV / GP provided in the embodiments of the present invention.

[0030] Fig.16 Tissue viral loads of Syrian hamsters of different genders infected with VSV-MARV / GP provided in the embodiments of the present invention.

[0031] Fig.17 The pathology and immunohistochemistry of Syrian hamsters of different sexes infected with VSV-MARV / GP provided in the embodiment of the present invention, wherein D is pathology and E is immunohistochemistry.

[0032] Fig.18 Survival rate and weight change of Syrian hamsters of different ages infected with VSV-MARV / GP and tissue viral load 36 hours after infection are provided in the embodiments of the present invention. In the figure, A is the survival rate and weight change of 5-week-old Syrian hamsters infected with VSV-MARV / GP, B is the survival rate and weight change of 3-month-old Syrian hamsters infected with VSV-MARV / GP, C is the survival rate and weight change of 1-year-old Syrian hamsters infected with VSV-MARV / GP, and D is the tissue viral load of Syrian hamsters of different ages 36 hours after infection.

[0033] Fig.19 The weight changes and survival curves of Syrian hamsters infected with VSV-MARV / GP under different infection routes provided in the embodiments of the present invention.

[0034] Fig. 20The blood index changes of Syrian hamsters infected with VSV-MARV / GP under different infection routes provided in the embodiments of the present invention.

[0035] Fig.21 The tissue viral load of Syrian hamsters infected with VSV-MARV / GP under different infection routes provided in the embodiments of the present invention.

[0036] Fig. 22 The effects of the MR191 antibody provided in the embodiments of the present invention on the survival rate and weight change of Syrian hamsters infected with VSV-MARV / GP.

[0037] Fig.23 The viral load of Syrian hamster tissues infected with VSV-MARV / GP immunized with the MR191 antibody provided in the embodiment of the present invention.

[0038] Fig.24 The changes in blood markers of Syrian hamsters infected with VSV-MARV / GP immunized with the MR191 antibody provided in the embodiments of the present invention.

[0039] Fig.25 The immunohistochemical results of Syrian hamsters infected with VSV-MARV / GP immunized with the MR191 antibody provided in the embodiment of the present invention.

[0040] Fig.26 The pathological results of Syrian hamsters infected with VSV-MARV / GP immunized with the MR191 antibody provided in the embodiments of the present invention.

[0041] Fig. 27 The histochemical score of Syrian hamsters infected with VSV-MARV / GP immunized with the MR191 antibody provided in the embodiment of the present invention.

[0042] Fig.28 Pathological scores of Syrian hamsters infected with VSV-MARV / GP immunized with the MR191 antibody provided in the embodiments of the present invention.

[0043] Fig.29 The present invention provides a comparison of histopathological changes between humans and Syrian hamsters infected with Marburg virus. DETAILED DESCRIPTION

[0044] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention will be further described in detail below in conjunction with the embodiments and drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in the art without making creative work are within the scope of protection of the present invention.

[0045] The test materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent stores. The experimental methods in the following examples, unless otherwise specified, were conventional methods.

[0046] The Marburg virus strain selected in the present invention is the Angola strain, and the VSV virus used is preserved from the Changchun Veterinary Research Institute.

[0047] Example 1 Construction and identification of MARV GP recombinant VSV and its application in neutralizing antibody detection

[0048] 1.1 Construction and identification of MARV recombinant VSV full-length plasmid

[0049] The present invention replaces the G gene in the VSV infectious clone full-length plasmid carrying the eGFP label with the GP gene of MARV to obtain the MARV recombinant VSV full-length plasmid.

[0050] Specifically, p3.1-VSV-Angola-GP plasmid (preserved by Changchun Veterinary Research Institute) was used as a template to design PCR primers for the Angola-GP gene. The sequences were: Angola-GP-F: AAGGCGCGCCATGAAAACCACATGTCTCC; Angola-GP-R: AACGATCGTTATCCAATATTATTTAGTAAA, and AscⅠ restriction site was added upstream and PvuⅠ restriction site was added downstream of the primers. The GP gene was connected to the p3.1-VSVΔG-eGFP vector by molecular cloning technology to obtain the MARV recombinant VSV full-length plasmid (such as Figure 1 ), named p3.1-VSVΔG-eGFP-Angola GP. The MARV recombinant VSV full-length plasmid was identified by double restriction digestion with AscⅠ and PvuⅠ, and sent to Changchun Kumei Biotechnology Co., Ltd. for sequencing.

[0051] The results showed that the MARV recombinant VSV full-length plasmid was identified by double digestion with AscⅠ and PvuⅠ, and specific target bands were observed at around 15000 bp and 2046 bp, respectively. Figure 2 The results of plasmid sequencing showed that the gene fragments connected to the vector in the MARV recombinant VSV full-length plasmid were consistent with the Angola-GP gene sequence, and there was no mutation site, indicating that the MARV recombinant VSV full-length plasmid was constructed correctly.

[0052] 1.2 Rescue and subculture of recombinant VSV virus

[0053] To rescue the recombinant VSV virus, the recombinant full-length plasmid was co-transfected with four VSV helper plasmids into BSR cells for virus rescue.

[0054] Specifically, BSR cells were cultured with DMEM containing 100 mL / L fetal bovine serum, and the cells were transferred to a six-well cell plate. When the cell density grew to about 80% of the area, calcium phosphate transfection reagent was used for transfection, and the recombinant full-length plasmid p3.1-VSVΔG-eGFP-Angola was co-transfected with 4 VSV auxiliary plasmids p3.1-VSV-N, p3.1-VSV-P, p3.1-VSV-L, and p3.1-VSV-G to co-transfect BSR cells. The specific steps refer to the kit instructions. After transfection, the cells were placed in a 37°C, 50 mL / L CO2 incubator for 18 hours, and a PBS solution containing 100 mL / L DMSO was added to shock the cells for 2.5 minutes. The supernatant was discarded and DMEM containing 50 mL / L fetal bovine serum was added to continue culturing for 24 hours, and then observed under a fluorescence microscope. The successfully constructed recombinant VSV virus was named rVSVΔG-eGFP-AngolaGP, referred to as VSV-MARV / GP (VSV-Angola).

[0055] The results are as follows Figure 3 As shown, about 60 hours after transfection, syncytial lesions of BSR cells accompanied by green fluorescence can be observed under a fluorescence microscope. The rescued recombinant virus was passaged on Vero E6 cells, and rounded lesions of cells accompanied by green fluorescence can be observed under a fluorescence microscope. After five passages on Vero E6 cells, it was found that the recombinant virus could be passaged on the cells and cause cytopathic effects.

[0056] The results showed that the recombinant VSV virus carrying the eGFP tag was successfully rescued and could be successfully passaged on Vero E6 cells. During passage, the virus supernatant was repeatedly frozen and thawed three times and then inoculated into Vero E6 cells. After incubation at 37°C and 50mL / L CO2 for 1 hour, DMEM containing 20mL / L fetal bovine serum was added and cultured for 48 hours. After five passages on Vero E6 cells, the recombinant virus supernatant was collected and frozen and stored in a -80°C refrigerator.

[0057] 1.3 RT-PCR identification of recombinant VSV virus

[0058] In order to identify whether the rescued recombinant VSV virus is correct, the recombinant VSV virus is subjected to reverse transcription polymerase chain reaction (RT-PCR) identification.

[0059] The RNA of the recombinant VSV virus and the 5th generation virus of the parent VSV virus were extracted using a viral RNA extraction kit and used as templates. The primers corresponding to the GP gene were used to perform RT-PCR amplification according to the kit. The parent virus rVSV-eGFP RNA extraction product was set as a negative control group in each group, and the PCR amplification products were identified by agarose gel electrophoresis and sequencing.

[0060] The results showed that the RT-PCR products of the recombinant VSV virus RNA extracts all had specific target bands around 2046 bp (such as Figure 4 The above results show that the MARV GP gene can be amplified from the genome extract of the recombinant virus.

[0061] 1.4 Western-blot identification of recombinant VSV virus

[0062] Furthermore, in order to verify whether the rescued recombinant VSV virus can successfully express the GP protein of MARV, the fifth-generation virus supernatant of the recombinant VSV virus was taken for protein immunoblot (Western-blot, WB) identification.

[0063] The 5th generation virus supernatant of the recombinant VSV virus and the parent VSV virus was taken, SDS-PAGE loading buffer was added to the sample, and then boiled in boiling water for 10 minutes to denature the protein, and then SDS-PAGE electrophoresis was performed. The protein in the gel was transferred to the NC membrane using a transfer instrument, and the NC membrane was blocked with 50g / L skim milk powder solution at room temperature for 2h, and then incubated with mouse anti-MARV-GP polyclonal antibody (diluted with PBST1:1000) at room temperature for 2h, washed with PBST for 3 times, incubated with Goat anti-mouse IgG (H+L) HRP secondary antibody (diluted with PBST1:25000) at room temperature for 1h, washed with PBST for 3 times, and then developed with Tanon automatic fluorescence chemiluminescence image analysis system.

[0064] WB identification results showed that the recombinant virus had specific target bands around 170 kDa (such as Figure 5 The results showed that after VAV-MARV / GP infected Vero E6 cells, MARV GP protein was successfully expressed.

[0065] 1.5 IF identification of recombinant VAV virus

[0066] In order to determine the expression site of MARV GP protein after the recombinant VAV virus infected Vero E6 cells, the recombinant VAV virus was identified by indirect immunofluorescence (IF).

[0067] Vero E6 cells were passaged into 24-well plates, and the recombinant VSV virus and the parent VSV virus were inoculated into Vero E6 cells, respectively, and cultured in an incubator at 37°C and 50 mL / L CO2 for 24 h. The cells were fixed with 4% paraformaldehyde at room temperature for 30 min, washed 5 times with PBST, blocked with 3% BSA solution for 1 h, washed 5 times with PBST, and incubated at 37°C for 2 h with mouse anti-MARV-GP polyclonal antibody (200-fold diluted with 3% BSA solution), washed 5 times with PBST, incubated with cy3-labeled goat anti-mouse IgG (H+L) secondary antibody (1000-fold diluted with 3% BSA solution) at 37°C for 1 h, washed 5 times with PBST, and stained with 4',6-diamidno-2-phenylindole (hereinafter referred to as DAPI) for 10 min for the cell nuclei. After washing 5 times with PBST, the results were observed under a fluorescence microscope.

[0068] The microscopic results showed (such as Figure 6 As shown): After the MARV-GP protein binds to the mouse anti-MARV-GP polyclonal antibody, it is stained orange by the orange light secondary antibody and is located on the cell surface. The DAPI stains the cell nucleus blue and is located in the center of the cell. The IF results show that after the recombinant virus infects Vero E6 cells, the expressed MARV GP protein is mostly located on the cell surface.

[0069] 1.6 Electron microscopic observation of recombinant VAV virus

[0070] In order to explore whether the recombinant MARV GP protein onto the surface of VSV would affect the original morphology of the virus, 100 μL of the fifth-generation virus supernatant of the recombinant VAV virus (VSV-MARV / GP) was negatively stained with phosphotungstic acid and then observed under a transmission electron microscope.

[0071] The results show (such as Figure 7 As shown in the figure, the recombinant VSV virus is basically the same as the parent VSV virus in morphology, both of which are typical bullet-shaped with tiny fibrous protrusions on the surface, indicating that the recombinant MARV GP protein onto the VSV surface will not affect the normal assembly of the virus.

[0072] 1.7 Titer determination and growth kinetics curve drawing of recombinant VAV virus

[0073] In order to explore the growth kinetic characteristics of the recombinant VAV virus, the growth kinetic curves of the recombinant VSV virus (VSV-MARV / GP) and the parent VSV virus (WT-VSV) were compared.

[0074] Determination of recombinant VSV virus titer: Vero E6 cells were passaged into 96-well plates the night before and cultured in a 37°C cell culture incubator for 12 h. 100 μL of the 5th generation recombinant VSV virus supernatant was taken and serially diluted 10-fold with DMEM culture medium until the dilution reached 10 -12 , discard the cell culture medium in the 96-well plate, and add 10 -1 -10 -12 The virus dilutions of different dilutions were inoculated into 96-well plates, with 100 μL of virus dilutions in each well. After being placed in a 37°C cell culture incubator for 1 hour, the virus solution was discarded, 100 μL of DMEM containing 2% serum was added, and the plates were placed in a 37°C, 5% CO2 incubator for 48 hours to observe the results.

[0075] Growth kinetics test: Vero E6 cells were passaged into T75 cell culture flasks. When the cells were fully grown, the 5th generation virus supernatants of the recombinant VSV virus and the parent VSV virus were inoculated into Vero E6 cells at MOI = 0.01, respectively, and placed in a 37°C, 5% CO2 incubator for culture. 200 μL of supernatant was collected at 0, 12, 24, 36, 48, 60, 72, and 84 hours, and the virus titer was determined by the above method after freezing and thawing 3 times. The TCID of the recombinant VSV virus at each time point was calculated using the Reed-Muench method. 50 , draw the growth kinetics curve.

[0076] The results show (such as Figure 8 The recombinant VSV virus reached its highest growth titer at around 72h, which was about 10 7 TCID 50 / mL, while the virulence of the parent VSV virus reached its highest level at around 36h, about 10 8.5 TCID 50 / mL. The results showed that the replacement of VSV glycoprotein by exogenous glycoprotein led to a decrease in the virulence of recombinant VSV virus to a certain extent, and the rate of infection of cells also decreased.

[0077] 1.8 Application of recombinant VSV virus in neutralizing antibody detection

[0078] To evaluate the neutralizing titer of the laboratory-prepared MR191 antibody in cells, recombinant VSV virus was used instead of wild-type MARV virus for virus neutralizing antibody detection. MR191 antibody is a human monoclonal antibody that has been shown to provide 100% protection against Marburg virus infection in nonhuman primates (Mire CE, Geisbert JB, Borisevich V, et al. Therapeutic treatment of Marburg and Ravn virus infection in nonhuman primates with a human monoclonal antibody. Science translational medicine. 2017; 9 (384).).

[0079] The specific steps include:

[0080] (1) Antibody dilution: Antibody MR191 was diluted 10-fold with DMEM maintenance medium and added to the first row of a 96-well cell culture plate. In rows 2-8 of the 96-well cell culture plate, 100 μL of DMEM was added to each well. The serum dilution in the first row was pipetted and mixed 20 times with a dispenser, and 100 μL was pipetted and added to the second row, and the dilution was performed in descending order.

[0081] (2) Add recombinant VSV virus, use VSV-MARV / GP to detect the neutralizing antibody titer against MARV GP, and dilute the recombinant virus to 100 TCID in DMEM. 50 / 100 μL, add 100 μL of the diluted recombinant virus to the 96-well cell culture plate, shake and mix well, and place in a 37°C cell culture incubator for 1 h.

[0082] (3) Prepare cells. During the static process, prepare Vero E6 cell suspension and dilute the cell suspension to 2×10 5 Pieces / mL.

[0083] (4) After adding cells and standing for 1 hour, add the cell suspension to a 96-well cell culture plate, 50 μL per well, and place the 96-well cell culture plate in a 37° C., 5% CO 2 cell culture incubator for culture.

[0084] (5) Reading the results: After 48 hours of incubation, read the neutralization titer under a fluorescence microscope. The highest dilution factor that can neutralize 100% of the recombinant virus is the neutralization titer of the antibody.

[0085] The results showed that the neutralization titer of antibody MR191 measured by VSV-MARV / GP was 1:40, indicating that the recombinant VSV virus can be used to detect the antibody titer in vitro.

[0086] Example 2 Establishment of VSV-MARV / GP infection model

[0087] 2.1 Study on the lethality of VSV-MARV / GP in small rodents

[0088] The present invention replaces the virus VSV-MARV / GP with 10 7 TCID 50 Five-week-old Syrian hamsters, SD rats, BALB / c mice, and Hartley guinea pigs were infected with a dose of 50 mg / kg via the intraperitoneal route. Control animals were injected intraperitoneally with the same volume of PBS, n = 5 per group. All animals were monitored daily for signs of disease, including changes in body weight, physical activity, and food and water intake.

[0089] Observation of the characteristics of Syrian hamsters infected with VSV-MARV / GP and determination of the LD of Syrian hamsters infected with VSV-MARV / GP 50 ; Detect the viral load in various organs, pathological changes in various organs, blood routine and blood biochemical changes after VSV-MARV / GP infected Syrian hamsters; and analyze the susceptibility of hamsters of different genders and ages to the recombinant virus and the impact of different infection routes on the lethality of hamsters.

[0090] The results showed that among the small rodents tested, VSV-MARV / GP caused lethal infection only in Syrian hamsters, while SD rats, BALB / c mice and Hartley guinea pigs survived and gained 10%-30% of their body weight (e.g. Fig. 9 However, the infected Syrian hamsters lost about 10% of their body weight and all died within 2-3 dpi (see Figure 2A,B,C). Fig. 9 In contrast, Syrian hamsters in the control group survived and were euthanized as planned on day 10 post infection.

[0091] 2.2 Characteristics of Syrian hamsters infected with VSV-MARV / GP

[0092] In order to further study the characteristics of VSV-MARV / GP infection in Syrian hamsters, the present invention designed four groups of 5-week-old female Syrian hamsters, infected with different doses of VSV-MARV / GP (10 4.5 TCID 50 , 10 5.5 TCID 50 , 10 6.5 TCID 50 , 10 7.5 TCID 50 ). Among them, 10 7.5TCID 50 The mortality rate of infected hamsters is 100%, 10 5.5 TCID 50 The mortality rate of infected hamsters is 50%. At the same time, the infected hamsters lose a lot of weight. Fig.10 shown.

[0093] Blood biochemical analysis was performed at 36 hpi. Blood was collected from the orbital venous plexus and compared with the blood of the uninfected group. Specifically, significantly increased concentrations of alkaline phosphatase (ALP) and aminotransferase (ALT) and decreased levels of amylase (AMY) were observed, indicating liver damage or pancreas-related diseases. A significant increase in the granulocyte percentage (GRAN%), a moderate increase in the white blood cell (WBC) count, and a significant decrease in the platelet count (PLT) and lymphocyte percentage (LYM%) were also observed, indicating severe viral infection and coagulopathy. Parameters such as blood phosphorus (P), creatinine (CRE), blood urea nitrogen (BUN), total bilirubin (TBIL), and red blood cell count (RBC) showed little change. As Fig.11 shown.

[0094] To further investigate the replication of VSV-MARV / GP in Syrian hamster tissues, the viral load TCID50 of tissues including heart, liver, spleen, lung, kidney, stomach, intestine and brain was collected at 36 hpi. The results showed that VSV-MARV / GP was detectable in all tested tissues, with the highest viral load in the liver (10 8.5 TCID 50 / g), the lowest viral load in the brain (10 3.5 TCID 50 / g). Fig.12 shown.

[0095] In addition, the present invention also performed pathological and histological analysis to examine the pathological changes in the liver, spleen, lungs and kidneys at 36hpi. Specifically, there was necrosis and nuclear fragmentation with hemorrhage in hepatocytes, a large number of macrophage infiltrations with hemorrhage in the red pulp of the spleen, mild thickening of the alveolar wall with diffuse lymphocyte infiltration in a large number of alveoli, and hemorrhage was seen in the kidneys. Antigen positivity was also detected in the liver, spleen, lungs and kidneys, which is consistent with the viral load in tissues and organs. Fig.13 shown.

[0096] 2.3 Comparison of the differences between the sexes of Syrian hamsters infected with VSV-MARV / GP

[0097] In order to determine the effect of gender on the mortality of Syrian hamsters infected with VSV-MARV / GP, the present invention designed three groups of 5-week-old Syrian hamsters (n=10 in each group), including female, male and control. Female and male hamsters were inoculated intraperitoneally for 10 7TCID 50 VSV-MARV / GP was given to the control group, and the same volume of PBS was given to the control group. All animals were monitored daily for signs of illness, including changes in body weight, physical activity, and food and water intake. After 36 hpi, blood samples were collected for complete blood cell count and blood chemistry analysis, and three animals in each group were sacrificed to obtain liver, spleen, lung, and kidney specimens for evaluation of virus distribution and pathology.

[0098] The results are as follows Fig.14 As shown, in the female group, all Syrian hamsters succumbed to the disease within 36-72 hpi with a weight loss of approximately 10%; while in the male group the mortality rate was 60% and some animals recovered from the infection; for the control group, all patients survived and showed a sustained weight gain of 10% to 20%.

[0099] At 36 hpi, blood was collected from the retroorbital venous plexus for hematological examination, which showed that the concentrations / activities of ALP, ALT, WBC, and GRAN were increased, but the concentrations / activities of albumin ALB, PLT, and LYM were decreased in all animals tested. Fig.15 shown.

[0100] At the same time, liver, spleen, lung, and kidney were collected from each group of animals to determine tissue tropism. Overall, the viral load in the female group was higher than that in the male group, with the highest viral load in the liver (e.g. Fig.16 Severe inflammatory cell infiltration, lymphocyte necrosis, and viral antigens (such as Fig.17 shown).

[0101] 2.4 Comparison of differences in Syrian hamsters of different ages after infection with VSV-MARV / GP

[0102] In order to explore the effect of age on the mortality of Syrian hamsters infected with VSV-MARV / GP, female Syrian hamsters aged 5 weeks, 3 months and 1 year (n=8 in each group) were intraperitoneally infected for 10 7 TCID 50 VSV-MARV / GP. All animals were monitored daily for signs of illness, including changes in body weight, physical activity, and food and water intake. After 36 hpi, blood samples were collected for complete blood count and blood biochemistry analysis, and three animals in each group were euthanized to collect liver, spleen, lung, and kidney specimens to evaluate viral distribution and pathological changes.

[0103] The results showed that 5-week-old female Syrian hamsters showed 100% lethality after infection with VSV-MARV / GP, dying within 2-3 days after infection and significantly losing about 10% of their body weight. In contrast, the lethality observed in 3-month-old and 1-year-old hamsters infected with VSV-MARV / GP was variable, at 87.5% and 50%, respectively. All hamsters lost weight (an average of 3% in 10-month-olds and 1% in 1-year-olds). However, some animals regained their original weight by 3dpi (e.g. Fig.18 36 h post infection (hpi), the viral loads in the liver, spleen, lungs, and kidneys were assessed. The 5-week-old hamster group had slightly higher overall viral loads compared to the other two groups, with the highest concentrations observed in the liver (Fig. Fig.18 Therefore, in order to have consistent lethality to hamsters infected with VSV-MARV / GP, the present invention selected 5-week-old female Syrian hamsters.

[0104] 2.5 Comparison of differences in Syrian hamsters infected with VSV-MARV / GP via different infection routes

[0105] In order to evaluate the effect of the challenge route on the lethality of Syrian hamsters infected with VSV-MARV / GP, the present invention designed four groups of 5-week-old Syrian hamsters to be infected with VSV-MARV / GP by intraperitoneal (ip), subcutaneous (sc), intramuscular (im) and intranasal (in) routes. All animals were monitored daily for signs of disease, including changes in body weight, physical activity, and food and water intake. At 36hpi, blood samples were collected through the orbital venous plexus, and complete blood cell counts and blood chemistry analyses were performed. At the same time, viral titers and pathology of internal organs including liver, lungs, spleen and kidneys were examined.

[0106] The results showed that Syrian hamsters infected intraperitoneally died within 36 hours post-infection (hpi) and lost about 10% of their body weight. Hamsters infected intranasally died within 60 hpi and lost about 15% of their body weight. Hamsters infected by the sc and im routes did not die and gradually regained their weight (e.g. Fig.19 Blood biochemical analysis showed that the concentration / activity of ALP, ALT, WBC and GRAN in the infected group increased, while the levels of ALB, PLT and LYM decreased compared with the normal group. The most obvious changes were observed in the ip infection group, followed by the in infection group (as shown in Figure 2A). Fig. 20 In addition, the viral load in the liver, spleen, lungs, and kidneys of each group of hamsters was quantified. Specifically, the viral load in the liver of the ip infection group was the highest, while the viral load in the lungs of the in infection group was the highest (as shown in Fig.21These results show that among the various infection routes tested, both intraperitoneal injection and injection routes can lead to fatal infections. However, compared with the ip route, the incidence of the in route progresses more slowly. Therefore, the present invention selects intraperitoneal infection as the infection route.

[0107] Example 3 Evaluation of MR191 Antibody in Alternative Animal Models

[0108] In order to evaluate the utility of VSV-MARV / GP infected Syrian hamsters in screening anti-MVD drugs in vivo, the present invention evaluated the therapeutic effect of passive immunization of MR191 antibody in this alternative animal model (VSV-MARV / GP infected Syrian hamster model).

[0109] The present invention randomly divided 22 5-week-old female Syrian hamsters into two groups. All hamsters were infected with 1 mL 10 7 TCID 50 VSV-MARV / GP. At 6 h post-infection, Syrian hamsters in the treatment group were treated intraperitoneally with MR191 antibody (25 mg / kg). Similarly, all Syrian hamsters in the control group were given an equal volume of PBS. All animals were monitored daily for signs of disease, including changes in body weight, physical activity, and food and water intake. At 36 h and 5 dpi, three Syrian hamsters were randomly selected from each group, and blood samples were collected through the orbital venous plexus to determine blood changes. Subsequently, euthanasia was performed, and the liver, spleen, lungs, and kidneys were collected to determine viral load, immunohistochemistry, and pathological changes.

[0110] The results showed that all hamsters in the control group died within 1.5-3 days after infection and lost 10% of their body weight. In contrast, all hamsters in the treatment group survived and began to regain weight at 1.5 days after infection, eventually exceeding 30% of their original body weight after 15 days of monitoring (e.g. Fig. 22 Compared with the control group, viral antigens in the liver, spleen, lungs and kidneys of all hamsters in the treatment group gradually decreased with the increase of treatment duration (as shown in Fig.23 As the duration of treatment increased, the blood markers of all hamsters in the treatment group gradually approached normal values ​​(such as Fig.24 In the control group, the liver, spleen, lungs, and kidneys showed obvious inflammatory cell infiltration, cell necrosis, and viral antigens (very similar to human Marburg virus disease, such as Fig.29 In contrast, the lesions in the treatment group were significantly reduced, and viral antigens were gradually cleared as the duration of treatment increased (as shown in Figure 2A). Fig.25 and Fig.26 ). Meanwhile, pathological and immunohistochemical scores supported these findings (as shown in Fig. 27 and Fig.28These results suggest that the Syrian hamster model of VSV-MARV / GP infection is an effective tool for antibody assessment.

[0111] The above-described embodiments are only specific implementation methods of the present application, which are used to illustrate the technical solutions of the present application, rather than to limit them. The protection scope of the present application is not limited thereto. Although the present application is described in detail with reference to the aforementioned embodiments, ordinary technicians in the field should understand that any technician familiar with the technical field can still modify the technical solutions recorded in the aforementioned embodiments within the technical scope disclosed in the present application, or can easily think of changes, or make equivalent replacements for some of the technical specialties therein; and these modifications, changes or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application. They should all be included in the protection scope of the present application. Therefore, the protection scope of the present application should be based on the protection scope of the claims.

Claims

1. A method for establishing a surrogate virus infection model that can be used to simulate symptoms of human Marburg virus disease under BSL-2, characterized in that: The replacement virus is a recombinant VSV virus, which is a recombinant vesicular stomatitis virus in which the G gene of VSV is replaced with the glycoprotein GP gene of Marburg virus (MARV), referred to as VSV-MARV / GP; the infected animal of the infection model is a 5-week-old female Syrian hamster, and the infection dose is 10 7 TCID 50 , the route of infection is intraperitoneal infection.

2. The method for establishing a surrogate virus infection model that can be used to simulate symptoms of human Marburg virus disease under BSL-2 as claimed in claim 1, characterized in that: The construction method of the VSV recombinant virus is as follows: the G gene in the VSV infectious clone full-length plasmid carrying the eGFP tag is replaced with the GP gene of MARV to obtain the MARV recombinant VSV full-length plasmid; the MARV recombinant VSV full-length plasmid is co-transfected with 4 VSV helper plasmids into BSR cells to rescue the MARV GPVSV carrying the eGFP tag, i.e., VSV-MARV / GP.

3. The method for establishing a surrogate virus infection model that can be used to simulate human Marburg virus disease symptoms under BSL-2 as claimed in claim 1, characterized in that: The Marburg virus is selected from the Angola strain.

4. A surrogate virus infection model that can be used to simulate symptoms of human Marburg virus disease under BSL-2, characterized in that: The method is established by any one of claims 1 to 3.

5. Use of the alternative virus infection model that can be used to simulate human Marburg virus disease symptoms under BSL-2 as claimed in claim 4 as an animal model for evaluating the effects of MARV antibodies or MARV vaccines.

6. The use according to claim 4, characterized in that The application environment is a biosafety level 2 laboratory.

Images