Method for improving production intensity of long-carbon-chain dicarboxylic acid

Abstract

The invention belongs to the technical field of fermentation engineering, and particularly relates to a method for improving the production intensity of long-carbon-chain dibasic acid, which comprises the following steps: carrying out fermentation culture on a strain for producing long-carbon-chain dibasic acid to obtain a fermentation product; supplementing a fermentation culture medium and an L-carnitine fumarate-long carbon chain alkane solution into the fermentation product, and continuing fermentation culture to obtain long carbon chain binary acid; the L-carnitine fumarate-long-carbon-chain alkane solution is composed of long-carbon-chain alkane and L-carnitine fumarate, and the long-carbon-chain alkane is any one or more of dodecane alkane, tridecane alkane or hexadecane alkane. According to the method, the fermentation strain for producing the long carbon chain dibasic acid is adopted, after fermentation culture, the long carbon chain alkane containing 20 [mu] mol / L-carnitine fumarate is supplemented into the obtained fermentation product, the conversion rate of the long carbon chain alkane is increased by 23.0% or above, the fermentation yield of the long carbon chain dibasic acid is increased by 46.5% or above, and the yield of the long carbon chain dibasic acid is increased by integrating the two. And the production intensity of the long-carbon-chain dicarboxylic acid is improved by 46.6% or above.

Description

Technical Field

[0001] The invention belongs to the technical field of fermentation engineering, and in particular relates to a method for improving the production intensity of long carbon chain dibasic acids. Background Art

[0002] Long-chain dicarboxylic acids refer to dicarboxylic acids with 8 to 20 carbon atoms in the carbon chain, including saturated and unsaturated dicarboxylic acids. They are widely used industrial raw materials and can be used in the fields of high-end engineering plastics, fragrances, coating synthesis, and biopharmaceutical production. Long-chain dicarboxylic acids have two carboxyl groups and typical properties of carboxylic acids. They can be condensed with hydroxyl groups to form esters under the action of enzymes or other chemical substances. They are widely used in industry and can be used as raw materials for polyesters and polyamides. They play an important role in the synthesis and manufacture of high-end engineering plastics, long-chain nylon products, and synthetic fibers. They can also be used as lubricants, waxes, and ingredients in cosmetics. They also have important uses in the preparation of dyes, resins, and rubbers. Since long-chain dicarboxylic acids are synthetic raw materials for a variety of substances, the current social demand for long-chain dicarboxylic acids is increasing. How to improve their production efficiency and reduce their production costs is an urgent problem to be solved in the industry.

[0003] There are three main methods for producing long-chain dibasic acids: catalytic oil method, chemical synthesis method and microbial fermentation method. The catalytic oil method mainly uses plant oils to produce acid, but there are few acid types, and plant oils are limited by climate and other conditions, so they are not universal; the chemical synthesis method has a complex process and causes great environmental pollution. At present, the production of long-chain dibasic acids is gradually shifting from chemical synthesis to preparation through microbial fermentation. Microbial fermentation has more advantages than chemical synthesis, such as high conversion rate of raw materials, low pollution and low cost.

[0004] At present, the production of long-chain dibasic acids by microbial fermentation has become a hot topic of research at home and abroad as an alternative green and environmentally friendly method. To obtain high-yield long-chain dibasic acids through microbial fermentation, the regulation of strains and their metabolic pathways is the key. The production of long-chain dibasic acids is closely related to the effective entry of long-chain alkanes into mitochondria for metabolic transformation. In order to improve the conversion efficiency of long-chain alkanes, it is necessary to increase the entry of long-chain alkanes into mitochondria as much as possible during the production process for conversion to dicarboxylic acids. This process is the alkane conversion rate, which is one of the key factors determining the fermentation production efficiency of long-chain dibasic acids; at the same time, it is also necessary to minimize the β-oxidation decomposition of the converted long-chain dibasic acids by yeast cells, thereby ultimately improving the conversion rate of long-chain alkanes in dibasic acid fermentation production and the output and yield of long-chain dibasic acids.

[0005] Choosing which metabolic regulation intervention strategy to improve the production intensity of long-chain dibasic acids is a scientific and technical problem that technicians in this field urgently need to solve. Summary of the invention

[0006] In order to solve the defect of low production intensity of long carbon chain dibasic acid in the existing long carbon chain dibasic acid production method, the present invention provides a fermentation method for improving the production intensity of long carbon chain dibasic acid.

[0007] The specific scheme is as follows: The present invention provides a method for improving the production intensity of long-chain dibasic acids, comprising the following steps: fermenting and culturing a strain that produces long-chain dibasic acids to obtain a fermentation product; adding fermentation medium and L-carnitine fumarate-long-chain alkane solution to the fermentation product, continuing fermentation and culturing to obtain long-chain dibasic acids; the L-carnitine fumarate-long-chain alkane solution is composed of long-chain alkanes and L-carnitine fumarate, and the long-chain alkane is any one or more of dodecane, tridecane or hexadecane.

[0008] Preferably, in the L-carnitine fumarate-long carbon chain alkane solution, the concentration of L-carnitine fumarate is 20 μmol / L 。

[0009] Preferably, the added amount of the fermentation medium is 2% of the volume of the fermentation product.

[0010] Preferably, the amount of the L-carnitine fumarate-long carbon chain alkane solution added is 2% of the total volume of the fermentation medium and the fermentation product.

[0011] Preferably, the fermentation culture conditions are: 30°C, 300rpm.

[0012] Preferably, the preparation of the fermentation product comprises the following steps: inoculating a strain producing a long-chain dibasic acid into a seed culture medium, activating the culture, and preparing a seed solution; inoculating the seed solution into a fermentation culture medium for fermentation culture to obtain a fermentation product.

[0013] Preferably, per liter of the fermentation medium contains 120 g of glucose, 2 g of yeast extract, 2 g of corn steep liquor, 3.86 g of urea, 0.8 g of MgSO47H20, 2 g of KH2PO4, 3 g of CH3OONa, 10 mL of trace element solution, 10 mL of vitamin solution, and the solvent is water; per liter of the trace element solution contains 12 g of MnCl2·4H2O; 2 g of FeSO4·7H2O; 2 g of CaCl2·2H2O; 0.05 g of CuSO4·5H2O; and 0.5 g of ZnCl2, and the solvent is water; per liter of the vitamin solution contains 0.004 g of biotin, 0.75 mg of thiamine, 0.04 g of pyridoxine, and 0.8 g of nicotinic acid, and the solvent is water.

[0014] Preferably, the seed culture medium contains 5 g of yeast extract, 3 g of corn steep liquor, 20 g of sucrose, 3 g of urea, and 8 g of KH2PO4 per liter, and the solvent is water.

[0015] Preferably, when preparing the seed solution, the activation culture conditions are: 30° C., 350 rpm, and culture for 24 hours.

[0016] Compared with the prior art, the present invention has the following beneficial effects: the present invention provides a method for improving the production intensity of long-chain dibasic acids, comprising the following steps: fermenting and culturing a strain producing long-chain dibasic acids to obtain a fermentation product; adding a fermentation medium and an L-carnitine fumarate-long-chain alkane solution to the fermentation product, continuing the fermentation and culturing, and obtaining the long-chain dibasic acids; the L-carnitine fumarate-long-chain alkane solution is composed of a long-chain alkane and L-carnitine fumarate, and the long-chain alkane is any one or more of dodecane, tridecane or hexadecane.

[0017] The present invention adopts a fermentation strain for producing long-chain dicarboxylic acid, and after fermentation and cultivation, a long-chain alkane containing 20 μmol / L L-carnitine fumarate is added to the obtained fermentation product, which can enhance the efficiency of long-chain alkane entering mitochondria and enhance the production intensity of long-chain dicarboxylic acid, and the improvement of production intensity mainly includes two aspects: the increase of yield and the increase of conversion rate. Through the method of the present invention, the conversion rate of long-chain alkane is increased by more than 23.0%, and the fermentation yield of long-chain dicarboxylic acid is increased by more than 46.5%. Combining the above two, the production intensity of long-chain dicarboxylic acid is increased by more than 46.6%. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Schematic diagram of the structure of L-carnitine fumarate. DETAILED DESCRIPTION

[0019] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments, but they should not be construed as limitations of the present invention.

[0020] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0021] Unless otherwise specified or there is a contradiction, the terms or phrases used in this invention have the following meanings:

[0022] The optional scope of the terms "and / or", "or / and", and "and / or" used in this article includes any one of two or more related listed items, and also includes any and all combinations of the related listed items, said any and all combinations include any combination of any two related listed items, any more related listed items, or all related listed items.

[0023] In the present invention, "one or several" refers to any one, any two or any two or more of the listed items. Among them, "several" refers to any two or any two or more.

[0024] The “combinations thereof”, “any combinations thereof”, “any combination thereof” etc. used in the present invention include all suitable combinations of any two or more of the listed items.

[0025] In the present invention, the “suitable” mentioned in “suitable combination”, “suitable method”, “any suitable method”, etc. shall be based on the ability to implement the technical solution of the present invention, solve the technical problem of the present invention, and achieve the expected technical effect of the present invention.

[0026] In the present invention, “preferred” is only used to describe an implementation method or example with better effects, and it should be understood that it does not constitute a limitation on the protection scope of the present invention.

[0027] In the present invention, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0028] In the present invention, reference to a numerical range includes both endpoints of the numerical range unless otherwise specified.

[0029] The percentage content involved in the present invention, unless otherwise specified, refers to mass percentage for solid-liquid mixing and solid-solid mixing, and refers to volume percentage for liquid-liquid mixing.

[0030] The percentage concentrations involved in the present invention, unless otherwise specified, refer to the final concentration. The final concentration refers to the proportion of the added component in the system after the addition of the component.

[0031] The temperature parameters in the present invention, if not specifically limited, allow for both constant temperature treatment and treatment within a certain temperature range. The constant temperature treatment allows the temperature to fluctuate within the precision range controlled by the instrument.

[0032] The experimental methods without specific conditions and the reagents without formulas in the present invention are based on conventional conditions, such as the conditions described in Medical Biochemistry and Molecular Biology Experimental Course, 2011 edition, Higher Education Press.

[0033] The strain used in the present invention is a recombinant bacterium that can produce long-chain dibasic acids. The recombinant bacterium is obtained by transferring a recombinant plasmid into the mutant strain PF-UV-56 of Candida tropicalis, and the deposit number of PF-UV-56 is CGMCC NO.0356. The recombinant plasmid carries the Inh1 gene, the vector is pGAPZαA, and the sequence of Inh1 is shown in SEQ ID NO.1. The construction method of the recombinant bacterium has been disclosed in the document with application number 202410400413.2 and patent name "A recombinant bacterium with improved production intensity of long-chain dibasic acids and its application". Referring to the above patent, the name of the recombinant bacterium in this application still uses the name in the above patent, and the recombinant bacterium is 0356-pGAPZαA / Inh1.

[0034] SEQ ID NO.1:

[0035] ATGTTACCACGTTCAGCATTAGCACGCTCATTGCAATTACAGCGCGGTGTGGCCGCAAGGTTCTACTCTGAAGGTTCTACCGGCACCCCAAGAGGGTCAGGCTCAGAGGATTCGTTTGTTAAAAGGGAA AGGGCCACGGAAGACTTCTTCGTTAGGCAGCGTGAGAAGGAGCAACTACGCCATTTGAAAGAACAACTGGAAAAACAACGAAAGAAGATTGATTCTTTGGAAAATAAAAATTGACTCGATGACCAAATAA.

[0036] Determination of bacterial growth: 100 μL of sample was collected under aseptic conditions in a clean bench every day, added to 900 μL of sterile water, mixed thoroughly, and the OD value was measured at 570 nm using a UV7500 visible light spectrophotometer to draw a growth curve.

[0037] Determination of dry weight of bacteria: Take a certain amount of bacterial suspension in a 10mL volumetric flask, add 2mL, 2mol / L hydrochloric acid to dissolve the calcium carbonate in the suspension, add deionized water to make up to 10mL, mix thoroughly, use UV7500 visible light spectrophotometer to measure the OD value at 660nm, and calculate the cell dry weight using the cell dry weight standard curve.

[0038] Analysis of long carbon chain alkane concentration: using n-tetradecane nC14 as an internal standard, the ratio of n-dodecane nC12, n-tridecane nC13 and n-hexadecane nC16 is between 0.5 and 2, and the ratio of the peak areas of nC12, nC13, nC16 and nC14 is measured by gas chromatography, and the volume percentage content X of nC12, nC13 and nC16 in the sample is calculated according to the amount of nC14 added. The calculation formula is as follows:

[0039]

[0040] Where: X—volume percentage of long carbon chain alkane, %.

[0041] F—relative correction factor, measured using standard samples, is 1.005.

[0042] Ai—peak area of ​​long-chain alkanes; As—nC14 peak area; Vs—nC14 added volume, mL; V—sampling volume, mL.

[0043] The long carbon chain alkanes are nC12, nC13 or nC16.

[0044] The specific operation is as follows: the pH value of the fermentation liquid is adjusted to 8.0, 10 mL of the fermentation liquid is accurately transferred into a separatory funnel, 50 mL of ether is added, and after shaking and standing for stratification, 10 mL of the extract is placed in a ground-mouth test tube, 0.2 mL of nC14 is added as an internal standard, and mixed evenly. The sample is analyzed by gas chromatography, and then the volume content of nC12, nC13, and nC16 is calculated respectively by the above formula.

[0045] Gas chromatography conditions: n-hexane as solvent, 100% methyl polysiloxane SE30 filling column, column temperature 150°C, injection temperature 200°C.

[0046] Determination of long-chain dibasic acids: Accurately pipette 5 mL of fermentation broth, add 0.5 mL of 4 mol / L NaOH solution, boil in water for 5 min, mix well, cool with tap water and place in a centrifuge tube, centrifuge at 4000 rpm for 10 min, pipette 4 mL of the middle aqueous phase into a 50 mL conical flask, drop 3 mol / L sulfuric acid solution until the pH is acidic, generally 2, so that the dibasic acid is completely crystallized. Filter, and wash the conical flask and filter cake with deionized water until the filtrate and filter paper are neutral. Transfer the filter cake and filter paper into a 150 mL conical flask, add 30 mL of 95% ethanol as solvent, heat to completely dissolve the dibasic acid, add 3 drops of bromothymol blue as an indicator, and titrate to the end point with NaOH standard solution.

[0047] The formula for calculating the concentration of long carbon chain dibasic acid is:

[0048] Wherein, H is the concentration of DCA12, DCA13 or DCA14, g / L.

[0049] I——equivalent concentration used for titration mol / L.

[0050] J——The volume of NaOH used for titration, mL.

[0051] K——sampling volume mL.

[0052] Note: The determination methods of dibasic acid production mentioned in this method are all to measure the dibasic acid content of the whole fermentation broth. DCA is the abbreviation of long carbon chain dibasic acid.

[0053] The conversion rate of long-chain alkanes = the amount of long-chain alkanes residual hydrocarbons / the amount of long-chain alkanes added × 100%.

[0054] Medium Preparation:

[0055] Per liter of LB liquid medium: 10 g yeast extract, 5 g peptone, 10 g NaCl, dilute to 1 L with water, and sterilize at 115°C for 15 min.

[0056] LB solid medium: Add agar powder equivalent to 2% of the mass fraction of LB liquid medium to the LB liquid medium and sterilize at 115℃ for 15min.

[0057] Per liter of YPD liquid medium: 10 g yeast extract, 20 g peptone, 20 g glucose, dilute to 1 L with water, and sterilize at 115°C for 15 min.

[0058] YPD solid medium: Add agar powder equivalent to 2% of the mass fraction of YPD liquid medium to the YPD liquid medium and sterilize at 115℃ for 15 minutes.

[0059] YPD plate medium: Zeocin was added to YPD solid medium to make the final concentration of Zeocin 100 μg / mL.

[0060] Per liter of seed culture medium: 5 g yeast extract, 3 g corn syrup, 20 g sucrose, 3 g urea, 8 g KH2PO4, water as solvent, sterilized at 115°C for 15 min, after the culture medium is cooled, add filtered sterile Zeocin, the final concentration is 50 μg / mL.

[0061] Per liter fermentation medium: glucose 120g, yeast extract 2g, corn steep liquor 2g, urea 3.86g, MgSO47H2O 0.8g, KH2PO42g, CH3OONa 3g, 10mL of trace element solution after filtration and sterilization, 10mL of vitamin solution after filtration and sterilization, water to 1L, sterilized at 115℃ for 15min. 40g / L NaOH was added to adjust pH to 6.0, and NaOH was sterilized alone.

[0062] The formula of trace element liquid per liter is: MnCl2·4H2O, 12g; FeSO4·7H2O, 2g; CaCl2·2H2O, 2g; CuSO4·5H2O, 0.05g; ZnCl2, 0.5g, dissolved with 2mol / L HCl and made up to 1L.

[0063] The formula of vitamin solution per liter: biotin 0.004g, thiamine 0.75mg, pyridoxine 0.04g, niacin 0.8g, dissolved in 2mol / L HCl and made up to 1L.

[0064] L-carnitine fumarate-dodecane solution, L-carnitine fumarate-tridecane solution or L-carnitine fumarate-hexadecane solution: dodecane, tridecane or hexadecane is sterilized at 115°C for 15 min, L-carnitine fumarate is filtered and sterilized, and then prepared into a 1 mol / L mother solution, which is added to the above-mentioned high-pressure sterilized dodecane, tridecane or hexadecane to make the final concentration of L-carnitine fumarate 20 μmol / L.

[0065] The inventive concept of the present invention is as follows: long-chain alkanes need to enter the mitochondria for conversion into long-chain dibasic acids, and entering the mitochondria requires the assistance of carnitine acyltransferases I and II. The activity of carnitine acyltransferases I and II is the key to the efficiency of long-chain alkanes entering the mitochondria. Fumarate is a small molecule that can promote the mitochondrial tricarboxylic acid cycle, and its molecular structure plays an important role in maintaining and enhancing the metabolic function of mitochondria; and carnitine is conducive to the entry of long-chain alkanes into the mitochondria. Therefore, the addition of L-carnitine fumarate to the fermentation broth will significantly improve the efficiency of long-chain alkanes entering the mitochondria for conversion. The structural formula of L-carnitine fumarate is as follows: Figure 1As shown; at the same time, combined with the engineered strain 0356-pGAPZαA / Inh1, the activity of mitochondrial ATP synthase was inhibited by overexpression of 0356-pGAPZαA / Inh1. Mitochondrial ATP synthase is also called: mitochondrial respiratory chain complex V, which is blocked at the end of the electron transport chain of the mitochondrial respiratory chain and diverts the metabolic flow to glycolysis, thereby enhancing the conversion and generation of long-chain dibasic acids and reducing their tendency to be β-oxidized and enter the tricarboxylic acid cycle, ultimately significantly improving the conversion rate of long-chain alkanes and the output and yield of long-chain dibasic acids.

[0066] The molecular formula of the long carbon chain dibasic acid is: HOOC-(CH2)n-COOH, where n is 8 to 20. In the present invention, the long carbon chain dibasic acid includes a twelve carbon long carbon chain dibasic acid, a thirty carbon long carbon chain dibasic acid and a hexa carbon long carbon chain dibasic acid.

[0067] The present invention is further described in detail below with reference to the examples, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art; the experimental methods used are all conventional methods.

[0068] Example 1

[0069] A method for improving the production intensity of long carbon chain dibasic acids, as described below:

[0070] S1: Fermenting and culturing a strain producing a long-chain dibasic acid to obtain a fermentation product, the method is as follows:

[0071] A single colony of the long-chain dicarboxylic acid producing strain 0356-pGAPZαA / Inh1 was picked from a YPD plate containing Zeocin and placed on a seed culture medium, and activated and cultured at 30°C and 350 rpm for 24 hours to prepare a seed solution.

[0072] The seed liquid was inoculated into the fermentation medium at an inoculation rate of 20%, and the fermentation culture was carried out at 30° C. and 300 rpm. After fermentation for 48 hours, a fermentation product was obtained.

[0073] S2: adding fermentation medium and L-carnitine fumarate-dodecane solution to the fermentation product, continuing fermentation culture, and obtaining a long carbon chain dibasic acid, the method is as follows:

[0074] According to the volume of the fermentation product, fresh fermentation medium is added every day, and the amount of fresh fermentation medium added is 2% of the volume of the fermentation product, and it is added continuously for 4 days; at the same time, a dodecane solution containing 20 μmol / L of L-carnitine fumarate is added every day, and the amount of dodecane solution added is 2% of the total volume of the fresh fermentation medium and the fermentation product, and it is added continuously for 96 hours, that is, 4 days, and the total culture is 144 hours to obtain a fermentation product containing a dodecane long-chain dibasic acid.

[0075] Example 2

[0076] A method for improving the production intensity of long carbon chain dibasic acids, as described below:

[0077] S1: Fermenting and culturing a strain producing a long-chain dibasic acid to obtain a fermentation product, the method is as follows:

[0078] A single colony of the long-chain dicarboxylic acid producing strain 0356-pGAPZαA / Inh1 was picked from a YPD plate containing Zeocin and placed on a seed culture medium, and activated and cultured at 30°C and 350 rpm for 24 hours to prepare a seed solution.

[0079] The seed liquid was inoculated into the fermentation medium at an inoculation rate of 20%, and the fermentation culture was carried out at 30° C. and 300 rpm. After fermentation for 48 hours, a fermentation product was obtained.

[0080] S2: adding fermentation medium and L-carnitine fumarate-tridecanane solution to the fermentation product, continuing fermentation culture, and obtaining a long carbon chain dibasic acid, the method is as follows:

[0081] According to the volume of the fermentation product, fresh fermentation medium was added every day, the amount of fresh fermentation medium added was 2% of the volume of the fermentation product, and the addition was continued for 4 days; at the same time, a tridecane solution containing 20 μmol / L of L-carnitine fumarate was added every day, the amount of tridecane solution added was 2% of the total volume of the fresh fermentation medium and the fermentation product, and the addition was continued for 96 hours, i.e. 4 days, and the total culture was 144 hours to obtain a fermentation product containing a tridecane long-chain diacid.

[0082] Example 3

[0083] A method for improving the production intensity of long carbon chain dibasic acids, as described below:

[0084] S1: Fermenting and culturing a strain producing a long-chain dibasic acid to obtain a fermentation product, the method is as follows:

[0085] A single colony of the long-chain dicarboxylic acid producing strain 0356-pGAPZαA / Inh1 was picked from a YPD plate containing Zeocin and placed on a seed culture medium, and activated and cultured at 30°C and 350 rpm for 24 hours to prepare a seed solution.

[0086] The seed liquid was inoculated into the fermentation medium at an inoculation rate of 20%, and the fermentation culture was carried out at 30° C. and 300 rpm. After fermentation for 48 hours, a fermentation product was obtained.

[0087] S2: adding fermentation medium and L-carnitine fumarate-hexadecane solution to the fermentation product, continuing fermentation culture, and obtaining a long-chain dibasic acid, the method is as follows:

[0088] According to the volume of the fermentation product, fresh fermentation medium is added every day, and the amount of fresh fermentation medium added is 2% of the volume of the fermentation product, and it is added continuously for 4 days; at the same time, a hexadecane solution containing 20 μmol / L of L-carnitine fumarate is added every day, and the amount of hexadecane solution added is 2% of the total volume of the fresh fermentation medium and the fermentation product, and it is added continuously for 96 hours, that is, 4 days, and the total culture is 144 hours to obtain a fermentation product containing a hexadecane long-chain diacid.

[0089] In order to demonstrate the effect of the present invention, the inventors prepared Comparative Examples 1 to 3.

[0090] Comparative Example 1

[0091] A fermentation method for producing long carbon chain dibasic acids, i.e. conventional fermentation, is specifically described as follows:

[0092] S1: Fermenting and culturing a strain producing a long-chain dibasic acid to obtain a fermentation product, the method is as follows:

[0093] A single colony of the long-chain dicarboxylic acid producing strain 0356-pGAPZαA / Inh1 was picked from a YPD plate containing Zeocin and placed on a seed culture medium, and activated and cultured at 30°C and 350 rpm for 24 hours to prepare a seed solution.

[0094] The seed liquid was inoculated into the fermentation medium at an inoculation rate of 20%, and the fermentation culture was carried out at 30° C. and 300 rpm. After fermentation for 48 hours, a fermentation product was obtained.

[0095] S2: adding fermentation medium and dodecane to the fermentation product, continuing fermentation and culturing, and obtaining a long-chain dibasic acid, the method is as follows:

[0096] According to the volume of the fermentation product, fresh fermentation medium was added every day, and the amount of fresh fermentation medium added was 2% of the volume of the fermentation product, and the addition was continued for 4 days; at the same time, dodecane was added every day, and the amount of dodecane added was 2% of the total volume of the fresh fermentation medium and the fermentation product. The addition was continued for 96 hours, i.e., 4 days, and the total culture was 144 hours to obtain a fermentation product containing a dodecyl long-chain dibasic acid.

[0097] Comparative Example 2

[0098] A fermentation method for producing long carbon chain dibasic acids, i.e. conventional fermentation, is specifically described as follows:

[0099] S1: Fermenting and culturing a strain producing a long-chain dibasic acid to obtain a fermentation product, the method is as follows:

[0100] A single colony of the long-chain dicarboxylic acid producing strain 0356-pGAPZαA / Inh1 was picked from a YPD plate containing Zeocin and placed on a seed culture medium, and activated and cultured at 30°C and 350 rpm for 24 hours to prepare a seed solution.

[0101] The seed liquid was inoculated into the fermentation medium at an inoculation rate of 20%, and the fermentation culture was carried out at 30° C. and 300 rpm. After fermentation for 48 hours, a fermentation product was obtained.

[0102] S2: adding fermentation medium and tridecane to the fermentation product, continuing fermentation and culturing, and obtaining a long-chain dibasic acid, the method is as follows:

[0103] According to the volume of the fermentation product, fresh fermentation medium was added every day, and the amount of fresh fermentation medium added was 2% of the volume of the fermentation product, and the addition was continued for 4 days; at the same time, tridecane was added every day, and the amount of tridecane added was 2% of the total volume of the fresh fermentation medium and the fermentation product. The addition was continued for 96 hours, i.e., 4 days, and the total culture was 144 hours to obtain a fermentation product containing tridecane long-chain dibasic acid.

[0104] Comparative Example 3

[0105] A fermentation method for producing long carbon chain dibasic acids, i.e. conventional fermentation, is specifically described as follows:

[0106] S1: Fermenting and culturing a strain producing a long-chain dibasic acid to obtain a fermentation product, the method is as follows:

[0107] A single colony of the long-chain dicarboxylic acid producing strain 0356-pGAPZαA / Inh1 was picked from a YPD plate containing Zeocin and placed on a seed culture medium, and activated and cultured at 30°C and 350 rpm for 24 hours to prepare a seed solution.

[0108] The seed liquid was inoculated into the fermentation medium at an inoculation rate of 20%, and the fermentation culture was carried out at 30° C. and 300 rpm. After fermentation for 48 hours, a fermentation product was obtained.

[0109] S2: adding fermentation medium and hexadecane to the fermentation product, continuing fermentation and culturing, and obtaining a long-chain dibasic acid, the method is as follows:

[0110] According to the volume of the fermentation product, fresh fermentation medium was added every day, and the amount of fresh fermentation medium added was 2% of the volume of the fermentation product, and the addition was continued for 4 days; at the same time, hexadecane was added every day, and the amount of hexadecane added was 2% of the total volume of the fresh fermentation medium and the fermentation product. The addition was continued for 96 hours, that is, 4 days, and the total culture was 144 hours to obtain a fermentation product containing a hexadecane long-chain dibasic acid.

[0111] After the fermentation is completed, the conversion rate of long-chain alkanes in the fermentation products obtained in Examples 1 to 3 and Comparative Examples 1 to 3 and the yields of long-chain dibasic acids of dodecane, tridecane or hexadecane were determined.

[0112] The fermentation results of Example 1 and Comparative Example 1 are shown in Table 1. After supplementation with L-carnitine fumarate, the conversion rate of long-chain alkanes and the yield of dodecacarbon long-chain dibasic acids were increased by 19.3% and 28.1% respectively compared with those under conventional fermentation conditions.

[0113] The fermentation results of Example 2 and Comparative Example 2 are shown in Table 2. After supplementation with L-carnitine fumarate, the conversion rate of long-chain alkanes and the yield of 13-carbon long-chain dibasic acids were increased by 18.4% and 16.3% respectively compared with those under conventional fermentation conditions.

[0114] The fermentation results of Example 3 and Comparative Example 3 are shown in Table 3. After supplementation with L-carnitine fumarate, the conversion rate of long-chain alkanes and the yield of 16-carbon long-chain dibasic acid increased by 23.0% and 46.5% respectively compared with those under conventional fermentation conditions.

[0115] Table 1 Comparison of fermentation of 12-carbon long-chain dibasic acid with control bacteria and L-carnitine fumarate supplementation

[0116]

[0117] Table 2 Comparison of fermentation of 13-carbon long-chain dibasic acid with control bacteria and L-carnitine fumarate supplementation

[0118]

[0119] Table 3 Comparison of sixteen carbon long chain dibasic acid fermentation with control bacteria and L-carnitine fumarate supplementation

[0120]

[0121] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0122] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0123] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A method for improving the production intensity of long carbon chain dibasic acids, characterized in that: The following steps are involved: Fermenting and culturing a strain producing a long-chain dibasic acid to obtain a fermentation product; Adding fermentation medium and L-carnitine fumarate-long carbon chain alkane solution to the fermentation product, continuing fermentation culture, and obtaining long carbon chain dibasic acid; The L-carnitine fumarate-long carbon chain alkane solution consists of long carbon chain alkane and L-carnitine fumarate, and the long carbon chain alkane is any one or more of dodecane, tridecane or hexadecane.

2. The method according to claim 1, characterized in that In the L-carnitine fumarate-long carbon chain alkane solution, the concentration of L-carnitine fumarate is 20 μmol / L 。 3. The method according to claim 1, characterized in that The added amount of the fermentation medium is 2% of the volume of the fermentation product.

4. The method according to claim 1, characterized in that The added amount of the L-carnitine fumarate-long carbon chain alkane solution is 2% of the total volume of the added fermentation medium and fermentation product.

5. The method according to claim 1, characterized in that The fermentation culture conditions are: 30°C, 300rpm.

6. The method according to claim 1, characterized in that The preparation of the fermentation product comprises the following steps: Inoculating a strain producing a long carbon chain dibasic acid into a seed culture medium, activating the culture, and preparing a seed solution; The seed liquid is inoculated into a fermentation medium for fermentation culture to obtain a fermentation product.

7. The method according to claim 1 or 6, characterized in that Each liter of the fermentation medium contains 120 g of glucose, 2 g of yeast extract, 2 g of corn steep liquor, 3.86 g of urea, 0.8 g of MgSO47H20, 2 g of KH2PO4, 3 g of CH3OONa, 10 mL of trace element solution, 10 mL of vitamin solution, and the solvent is water; Each liter of the trace element liquid contains 12 g of MnCl2·4H2O, 2 g of FeSO4·7H2O, 2 g of CaCl2·2H2O, 0.05 g of CuSO4·5H2O, and 0.5 g of ZnCl2, and the solvent is water; Each liter of the vitamin solution contains 0.004 g of biotin, 0.75 mg of thiamine, 0.04 g of pyridoxine, and 0.8 g of nicotinic acid, and the solvent is water.

8. The method according to claim 6, characterized in that Each liter of the seed culture medium contains 5g of yeast extract, 3g of corn steep liquor, 20g of sucrose, 3g of urea, 8g of KH2PO4, and the solvent is water.

9. The method according to claim 6, characterized in that When preparing the seed solution, the activation culture conditions are: 30° C., 350 rpm, and culture for 24 hours.

Images