Mycoplasma pneumoniae nucleic acid extraction reagent, detection kit and application

Abstract

The invention discloses a mycoplasma pneumoniae nucleic acid extraction reagent, a detection kit and application, the mycoplasma pneumoniae nucleic acid extraction and detection reagent utilizes soybean saponin which is a mild detergent, the splitting efficiency of mycoplasma pneumoniae is greatly improved, the mycoplasma pneumoniae nucleic acid DNA is rapidly and efficiently extracted, and the mycoplasma pneumoniae nucleic acid extraction and detection reagent has the advantages of high specificity, high sensitivity, high sensitivity and the like. The efficiency of extracting the mycoplasma pneumoniae nucleic acid is improved by at least four times or more; compared with a column method, the cost is reduced by 40 times, and the extraction detection limit of the mycoplasma pneumoniae is increased to 100 copy number / mL; the mycoplasma pneumoniae nucleic acid can be rapidly and efficiently extracted from a complex sample, and the method has remarkable superiority and potential clinical applicability.

Description

Technical Field

[0001] The present invention relates to the technical field of Mycoplasma pneumoniae detection, and in particular to a Mycoplasma pneumoniae nucleic acid extraction reagent, a detection kit and applications thereof. Background Art

[0002] Mycoplasma pneumoniae is a tiny cell wall-less bacterium belonging to the family Mycoplasmaceae. It is one of the smallest known microorganisms that can live independently. It is mainly transmitted through droplets in humans and is a common pathogen of community acquired pneumonia (CAP), especially in children and adolescents. The symptoms of Mycoplasma pneumoniae infection are diverse, ranging from mild upper respiratory tract infections to severe lung infections. Although a variety of antibiotics have been used to treat respiratory infections caused by Mycoplasma pneumoniae, with the increasing antibiotic resistance, the development of new treatments and diagnostic methods is particularly urgent. In addition, rapid and accurate diagnosis of Mycoplasma pneumoniae is crucial for timely and effective treatment and control of infection spread.

[0003] In order to scientifically prevent and diagnose Mycoplasma pneumoniae, it is necessary to optimize the nucleic acid extraction of such Mycoplasma pneumoniae so as to facilitate in-depth research in the later stage, such as molecular diagnosis. The commercial kits relied on by the current nucleic acid extraction methods not only have slow extraction speed and low work efficiency, but also make it difficult to clean up the residual Mycoplasma pneumoniae in the later stage. For example, the general nucleic acid extraction will use guanidine salts for lysis, which can dissolve proteins and cause nucleic acid fragmentation, so that the nucleoprotein is quickly separated from the nucleic acid due to the destruction of its secondary structure. However, the cleavage time required for guanidine salts in the actual lysis process is long, and the lysis solution and the binding solution are added at different times, resulting in a long time for the extraction of pathogenic nucleic acids and low extraction efficiency. In addition, pathogen nucleic acid extraction can also use ultrasonic treatment, bead beating, enzymes, mixing (vortex), mechanical shearing and chaotropic solution and other steps, but these steps cannot directly achieve the purpose of extraction. After the above treatment, the actual extraction procedure is still required for extraction, which ultimately adds complexity and operation time to the entire extraction process. Summary of the invention

[0004] The invention provides a Mycoplasma pneumoniae nucleic acid extraction reagent, which is used to improve the nucleic acid extraction efficiency and reduce the nucleic acid extraction and nucleic acid detection costs.

[0005] In view of this, the scheme of the present invention is:

[0006] The first aspect of the present invention is to provide a Mycoplasma pneumoniae nucleic acid extraction reagent, which is composed of Chelex-100 with a mass concentration of 2-30%, Tris-HCl with a molar concentration of 10-100mM / L, SDS with a mass concentration of 1-20%, MgCl2 with a molar concentration of 10-100mM / LM, EDTA with a molar concentration of 0.1-50mM / L and soybean saponin with a mass concentration of 0.1-10%.

[0007] The second aspect of the present invention is to propose the use of the nucleic acid extraction reagent described in the first aspect in the preparation of a Mycoplasma pneumoniae nucleic acid extraction or detection kit.

[0008] The third aspect of the present invention is to provide a method for extracting Mycoplasma pneumoniae nucleic acid, comprising the following steps:

[0009] A1) Centrifuge the sample containing Mycoplasma pneumoniae and remove the supernatant to obtain the precipitate;

[0010] A2) adding the nucleic acid extraction reagent described in the first aspect to the precipitate, mixing, and lysing in a hot bath;

[0011] A3) The lysate is centrifuged and the supernatant is collected to obtain a nucleic acid extract.

[0012] Furthermore, in step b), the cracking process temperature is 90° C. and the cracking time is 2-10 min.

[0013] The fourth aspect of the present invention is to provide a Mycoplasma pneumoniae nucleic acid detection kit, comprising the nucleic acid extraction reagent described in the first aspect, and a nucleic acid detection system; the nucleic acid detection system comprises PCR amplification primers, a reaction solution and a buffer solution.

[0014] Furthermore, the PCR amplification primers include primer pairs with nucleotide sequences as shown in SEQ ID NOs: 1-2 and SEQ ID NOs: 3-4.

[0015] Furthermore, the kit also includes a positive reference substance and a negative reference substance.

[0016] The fifth aspect of the present invention is to provide a method for detecting nucleic acid of Mycoplasma pneumoniae for non-diagnostic purposes, comprising the steps of performing nucleic acid detection using the nucleic acid detection kit described in the fourth aspect, specifically:

[0017] B1) extracting Mycoplasma pneumoniae nucleic acid using the nucleic acid extraction reagent;

[0018] B2) using the nucleic acid detection system to amplify the obtained nucleic acid extract, and performing relative quantitative analysis on the amplified Mycoplasma pneumoniae nucleic acid in combination with the melting curve.

[0019] Furthermore, in the nucleic acid detection system, the concentration of the forward primer and the reverse primer of the primer pair is 0.25 μM.

[0020] Furthermore, the amplification process is as follows:

[0021] 1) 94°C, 2 min;

[0022] 2) 94°C, 15 s; 60°C, 30 s, 40 cycles; collect fluorescence signals.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The Mycoplasma pneumoniae nucleic acid extraction and detection reagent provided by the present invention utilizes soybean saponin, a mild detergent, to produce a synergistic effect with other components, greatly improves the lysis efficiency of Mycoplasma pneumoniae, and realizes rapid and efficient extraction of Mycoplasma pneumoniae nucleic acid DNA, and the efficiency of extracting Mycoplasma pneumoniae nucleic acid is improved by at least 4 times; compared with the column method, the cost is reduced by 40 times, and the extraction detection limit of Mycoplasma pneumoniae is increased to 100 copies / mL; Mycoplasma pneumoniae nucleic acid can also be quickly and efficiently extracted from complex samples, and has significant advantages and potential clinical applicability. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The figure is a schematic diagram of the process of extracting nucleic acid of Mycoplasma pneumoniae according to the present invention.

[0026] Figure 2 It is the qPCR amplification result of the Mycoplasma pneumoniae nucleic acid detection of the present invention; in the figure, Ct1 is repeat 1; Ct2 is repeat 2; Ct mean is the average value of Ct1 and Ct2; standard deviation is the value calculated using Ct1 and Ct2. DETAILED DESCRIPTION

[0027] The technical solution of the present invention will be clearly and completely described below in conjunction with the preferred embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] The Mycoplasma pneumoniae plasmid nucleic acid used in the examples was purchased from Wuhan Qingke Biotechnology Co., Ltd. The column method was used to extract bacterial nucleic acid using the Novozyme nucleic acid extraction kit (Cat. No.: DC103-01), and then quantified by spectrophotometry to determine the total mass of nucleic acid that can be extracted from each tube, and the genome copy number was calculated based on this standard to establish a baseline for the subsequent extraction detection limit.

[0029] The sample group of the embodiment uses the purchased Mycoplasma pneumoniae plasmid nucleic acid to simulate Mycoplasma pneumoniae in a complex biological background. The embodiment sets up a combination of various different microorganisms in Mycoplasma pneumoniae and adds a human background to increase the complexity of extraction, and finally forms a simulated sample that can simulate the actual human sample environment. The specific microbial combination is the commercial reagent ZymoBIOMICS TM Microbial Community Standard (Cat. No.: D6300, hereinafter referred to as Zymo), which includes ten common microorganisms, uses a parameter of 1.4x10 6 cell / mL; human HeLa cell line (purchased from Beina Biotechnology) was also added, and the parameter used was 1.0x10 5 cell / mL; the input parameter of Mycoplasma pneumoniae plasmid is 10 3 with 10 4 Copy number / mL.

[0030] Example 1 Mycoplasma pneumoniae nucleic acid extraction reagent

[0031] Solution preparation method: Chelex-100 (2-30%, w / v, Bio-Rad), Tris-HCl (10-100mM, pH8.0), SDS (1-20%, w / v), MgCl2 (10-100mM) and EDTA (0.1-50mM), soybean saponin (0.1-10%, w / v) are mixed; after the buffer solution is prepared (except Chelex-100 and soybean saponin), it is sterilized by high pressure and stored in separate devices at 4°C for a long time for later use.

[0032] Extraction reagent 1:

[0033] Chelex-100 5% (w / v), Tris-HCl 50 mM (pH 8.0), SDS 10% (w / v), MgCl2 50 mM, EDTA 2.5 mM, soybean saponin 5% (w / v).

[0034] Extraction reagent 2:

[0035] Chelex-100 20% (w / v), Tris-HCl 20 mM (pH 8.0), SDS 1% (w / v), MgCl2 10 mM and EDTA 5 mM, soybean saponin 2% (w / v).

[0036] Extraction reagent 3:

[0037] Chelex-100 10% (w / v), Tris-HCl 10 mM (pH 8.0), SDS 20% (w / v), MgCl2 80 mM and EDTA 0.5 mM, soybean saponin 10% (w / v).

[0038] Example 2 Mycoplasma pneumoniae nucleic acid extraction and multiple detection kit

[0039] The Mycoplasma pneumoniae nucleic acid extraction and detection kit comprises an extraction and detection reagent and a nucleic acid detection reagent, wherein the detection reagent comprises qPCR SYBR Green Master mix, a qPCR primer set, a positive standard, a negative standard and ddH2O.

[0040] Example 3 Extraction of Mycoplasma pneumoniae nucleic acid

[0041] Use the Mycoplasma pneumoniae nucleic acid extraction reagent to extract the nucleic acid of Mycoplasma pneumoniae. The process is as follows Figure 1 As shown, the specific steps are as follows:

[0042] 1) Centrifuge 1 mL of the prepared mixed bacterial solution at 5000-8000 rpm for 1 minute and remove the supernatant;

[0043] 2) Add 100-200 μL of nucleic acid extraction solution to the colony pellet and shake to mix; then place the mixture in a 90°C water bath for 2-10 minutes, and then cool at room temperature for 2-5 minutes, preferably 2 minutes;

[0044] 3) The lysate was centrifuged at high speed at 12000-14000 rpm for 2 minutes;

[0045] 4) Take 100-200 μL of supernatant for subsequent quality control and target gene detection;

[0046] Nucleic acid quality control: In this example, NanoDrop (Thermo Scientific) was used to perform quality control on the extracted nucleic acid solution, and the parameters were A260 / A280 and A260 / A230 nucleic acid concentrations; Agilent 2100 was also used to perform quality control on the extracted nucleic acid.

[0047] Results and discussion: By comparing the extraction time, extraction cost, extraction nucleic acid quality control, total extraction amount, qPCR amplification test results, etc. with the control group, it can be seen that Example 3 of the present invention can efficiently extract Mycoplasma pneumoniae in simulated and clinical retrospective samples, and the cost and time comparison data of this method and the traditional Mycoplasma pneumoniae nucleic acid extraction method are as follows (average value of multiple repeated data):

[0048] method cost Optimization improvement % time Optimization improvement % Example 3 0.5 - 15 - column method 20 4000 60 400

[0049] From the above data, it can be seen that the cost of this method is reduced by 40 times and the time is shortened by 4 times compared with the column method.

[0050] Example 4 Mycoplasma pneumoniae nucleic acid extraction and testing

[0051] This example uses a complex sample group to perform nucleic acid extraction, qPCR amplification, qPCR detection and result analysis of Mycoplasma pneumoniae.

[0052] (1) Using the nucleic acid extraction and detection reagent of Example 1 to extract nucleic acid from Mycoplasma pneumoniae;

[0053] (2) Multiplex PCR primer design and synthesis: After downloading the Mycoplasma pneumoniae genome from NBCI (https: / / www.ncbi.nlm.nih.gov / taxonomy / 2104), Primer3 was used for primer design (https: / / bioinfo.ut.ee / primer3-0.4.0 / primer3 / ), and Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) was used for specificity analysis. The primer sequence information of Mycoplasma pneumoniae was finally obtained as follows:

[0054] MPF1: CTAATGGTACGCCCAGCAAT (SEQ ID NO: 1);

[0055] MPR1: AGCAGCGGGAGTCAACTG (SEQ ID NO: 2);

[0056] MPF2:TTTGAAAGCCCTGCTTGGTG (SEQ ID NO: 3);

[0057] MPR2: GAAACCACCACGGTTTTGTGG (SEQ ID NO: 4).

[0058] Next, the secondary structure of the primers was analyzed by sequence analysis software to confirm that the above primers had no secondary structure. The purpose was to ensure that the specific amplification and high-efficiency amplification could be achieved in the PCR reaction. Then, the primers were synthesized by Wuhan Qingke Biotechnology Co., Ltd.; finally, the synthesized primers were dissolved in enzyme-free water with a final concentration of 10μM;

[0059] (3) qPCR amplification: The fluorescence quantitative detection method is used. In this example, the self-selected SYBR Green Master Mix, positive reference substance, and negative reference substance are used. The PCR reaction system is as follows:

[0060] Components Volume (μL) SYBR Green Master Mix (2X) 10 DNA template 2 Forward primer (10 μM) 0.5 Reverse primer (10 μM) 0.5 <![CDATA[ddH2O]]> Up to 20 Total 20

[0061] The PCR amplification system is as follows:

[0062]

[0063]

[0064] (4) qPCR detection and result analysis: ABI 7500 fluorescence quantitative PCR instrument was used to analyze the amplification results (amplification curves such as Figure 2 Combined with the results of the melting curve, the amplified Mycoplasma pneumoniae nucleic acid was analyzed by relative quantitative analysis, and it was found that the extracted nucleic acids all contained Mycoplasma pneumoniae genes, thus indicating that this method can extract Mycoplasma pneumoniae genomic DNA. At the same time, this qPCR detection method can also be used for the detection of Mycoplasma pneumoniae nucleic acid.

[0065] Example 5 Method for determining the extraction limit of Mycoplasma pneumoniae nucleic acid

[0066] This example preliminarily explored the extraction limit of Mycoplasma pneumoniae nucleic acid by setting the input amount of Mycoplasma pneumoniae with different copy numbers. The specific steps are as follows:

[0067] (1) Setting up complex sample groups: The main difference lies in the number of copies of inactivated Mycoplasma pneumoniae (MP) added; the number of copies of Mycoplasma pneumoniae added in the experiment of this embodiment includes 10 2 , 10 3 and 10 4 Copy number / mL; background organisms include ten common microorganisms contained in Zymo, and the parameter used is 1.4x10 6 cell / mL; human HeLa cell line was also added, using a parameter of 1.0x10 5 cell / mL;

[0068] (2) Extracting sample nucleic acid using the method of Example 3, and performing concentration determination and quality control;

[0069] (3) The control method group uses column extraction, and the Novozyme nucleic acid extraction kit is preferably used for control testing;

[0070] (4) Performing qPCR verification on the simulated mixed sample nucleic acid according to step Example 4 to determine the extraction limit of the method for extracting Mycoplasma pneumoniae nucleic acid;

[0071] Results and discussion: From the data in the table below, it can be determined that this method can extract a variety of different copy numbers (10 2 , 10 3 and 10 4The number of copies / mL of Mycoplasma pneumoniae nucleic acid was maintained at 10 after the second-generation sequencing. 2 The above results prove that this method can be used to extract Mycoplasma pneumoniae nucleic acid in a complex sample background.

[0072] Sample composition Ct(repeat 1) Ct (repeat 2) Ct (repeat 3) <![CDATA[MP(10 2 )+Zymo+HeLa]]> 29.43 29.28 29.67 <![CDATA[MP(10 3 )+Zymo+HeLa]]> 27.21 27.42 27.28 <![CDATA[MP(10 4 )+Zymo+HeLa]]> 25.28 25.19 25.14 Zymo+HeLa(control) NoC NoC NoC

[0073] Example 6 Performance comparison of different Mycoplasma pneumoniae nucleic acid extraction and detection reagents

[0074] The nucleic acid extraction and detection reagents for Mycoplasma pneumoniae in different combinations were respectively carried out using the method of Example 3, and the complex sample group (MP(10 4 copies / mL)+Zymo(1.4x10 6 cell / mL)+HeLa(1.0x10 5 cell / mL) and compared the results of the complex sample group with the data of the baseline 11 established using the extraction detection limit of Mycoplasma pneumoniae. The results are shown in the following table:

[0075]

[0076] In the above-mentioned test reagent experiment, the selected extraction reagent is the extraction reagent 1 in Example 1: the mass concentration of Chelex-100 is 5%, the molar concentration of Tris-HCl is 50mM / L, the pH is 8.0, the mass concentration of SDS is 10%, the molar concentration of MgCl2 is 50mM / L, the molar concentration of EDTA is 2.5mM / L, and the mass concentration of soybean saponin is 5%. By continuously increasing and decreasing the substance detection and comparing with the publicly reported data of the substance, the role of each substance and the relationship between them are determined.

[0077] From the above data and the existing public data of the above substances, it can be seen that the Mycoplasma pneumoniae nucleic acid extraction and detection reagent provided by component 1 of the embodiment of the present application has the best effect, and removing one or more of the components will affect the extraction performance to a certain extent; at the same time, there is a certain correlation between different components, among which the role of detergents and chelating agents accounts for a relatively high level. Through repeated experiments, it is found that these substances not only have the functions of cell crushing, divalent ion chelation of EDTA, buffering, etc., but also have an impact on other reagents. The experiment found that the combination of Chelex-100, Tris-HCl, SDS, MgCl2, EDTA, and soybean saponin played a good synergistic effect. In particular, the combination of CHlex-100 and soybean saponin has played a good role in improving the efficiency of nucleic acid extraction.

[0078] Example 7 Performance Differences between Soy Saponin and Other Saponins in Nucleic Acid Extraction Reagent Solution

[0079] The selection of soybean saponins in Example 1 of the present invention is based on the comparison and optimization of the extraction effects of different saponins. Under the premise of the same saponin concentration and other components, the extraction effects of different saponins were compared respectively. The complex sample group (MP(10 4 copies / mL)+Zymo(1.4x10 6 cell / mL)+HeLa(1.0x10 5 cell / mL) and compared the results of the complex sample group with the data of the baseline 6 established using the extraction detection limit of Mycoplasma pneumoniae. The results are shown in the following table:

[0080]

[0081] In the above-mentioned test reagent experiment, the selected extraction reagent is the extraction reagent 1 in Example 1: the mass concentration of Chelex-100 is 5%, the molar concentration of Tris-HCl is 50mM / L, the pH is 8.0, the mass concentration of SDS is 10%, the molar concentration of MgCl2 is 50mM / L, the molar concentration of EDTA is 2.5mM / L, and the mass concentration of soybean saponin (digitonin, ginsenoside, digitonin and gypsophila saponin are selected as controls) is 5%. By replacing different types of saponins, the relationship between the combination of each component and the efficiency of nucleic acid extraction is determined.

[0082] Example 8: Efficient extraction of nucleic acid detection reagents for Mycoplasma pneumoniae nucleic acid

[0083] The amount of each substance in Examples 3, 4 and 6 of the present invention was used to test the efficiency of nucleic acid extraction of Mycoplasma pneumoniae, and the nucleic acid extraction detection reagent of the present invention was compared with other extraction methods based on Chelex-100, and the nucleic acid extraction detection reagent of the present invention was determined to have the highest efficiency of nucleic acid extraction of Mycoplasma pneumoniae using clinical samples positive for Mycoplasma pneumoniae. Among them, the nucleic acid extraction reagent composition of Chelex-100 method 1 is 10% Chelex-100 + 1% Tween-20, and the nucleic acid extraction reagent composition of Chelex-100 method 2 is 10% Chelex-100 + 1% NP-40.

[0084]

[0085] Example 9 Application of the nucleic acid extraction reagent and detection reagent of the present invention in clinical samples

[0086] The present invention uses the dosage of each substance in Examples 3, 4 and 6 to extract and detect clinical samples, and evaluates the performance of sputum and bronchoalveolar lavage fluid from clinical settings. The results are shown in the following table:

[0087]

[0088]

[0089] In the above nucleic acid extraction and detection reagent experiment, different clinical samples were selected for performance testing. It can be found that the Mycoplasma pneumoniae nucleic acid extraction solution and detection reagent of the present invention can be used to detect clinical samples well. The performance difference with the comparison reagent is small, and it can replace the existing extraction kit for the detection of Mycoplasma pneumoniae.

[0090] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A Mycoplasma pneumoniae nucleic acid extraction reagent, characterized in that: The invention comprises Chelex-100 with a mass concentration of 2-30%, Tris-HCl with a molar concentration of 10-100mM / L, SDS with a mass concentration of 1-20%, MgCl2 with a molar concentration of 10-100mM / LM, EDTA with a molar concentration of 0.1-50mM / L and soybean saponin with a mass concentration of 0.1-10%.

2. Use of the nucleic acid extraction reagent according to claim 1 in preparing a Mycoplasma pneumoniae nucleic acid extraction or detection kit.

3. A method for extracting Mycoplasma pneumoniae nucleic acid, characterized in that the steps include: A1) Centrifuge the sample containing Mycoplasma pneumoniae and remove the supernatant to obtain the precipitate; A2) adding the nucleic acid extraction reagent according to claim 1 to the precipitate, mixing, and lysing in a hot bath; A3) The lysate is centrifuged and the supernatant is collected to obtain a nucleic acid extract.

4. The extraction method according to claim 3, characterized in that In step b), the cracking process temperature is 90° C. and the cracking time is 2-10 min.

5. A Mycoplasma pneumoniae nucleic acid detection kit, characterized in that: It comprises the nucleic acid extraction reagent as claimed in claim 1, and a nucleic acid detection system; the nucleic acid detection system comprises PCR amplification primers, a reaction solution and a buffer solution.

6. The kit according to claim 5, characterized in that The PCR amplification primers include primer pairs with nucleotide sequences as shown in SEQ ID NOs: 1-2 and SEQ ID NOs: 3-4.

7. The kit according to claim 5, characterized in that The kit also includes a positive reference substance and a negative reference substance.

8. A method for detecting Mycoplasma pneumoniae nucleic acid for non-diagnostic purposes, characterized in that: The method comprises the steps of using the nucleic acid detection kit according to claim 5 to perform nucleic acid detection, specifically: B1) extracting Mycoplasma pneumoniae nucleic acid using the nucleic acid extraction reagent; B2) using the nucleic acid detection system to amplify the obtained nucleic acid extract, and performing relative quantitative analysis on the amplified Mycoplasma pneumoniae nucleic acid in combination with the melting curve.

9. The detection method according to claim 8, characterized in that: In the nucleic acid detection system, the concentration of the forward primer and the reverse primer of the primer pair is 0.25 μM.

10. The detection method according to claim 8, characterized in that: The amplification process procedure is: 1) 94°C, 2 min; 2) 94°C, 15 s; 60°C, 30 s, 40 cycles; collect fluorescence signals.

Images