Application of overexpression hsaCLNS1A2 reagent in preparation of medicine for treating preeclampsia

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of a reagent for overexpressing hsaCLNS1A2 in preparation of a medicine for treating preeclampsia, the placenta tissues of a normal puerpera and a PE puerpera are sequenced by RNA sequencing, hsaCLNS1A2 is determined to be specific circRNA, and the influence of hsaCLNS1A2 on placental trophoblast pyroptosis and invasion and migration is clarified.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to the use of a reagent for overexpressing hsa_CLNS1A_2 in the preparation of a drug for treating preeclampsia. Background Art

[0002] Preeclampsia, abbreviated as PE, is a serious pregnancy complication that usually occurs after 20 weeks of pregnancy. It is mainly manifested by new hypertension and proteinuria, and end-organ dysfunction may occur. The specific symptoms vary from person to person, but it usually poses a serious threat to the health of pregnant women and fetuses around the world, leading to iatrogenic premature birth, intrauterine growth restriction of the fetus, etc., and the impact is long-term, which will increase the risk of pregnant women suffering from cardiovascular diseases in the future and the risk of chronic diseases in the fetus as an adult. At present, more attention is paid to the prevention methods before the onset of PE, such as adjusting lifestyle, treating high-risk factors, taking aspirin, and regular prenatal examinations to prevent the occurrence of PE in advance to a certain extent. In particular, special attention should be paid to the high-risk population for PE, and the method of taking aspirin in advance should be adopted to minimize the incidence of PE. When PE occurs, symptomatic treatment can only be taken by lowering blood pressure, sedation, etc. Termination of pregnancy is currently the only and effective way to cure PE. Therefore, in-depth exploration of the pathogenesis and prevention and treatment strategies of PE has become an important issue that clinicians and laboratories around the world urgently need to solve.

[0003] Pyroptosis is a special type of inflammatory programmed necrosis that mainly relies on gasdermin family proteins to form plasma membrane pores, leading to cell death, and plays an important role in the innate immune response. Unlike other cell death modes, it is characterized by NLRP3 inflammasomes promoting caspase-1-dependent plasma membrane rupture and releasing IL-1β, IL-18, etc. into the external environment, leading to inflammation and further aggravating PE. Cell pyroptosis occurs rapidly and is accompanied by the release of a large number of pro-inflammatory factors. It also causes cell swelling, cell membrane blistering and other cell lysis phenomena, similar to necrosis. In healthy pregnant women, the regulatory mechanism of the maternal-fetal interface plays an important role, ensuring that the maternal immune system does not over-attack the embryo, while protecting the embryo from external pathogens, thereby preventing excessive local and systemic inflammation. The maternal-fetal interface is mainly composed of trophoblasts. The outer layer is the syncytiotrophoblast, a special tissue formed by the fusion of the cell membranes of the original cells; the inner layer is the cytotrophoblast, which is close to the embryonic sac and has a cell membrane. This structural feature enables the trophoblast to effectively regulate the exchange of substances and information between the mother and the embryo. However, in pregnant women with PE, these regulatory mechanisms are interrupted due to local hypoxia / ischemia, innate immune activation, etc., further leading to placental inflammation and dysfunction. A large number of studies have detected increases in IL-1β, IL-6, IL-8 and tumor necrosis factor-α in PE patients. Tumor necrosis factor-α is abbreviated as TNF-α. Placental trophoblast pyroptosis is a key pathway for the occurrence of PE. Studying the specific mechanism of pyroptosis in the placenta can provide new ideas for the clinical treatment of PE.

[0004] Circular RNA, abbreviated as circRNA, is a new type of non-coding RNA molecule widely present in eukaryotic cells. It can act as a miRNA sponge, RNA-binding protein chelator, and nuclear transcription factor to participate in the regulation of gene expression. Due to the special covalent closed loop structure of circRNA, it has the characteristics of stability, conservation, timing specificity, tissue cell specificity and stability, and has become a new hot spot for precise prevention and treatment of diseases. Compared with other RNAs, circRNA is more abundant and more specific, and its unique structure makes it highly stable. A large number of studies have confirmed that circRNA is involved in many disease processes, including embryonic development, myocardial infarction, diabetes, etc., suggesting that circRNA is closely related to disease diagnosis, prognosis and treatment, and has great potential as a new molecular marker. Studies have found that circRNA plays an important role in the pathological process of PE, and can promote the occurrence and development of PE by participating in the regulation of trophoblast proliferation, invasion and apoptosis. Research on circRNAs in the progression of PE is still in its infancy, making the role of circRNA and preeclampsia unknown. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides the use of a reagent that overexpresses hsa_CLNS1A_2 in the preparation of a drug for treating preeclampsia.

[0006] The use of an agent overexpressing hsa_CLNS1A_2 in the preparation of a drug for treating preeclampsia. The nucleotide sequence of hsa_CL NS1A_2 is: CCGCCTGTCTTGGTTAGATGGCTCTGGATTAGGA, recorded as SEQ ID NO.1.

[0007] Preferably, the drug inhibits cell apoptosis.

[0008] Preferably, the reagent for overexpressing hsa_CLNS1A_2 comprises an adenovirus vector.

[0009] Preferably, the adenovirus vector is pAAV-IRES-hrGFP.

[0010] Preferably, the reagent for overexpressing hsa_CLNS1A_2 also includes a transfection aid reagent.

[0011] Preferably, the transfection aid is Polybrene.

[0012] Preferably, the reagent for overexpressing hsa_CLNS1A_2 also includes complete culture medium.

[0013] Preferably, the complete culture medium comprises 0.8% to 1.2% volume fraction of antibiotics.

[0014] Preferably, the antibiotic is penicillin-streptomycin.

[0015] The present invention uses RNA sequencing to sequence the placental tissues of normal and PE pregnant women, determines that hsa_CLNS1A_2 is a specific circRNA, and comprehensively analyzes the cellular expression localization of hsa_CLNS1A_2 based on the results of clinical tissue samples and cultured cells, and clarifies its effects on the pyroptosis, invasion and migration of placental trophoblast cells, providing an important intervention target for further improving the mechanism of action, clinical diagnosis and precision treatment of PE. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Figure 1 is the expression of pyroptosis-related proteins in placental tissues of PE patients. Figure A is the expression of pyroptosis-related proteins NLRP3 and GSDMD in placental tissues of PC and PE groups detected by immunohistochemistry, and Figure B is the expression of pyroptosis-related proteins NLRP3, GSDMD and GSDMD-N proteins in placental tissues of PC and PE groups detected by Western blot.

[0017] Figure 2 Figure 1 is the effect of hypoxia on pyroptosis in placental trophoblast cells. Figure A is the expression of pyroptosis-related proteins NLRP3, GSDMD and GSDMD-N proteins detected by Western blot after placental trophoblast cells were hypoxic. Figure B is the concentration of inflammatory factors IL-1β and IL-18 in the supernatant of placental trophoblast cells after hypoxia detected by ELISA.

[0018] Figure 3 To screen differentially expressed circRNAs in placental tissues of PE patients for circRNA sequencing and perform cluster analysis;

[0019] Figure 4To detect the expression levels of differentially expressed CircRNAs in placental tissues by qRT-PCR;

[0020] Figure 5 qRT-PCR was used to detect the expression of hsa_CLNS1A_2 in HTR-8 / SVneo cells after hypoxia;

[0021] Figure 6 Figure 1 is a diagram of the circular structure of hsa_CLNS1A_2, wherein Figure A is the expression of hsa_CLNS1A_2 in cDNA and gDNA detected by agarose gel electrophoresis, and Figure B is the expression of hsa_CLNS1A_2 and its corresponding linear RNA CLNS1A detected by qRT-PCR after HTR-8 / SVneo cells were treated with exonuclease (RNase R);

[0022] Figure 7 Figure 1 is the localization of hsa_CLNS1A_2 in HTR-8 / SVneo cells, where Figure A is the nuclear-cytoplasmic RNA isolation experiment to detect the expression of hsa_CLNS1A_2 in the nucleus and cytoplasm of HTR-8 / SVneo cells, and Figure B is the RNAFISH experiment to detect the distribution of hsa_CLNS1A_2 in HTR-8 / SVneo cells;

[0023] Figure 8 The hsa_CLNS1A_2 overexpression and interference stable cell lines were successfully constructed, among which A is the qRT-PCR detection of the self-expression level of HTR-8 / SVneo cells after overexpression of hsa_CLNS1A_2, and B is the qRT-PCR detection of the self-expression level of HTR-8 / SVneo cells after interference of hsa_CLNS1A_2;

[0024] Fig. 9 The effect of overexpression of hsa_CLNS1A_2 on pyroptosis of HTR-8 / SVneo cells, wherein A is the microscopic observation of pyroptotic cells in HTR-8 / SVneo cells after overexpression of hsa_CLNS1A_2, B is the ELISA detection of the concentrations of inflammatory factors IL-1β and IL-18 in the supernatant of HTR-8 / SVneo cells after overexpression of hsa_CLNS1A_2, C is the Western blot detection of the expression of pyroptosis-related proteins NLRP3, GSDMD and GSDMD-N proteins in HTR-8 / SVneo cells after overexpression of hsa_CLNS1A_2, and D is the statistical graph of the expression of pyroptosis-related proteins NLRP3, GSDMD and GSDMD-N proteins in HTR-8 / SVneo cells after overexpression of hsa_CLNS1A_2 detected by Western blot;

[0025] Fig.10 The effect of interfering with hsa_CLNS1A_2 on pyroptosis of HTR-8 / SVneo cells, wherein A is the microscopic observation of pyroptosis of HTR-8 / SVneo cells after interfering with hsa_CLNS1A_2, B is the ELISA detection of the concentrations of inflammatory factors IL-1β and IL-18 in the supernatant of HTR-8 / SVneo cells after interfering with hsa_CLNS1A_2, C is the Western blot detection of the expression of pyroptosis-related proteins NLRP3, GSDMD and GSDMD-N proteins in HTR-8 / SVneo cells after interfering with hsa_CLNS1A_2, and D is the statistical graph of the expression of pyroptosis-related proteins NLRP3, GSDMD and GSDMD-N proteins in HTR-8 / SVneo cells after interfering with hsa_CLNS1A_2;

[0026] Fig.11 The effect of overexpression of hsa_CLNS1A_2 on the invasion and migration of HTR-8 / SVneo cells, where A is the Trans-well assay to determine the invasion ability of HTR-8 / SVneo cells after overexpression of hsa_CLNS1A_2, and B is the wound healing assay to detect the migration ability of HTR-8 / SVneo cells after overexpression of hsa_CLNS1A_2;

[0027] Fig.12 To show the effect of interfering with hsa_CLNS1A_2 on the invasion and migration of HTR-8 / SVneo cells, A is the transwell method used to determine the invasion ability of HTR-8 / SVneo cells after interfering with hsa_CLNS1A_2, and B is the wound healing experiment used to detect the migration ability of HTR-8 / SVneo cells after interfering with hsa_CLNS1A_2.

[0028] Fig.13 Adenoviral vector map. DETAILED DESCRIPTION

[0029] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified.

[0030] Placental tissue specimens were collected from obstetricians of the General Hospital of Ningxia Medical University from October 2022 to March 2023, including: preeclampsia group PE: 30 cases, women of childbearing age, patients hospitalized for PE; pregnancy control group PC: 30 cases, healthy patients hospitalized in the hospital during the same period, full-term delivery. At the same time, clinical data of the subjects were collected, including: maternal age, gestational age, systolic blood pressure, diastolic blood pressure, random urine protein, neonatal weight, etc. Among them, random urine protein, 1 = negative, 2 = positive.

[0031] For human specimens involved, patients were informed in writing before acquisition and their signed informed consent was obtained, which had been reviewed and approved by the Medical Ethics Committee.

[0032] All pregnant women included in the study were singleton pregnancies and underwent cesarean section, without other comorbidities or complications. The diagnostic criteria for PE refer to the diagnostic criteria in the ninth edition of Obstetrics and Gynecology edited by Xie Xing: systolic blood pressure ≥140 mmHg and / or diastolic blood pressure ≥90 mmHg after 20 weeks of pregnancy, accompanied by any of the following conditions: urine protein ≥0.3g / 24h or random urine protein ≥(+); or no urine protein, but combined with any of the following five items, thrombocytopenia <100*10 9 ; In patients with liver damage, serum transaminase levels are more than twice the normal value; In patients with renal damage, blood creatinine levels are >0.11 mg / L or more than twice the normal value; Pulmonary edema; New onset of central nervous system abnormalities or visual impairment.

[0033] Exclusion criteria: multiple pregnancy; accompanied by comorbidities or other complications, such as a history of diabetes, heart disease, nephritis, autoimmune diseases, etc.; a history of treatment such as blood transfusion, transplantation, immunotherapy, etc.; a history of smoking, drinking, drug abuse, etc.

[0034] Specimen collection: Within 10 minutes after cesarean section placenta delivery, three pieces were collected from the middle of the maternal placenta, 2 cm around the umbilical cord, and the infarction and calcification foci were removed; the diameter of the placenta specimen was about 1 cm, rinsed with saline three times, drained with dry gauze, placed in a cryopreservation tube and stored in liquid nitrogen, with the time, name and hospital number noted.

[0035] Human placental trophoblast cell line HTR-8 / Svneo cells were purchased from Shanghai Fudan Cell Bank. The cells were stored in liquid nitrogen for future use. The freezing solution was prepared in a ratio of DMSO to fetal bovine serum of 1:9.

[0036] The experimental method involved in the present invention is carried out as follows:

[0037] 1. Experimental grouping and culture of HTR8-S / Vneo trophoblast cells

[0038] 1. Experimental Grouping

[0039] To study the effects of hypoxic conditions on trophoblast cell pyroptosis, invasion and migration: normoxia group Normoxia and hypoxia group Hypoxia; to study the effects of overexpression and interference of hsa_CLNS1A_2 on hypoxia-induced trophoblast cell pyroptosis: Hypoxia group, Hypoxia+AAV-GFP group, Hypoxia+AAV-hsa_CLNS1A_2 group, Hypoxia+sh-NC group, and Hypoxia+sh-hsa_CLNS1A_2 group.

[0040] The hsa_CLNS1A_2 overexpression adenovirus (synthesized by Shanghai GenePharma) was constructed, denoted as AAV-hsa_CLNS1A_2. Specifically, the hsa_CLNS1A_2 sequence was constructed into the adenovirus vector AAV-GP-12 (pAAV-IRES-hrGFP), and transferred into HTR8-S / Vneo trophoblast cells to achieve overexpression of the target gene. The adenovirus vector was pAAV-IRES-hrGFP, abbreviated as AAV-GP-12, constructed by Shanghai GenePharma, and the map is shown in Fig.13 shown.

[0041] 2. Cell culture

[0042] (1) The cell culture medium is a complete culture medium, specifically: RPMI 1640 culture medium containing 10% fetal bovine serum and 1% penicillin-streptomycin;

[0043] (2) Normoxic culture: in a cell culture incubator at 37°C and 5% CO2;

[0044] (3) Hypoxic culture: in a cell culture incubator at 37°C, 1% O2 and 5% CO2;

[0045] (4) After 48 h, the cells were collected for subsequent experiments.

[0046] 3. Cell cryopreservation

[0047] Cryopreservation solution was prepared at a ratio of DMSO: fetal bovine serum = 1:9. The cell culture flask was taken out of the incubator, and cells in the logarithmic growth phase were selected. The waste liquid in the culture flask was aspirated and discarded on the clean bench. After gently blowing and washing 1 to 2 times, 1 mL of trypsin was added to digest the cells. After digestion was complete, the trypsin was discarded, and culture medium was added to blow and mix the adherent cells. The cells were transferred to a 15 mL centrifuge tube and centrifuged at 1000 rpm for 5 min. The supernatant was discarded, and the cryopreservation solution was added. The cells were blown and mixed, and then aliquoted into 1.5 mL to 1.8 mL cryopreservation tubes, and the cell name, freezing time and operator were marked. The cells were transferred to a liquid nitrogen tank for retention in the order of gradient freezing at 4°C for 30 min, -20°C for 2 h, and -80°C overnight.

[0048] 4. Adenovirus and Lentivirus Transfection

[0049] Select the trophoblast cells in the logarithmic growth phase and digest them with trypsin, then add 8 mL of complete medium, gently blow the cells, shake to prepare the suspension, take 500 μL and inoculate in a 24-well plate overnight; take out the cells the next day, observe the cell growth to 60%-70% under a microscope, and transfect with MOI=50 according to the instructions of the adenovirus and lentivirus operation manual. Add hsa_CLNS1A_2 overexpression adenovirus and interfering lentivirus to the complete medium, add 8 μg / mL of the transfer agent polybrene, discard the complete medium after 24 hours and replace it with new complete medium for continued culture. When the cell density reaches about 90%, transfer to 25cm 2 The cells were cultured in the culture flasks, and stable transfection strains were selected by 2 μg / mL puromycin (used for screening of interference with lentiviral transfection, not required for overexpression adenovirus), and then the transfection efficiency was detected by real-time fluorescent quantitative polymerase chain reaction.

[0050] 2. Real-time fluorescence quantitative polymerase chain reaction, abbreviated as qRT-PCR

[0051] 1. Total RNA extraction from placental tissue / cells

[0052] (1) Preparation: Place the items required for RNA extraction in a clean bench irradiated with ultraviolet light according to the instructions;

[0053] (2) Sample lysis: Weigh 80 mg to 100 mg of human placental tissue or prepared cells in advance and place them in an EP tube containing 1 mL of RZ lysis solution. Use a pipette to gently blow and mix the cells. Use ophthalmic scissors to cut the placental tissue into pieces and place it in an oscillator for vigorous shaking. Then place it at room temperature for 5 min to allow it to be fully lysed.

[0054] (3) Place the tube in a pre-cooled centrifuge and centrifuge at 12,000 rpm / min for 5 min. Remove the tube and move it to the workbench. Transfer the supernatant to a new enzyme-free EP tube prepared in advance.

[0055] (4) Add 200 μL of chloroform to the sample, vortex vigorously for 30 seconds, let it stand on the workbench for 3 minutes, and centrifuge it at 4°C for 10 minutes. The sample can be seen to be divided into three layers: organic layer, middle layer and aqueous phase. RNA is mainly concentrated in the aqueous phase. Pipette 450 μL of the colorless aqueous phase and transfer it to a new EP tube;

[0056] (5) Add 225 μL of anhydrous ethanol to the EP tube and mix by inverting. Transfer the mixed liquid to the marked adsorption column and centrifuge at 12000 rpm / min at 4°C for 30 seconds.

[0057] (6) Discard the liquid in the collection tube and add 500 μL of protein-free eluent RD to the adsorption column, and centrifuge at 12000 rpm at 4°C for 30 seconds;

[0058] (7) Discard the liquid in the collection tube and add 500 μL of rinse solution RW to the adsorption column. Place it on the workbench for 2 min and then centrifuge it at 4°C and 12000 rpm / min for 30 sec. Repeat this step twice.

[0059] (8) After discarding the waste liquid, centrifuge at 12000 rpm / min at 4°C for 2 min. After the centrifugation, aspirate the remaining liquid;

[0060] (9) In a clean bench, let the adsorption column stand for 10 min, dry it thoroughly, and finally move it to a labeled RNase-free EP tube. Add 40 μL RNase-free ddH2O and let it stand at room temperature for 2 min. Centrifuge at 12,000 rpm / min at 4°C for 30 sec to collect RNA. Use a spectrophotometer to detect the RNA concentration and store it in a -80°C refrigerator for long-term storage.

[0061] 2. Reverse transcription

[0062] (1) After preparing the RNA, if the RNA has been extracted and stored at -80°C, put it on ice first, and re-measure the RNA concentration after it thaws. Configure the reverse transcription system for each sample, see Table 1:

[0063] Table 1 Reverse transcription system

[0064] Reagents Usage 5×PrimeScriptBuffer 4μL PrimeScriptRTEnzymeMixI 1μL 50 μM OligodTPrimer 1μL 100 μM Random 6mers 1μL Total RNA 1 μg <![CDATA[RNaseFreeddH2O]]> up to 20 μL

[0065] (2) Vortex the prepared reverse transcription system to mix well, remove bubbles, and perform reverse transcription according to the conditions in Table 2:

[0066] Table 2 Reverse transcription conditions

[0067] Reaction temperature Reaction time 37℃ 15min 85℃ 5sec 4℃ ∞

[0068] (3) After the RNA is reverse transcribed into cDNA, the sample is collected and stored in a -20°C refrigerator.

[0069] 3. PCR reaction

[0070] (1) Prepare the reagents required for the PCR reaction according to the following table. Place the eight rows on a pre-cooled constant temperature module to prepare the reaction solution. See Table 3 for details:

[0071] Table 3 Reaction system

[0072]

[0073]

[0074] (2) Add the reaction solution to each of the eight tubes in a row, shake gently to mix until there are no bubbles, and then perform PCR amplification. The procedure is as shown in Table 4:

[0075] Table 4 Amplification procedures

[0076] Cycle steps Reaction conditions Pre-denaturation 95℃,30sec transsexual 95℃,5sec Annealing and extension 60℃,30sec

[0077] (3) Adopt 2 -Ct The relative expression level of the target gene hsa_CLNS1A_2 was calculated by this method.

[0078] 4. RNase R digestion experiment verifies the ring structure of hsa_CLNS1A_2

[0079] (1) Observe cells that are in good growth condition under a microscope and extract RNA according to the above RNA extraction steps;

[0080] (2) RNA grouping: control group, RNase R treatment group;

[0081] (3) RNase R treatment group: incubated at 37°C for 10 min;

[0082] (4) reverse transcribing the RNA into cDNA according to the reverse transcription step above;

[0083] (5) qRT-PCR experiments were used to detect the expression of hsa_CLNS1A_2 and its corresponding linear RNA CLNS1A_2.

[0084] 5. Verification of the ring structure of hsa_CLNS1A_2 by agarose gel electrophoresis

[0085] (1) Glue preparation: dilute 50×TAE solution with up water to 1×TAE, add 1 g agarose powder to every 100 mL 1×TAE, heat in a microwave oven to fully dissolve until completely transparent, add 1 μL nucleic acid dye after the temperature drops, shake to mix, pour into the glue preparation module and place in a 4°C refrigerator to wait for the liquid to solidify, insert a comb into the glue preparation module in advance;

[0086] (2) Sample loading: dilute the pre-amplified product according to a certain ratio, and then add DNA loading buffer, with the total sample volume: DNA loading buffer = 1:6;

[0087] (3) On-line testing: Fill the electrophoresis tank with TAE liquid, take the agarose gel out of the refrigerator and place it in the electrophoresis tank, add the sample to the spotting well, set the electrophoresis voltage to 150V for 20 min, use ice cubes to cool the gel during this period to avoid gel deformation. After the electrophoresis is completed, place the gel in a gel imager for exposure and save the results.

[0088] 6. RNA nuclear-cytoplasmic separation experiment clarifies the localization of hsa_CLNS1A_2

[0089] (1) After trypsin digestion, 1×10 trophoblasts were collected. 7 Transfer the cells to a 1.5 mL centrifuge tube without enzymes, add 500 μL of cell separation buffer, use a pipette to gently and repeatedly blow to resuspend the cells, incubate on ice for 10 min, and then centrifuge for 5 min;

[0090] (2) Transfer the supernatant to a new RNase-free tube, add 500 μL of cell disruption buffer, and vortex vigorously for 30 seconds to lyse the cell nuclei;

[0091] (3) Add an equal volume of Lysis / Binding Solution to the liquid and mix using a pipette;

[0092] (4) Add an equal volume of anhydrous ethanol to the liquid, stir gently and transfer the sample mixture to the pre-marked filter cartridge. Centrifuge briefly and discard the filtrate and place it in a new filter cartridge. Repeat this step once;

[0093] (5) Add 700 μL of cleaning solution I to the filter element for cleaning once, centrifuge briefly to discard the waste liquid, then add 500 μL of cleaning solution II / III, centrifuge briefly to discard the waste liquid, repeat this step once, and continue centrifugation for 2 minutes to fully remove the waste liquid;

[0094] (6) Place the filter cartridge into a new collection tube and add 50 μL of elution buffer. Centrifuge for 1 min to recover RNA. Repeat this step once to collect RNA. Store the resulting RNA at -80°C for later use.

[0095] 7. Detection of the distribution of hsa_CLNS1A_2 in cells by fluorescence in situ hybridization (FISH for short)

[0096] (1) Cell fixation: Add 4% paraformaldehyde to the culture dish to fix the cells to maintain the integrity of the cell structure and nucleic acid;

[0097] (2) Permeabilization: After discarding the paraformaldehyde, add 1 mL of PBS to wash three times, aspirate the PBS and add 50 μL of TritonX-100 for transparent treatment;

[0098] (3) Probe denaturation: Place the probe in a 75°C constant temperature water bath for 5 min, then take it out and place it on ice to denature the probe;

[0099] (4) Probe hybridization: Add the denatured probe dropwise to the culture dish and incubate in a 37°C constant temperature oven overnight;

[0100] (5) Washing samples: After hybridization, the excess probe is removed by brief incubation in wash buffer;

[0101] (6) Hybridization signal amplification: block, add avidin-FITC, wash, repeat once, and then add DAPI staining solution;

[0102] (7) Seal the slides and observe the results under a fluorescence microscope.

[0103] 8. Western blot assay to detect pyroptosis-related indicators NLRP3 and GSDMD

[0104] (1) Protein extraction: a. Placental tissue: Take out the placenta tissue from the -80°C freezer, use forceps to cut 80-100 mg of tissue, rinse the blood stains and dry the surface water, then grind it with a tissue homogenizer; b. After removing the cells from the intercellular space, place them on ice to prevent protein degradation, wash them with PBS, scrape the adherent cells into PBS liquid with a cell scraper, then transfer them to an EP tube with a pipette, centrifuge at 4°C, 5000 rpm for 5 min, and discard the supernatant;

[0105] (2) Prepare protein lysis buffer as shown in Table 5.

[0106] Table 5 Preparation of protein lysis buffer

[0107] Reagent Type Dosage LysisBuffer 1000μL 100mMPMFS 5μL Phosphatase inhibitors 10μL Protease inhibitors 1μL

[0108] (3) Cooking protein: add 0.5 mL of lysis buffer to each EP tube, vortex vigorously for 30 seconds, let stand for 4 minutes, and repeat 5 times. After the last operation, centrifuge at 4°C, 12000 rpm for 5 minutes, transfer the supernatant to a new centrifuge tube, test the protein concentration, add loading buffer, protein solution: loading buffer = 4:1, cook in a 99°C metal bath for 5 minutes, cool to room temperature, transfer to a -20°C refrigerator for storage;

[0109] (4) During the WB process, electrophoresis solution, electrotransfer solution, PBST, blocking solution, and luminescent solution need to be prepared. The specific configuration scheme is as follows:

[0110] (5) SDS-polyacrylamide gel electrophoresis, abbreviated as SDS-PAGE: Prepare 10% gel in advance, put it into the electrophoresis solution, mark the experimental group and add the sample, set the voltage to 80V; cut the PVDF membrane and mark it for use, and soak the PVDF membrane in 100% anhydrous ethanol for 5 minutes before the end of electrophoresis. After the electrophoresis, cut the gel and transfer the mold. Avoid bubbles between the gel and the PVDF membrane during the transfer. Make sure the gel / membrane is in a wet state. Clamp it with a clamp and put it into the transfer tank filled with electrotransfer solution. Set 0.3A and 90 minutes;

[0111] (6) Blocking: Prepare the blocking solution in advance and mix it on a shaker. After the transfer is completed, place the membrane in the blocking solution and incubate it on a shaker at room temperature for 2 h.

[0112] (7) Primary antibody incubation: After blocking is completed, wash with PBST three times, 10 min each time, prepare the primary antibody using antibody diluent or PBST, place the membrane in the primary antibody incubation box, and incubate at 4°C overnight. It should be noted that the primary antibody prepared with PBST is not suitable for phosphorylated proteins;

[0113] (8) Secondary antibody incubation: The next day, the membrane was washed three times with PBST, 10 min each time, and the secondary antibody was added and incubated at room temperature for 2 h.

[0114] (9) Exposure: Soak the membrane incubated with secondary antibodies in luminescent liquid. After a short period of time, take out the membrane and absorb the luminescent liquid with absorbent paper. Place it in a gel imager, adjust the exposure parameters, and collect data for further analysis.

[0115] 9. Immunohistochemistry experiments to detect pyroptosis-related indicators NLRP3 and GSDMD

[0116] (1) Dewaxing of paraffin sections: Placental tissue paraffin sections were immersed in the following order: xylene immersion for 10 min → xylene II immersion for 10 min → anhydrous ethanol I immersion for 5 min → anhydrous ethanol II immersion for 5 min → 95% alcohol immersion for 5 min → 80% alcohol immersion for 5 min → 70% alcohol immersion for 5 min. After being removed from the alcohol, the sections were rinsed with up water for 3 times, 5 min each time.

[0117] (2) Prepare PBS solution according to Table 6:

[0118] Table 6 Preparation of PBS solution

[0119] Powder / reagent Dosage UP Water 2000mL PBST powder 1 pack / 2L

[0120] (3) Antigen repair: Place the tissue sections in a repair box, add an appropriate amount of 0.01 M, pH 6.0 citrate buffer to cover the area of ​​the tissue section, and repair with microwave at high temperature. Take the repair box out of the microwave and cool it naturally to room temperature. Rinse the sections with PBS three times, 5 min each time.

[0121] (4) Blocking: Add endogenous peroxidase blocker to the slice tissue area to cover all the slice tissue areas, incubate at room temperature for 30 min, and rinse the slices with PBS three times, 5 min each time;

[0122] (5) Immunolabeling: Use absorbent paper to gently absorb the water around the tissue, and use a special oil pen to draw a circle around the tissue, add 80uL of BSA solution blocking solution, and place it in a 37℃ constant temperature oven for incubation for 30min. After discarding the blocking solution, incubate the prepared primary antibody at 4℃ overnight. The primary antibody is diluted at a ratio of 1:200. The next day, wash with PBS and incubate with the fluorescent secondary antibody at room temperature for 2h;

[0123] (6) Color development: After the secondary antibody incubation, wash with PBS three times, spin dry, add the prepared DAB color development solution and incubate for 10 min;

[0124] (7) Re-staining of cell nuclei: After rinsing with tap water, add hematoxylin to counterstain for 3 min. After rinsing, add ammonia water to return to blue;

[0125] (8) Sealing: Add neutral gum to seal the slide and observe under a microscope.

[0126] 10. ELISA assay to detect pyroptosis-related indicators IL-1β and IL-18

[0127] (1) Sample processing: Collect the cell culture medium, centrifuge at 1000 rpm for 15 min, and collect the supernatant;

[0128] (2) Preparation of gradient working solutions of standards: Add 1 mL of diluent to the standard and mix gently. Prepare working solutions of 100 pg / mL, 50 pg / mL, 25 pg / mL, 12.5 pg / mL, 6.25 pg / mL, 3.13 pg / mL, and 0 pg / mL respectively according to the serial dilution method.

[0129] (3) Sample addition: Add the prepared standards and samples to a 96-well ELISA plate in sequence, 100 μL / well. Set up a blank well and add 100 μL of universal diluent. Cover the plate with a sealing film and mix gently. Incubate at 37°C for 60 min.

[0130] (4) Biotinylated antibody: After removing the ELISA plate, remove the liquid and add 100 μL of the pre-prepared biotinylated antibody working solution to each well. Cover the plate with a sealing film and mix gently. Incubate at 37°C for 60 min.

[0131] (5) Washing: After taking out the ELISA plate, remove the liquid and add 300 μL of the previously prepared washing solution to each well. After standing for 1 min, remove the washing solution and pat the ELISA plate dry on absorbent paper. Repeat the washing three times.

[0132] (6) Adding enzyme conjugate working solution: After the ELISA plate is dried, add 100 μL of the pre-prepared enzyme conjugate working solution to each well, cover with a sealing film and incubate at 37°C for 30 min.

[0133] (7) Adding substrate: After washing the plate, add 90 μL of substrate to each well, cover with sealing film and incubate at 37°C for 15 min;

[0134] (8) Add stop solution: Take out the ELISA plate, add 50 μL of stop solution to each well, measure the OD value of each well at a wavelength of 450 nm on an ELISA reader, and calculate the sample concentration.

[0135] Statistical methods

[0136] Prism 8.0 and SPSS 23.0 software were used to process the data. The measurement data were expressed as mean ± standard deviation. The independent sample t test was used for comparison between the two groups. One-way analysis of variance was used for comparison between multiple groups. The Student-Newman-Keuls test was used for pairwise comparison between the groups. The enumeration data were expressed as number of cases or percentage. The chi-square test (χ 2 ) test. P ≤ 0.05 was considered statistically significant.

[0137] result

[0138] 1. Analysis of clinical data of PC group and PE group

[0139] Analysis of clinical case data of pregnant women in PC group and PE group showed that the average age of PC group was 28.47±5.19 years old, the average gestational age was 39.19±1.50 weeks, the average systolic blood pressure was 115.90±8.78 mmHg, the average diastolic blood pressure was 74.77±7.10 mmHg, there was no case of random urine protein positive, and the average neonatal weight was 3456.33±441.31 g; the average age of PE group was 28.17±6.09 years old, the average gestational age was 38.11±2.34 weeks, the average systolic blood pressure was 144.90±12.83 mmHg, the average diastolic blood pressure was 95.37±7.67 mmHg, there were 16 cases of random urine protein positive, and the average neonatal weight was 2887.00±607.71 g. Except for age, which had no statistical difference (P>0.05), the other differences between the two groups were significantly statistically different (P<0.05). The systolic and diastolic blood pressures of PE patients were significantly higher than those of the PC group, P<0.001. The weight of newborns of PE patients was significantly lower than that of the PC group, P<0.001. There was a significant difference in the number of random urine protein positive patients between the PC group and the PE group, and the positive proportion in the PE group was higher, P<0.001, Table 7.

[0140] Table 7 Comparison of clinical characteristics between normal pregnant women and patients with preeclampsia

[0141]

[0142] 2. Expression of pyroptosis-related proteins in placental tissue of PE patients

[0143] In order to clarify whether pyroptosis exists during PE, placental tissues from the PC and PE groups were collected according to the diagnostic and exclusion criteria, and the expressions of pyroptosis-related proteins NLRP3 and GSDMD were analyzed by immunohistochemical staining. The results showed that compared with the PC group, the expressions of pyroptosis-related proteins NLRP3 and GSDMD in the PE group were significantly increased. Western blot was used to detect the expressions of pyroptosis-related proteins NLRP3 and GSDMD in placental tissues, and the results showed that compared with the PC group, the protein expression levels of pyroptosis-related proteins NLRP3, GSDMD and GSDMD-N in the PE group were significantly increased, indicating that cell pyroptosis may be involved in the development of PE. Figure 1 .

[0144] 3. Effects of hypoxia on pyroptosis in placental trophoblasts

[0145] HTR-8 / SVneo cells were cultured in vitro for 24 h under 1% oxygen concentration and normoxia. Western blot was used to detect the expression of pyroptosis-related proteins in the cells. The results showed that compared with Normoxia, the protein expression levels of pyroptosis-related proteins NLRP3, GSDMD and GSDMD-N in the Hypoxia group were significantly increased. ELISA results showed that the concentrations of inflammatory factors IL-1β and IL-18 in the supernatant of HTR-8 / SVneo cells increased significantly after hypoxia. Figure 2 .

[0146] 4. CircRNA sequencing to screen differentially expressed circRNAs in placental tissues of PE patients

[0147] The research team initially selected 10 pairs of PC and PE maternal placental tissues to extract RNA and then performed circRNA sequencing. The differentially expressed circRNAs were screened out using P < 0.05 and difference fold |FC| ≥ 1.5 as the screening criteria. Finally, GO functional analysis and KEGG pathway enrichment analysis were used to screen out 5 differentially expressed circRNAs related to pyroptosis, such as Figure 3 and Table 8.

[0148] Table 8 Five differentially expressed circRNAs associated with pyroptosis

[0149] Gene Symbol PValue Regulation ENSG00000155974 GRIP1 0.0085638 down ENSG00000107771 CCSER2 0.0316432 down ENSG00000144824 PHLDB2 0.000382 down ENSG00000204842 ATXN2 0.0178798 down ENSG00000074201 CLNS1A 0.0226041 down

[0150] 5. Expression of differentially expressed CircRNAs in placental tissue

[0151] qRT-PCR was used to further detect the expression of the five pyroptosis-related circRNAs in the cluster heat map in placental tissues. The results showed that compared with the PC group, only the expression of hsa_CLNS1A_2 was significantly decreased in the PE group (P < 0.0001), which was consistent with the sequencing results. Figure 4 .

[0152] 6. Expression of hsa_CLNS1A_2 in HTR-8 / SVneo cells

[0153] The expression of hsa_CLNS1A_2 was verified in HTR-8 / SVneo cells cultured in vitro. The results of qRT-PCR showed that the expression of hsa_CLNS1A_2 was significantly reduced after hypoxia. Therefore, the role of hsa_CLNS1A_2 in pyroptosis of PE placental trophoblasts was explored in the follow-up. Figure 5 .

[0154] 7. Ring structure of hsa_CLNS1A_2

[0155] In order to verify that hsa_CLNS1A_2 has circularization characteristics, blue Divergent Primer and green Convergent Primer were designed for ordinary PCR amplification. The circular RNA was reversely sheared into a circle, while the linear RNA could not. The agarose gel electrophoresis results showed that cDNA could amplify bands, but gDNA could not amplify bands, indicating that hsa_CLNS1A_2 is a circular structure. After HTR-8 / SVneo cells were treated with nuclease exonuclease, the expression of hsa_CLNS1A_2 and the corresponding linear RNA CLNS1A was detected. The qRT-PCR results showed that hsa_CLNS1A_2 did not change significantly after RNase R treatment, while its corresponding linear RNA was significantly degraded, confirming that hsa_CLNS1A_2 exhibited stable characteristics in HTR-8 / SVneo cells, such as Figure 6 .

[0156] 8. Localization of hsa_CLNS1A_2 in HTR-8 / SVneo cells

[0157] After extracting nuclear RNA and cytoplasmic RNA of HTR-8 / SVneo cells using a nuclear RNA isolation kit, qRT-PCR was used to detect the expression of hsa_CLNS1A_2. The results showed that hsa_CLNS1A_2 was mainly located in the cytoplasm. At the same time, RNA FISH experiments were used to observe the distribution of hsa_CLNS1A_2 in the nucleus and cytoplasm. The results showed that most of hsa_CLNS1A_2 was located in the cytoplasm of HTR-8 / SVneo. Therefore, hsa_CLNS1A_2 is mainly located in the cytoplasm, such as Figure 7 .

[0158] 9. hsa_CLNS1A_2 overexpression and interference stable cell lines were successfully constructed

[0159] HTR-8 / SVneo cells were infected with hsa_CLNS1A_2 overexpression adenovirus and interference lentivirus to construct hsa_CLNS1A_2 overexpression adenovirus and interference lentivirus stable cell lines. hsa_CLNS1A_2 overexpression was recorded as AAV-hsa_CLNS1A_2, and interference hsa_CLNS1A_2 was recorded as sh-hsa_CLNS1A_2. qRT-PCR was used to detect the expression level of hsa_CLNS1A_2 after overexpression and interference. The results showed that the overexpression effect of hsa_CLNS1A_2 was significant, and the three interference lentiviruses all had significant interference effects, P<0.001, P<0.0001, among which sh-hsa_CLNS1A_2-2 had the most obvious interference effect. Figure 8 B.

[0160] 10. Effect of overexpression of hsa_CLNS1A_2 on pyroptosis in HTR-8 / SVneo cells

[0161] In order to verify the role of hsa_CLNS1A_2 in placental trophoblast pyroptosis, a stable hsa_CLNS1A_2 overexpressing cell line was constructed. Microscopy was used to observe typical changes of cell pyroptosis, such as cell swelling and bubble-like protrusions. The results showed that after overexpression of hsa_CLNS1A_2, a significant decrease in cells with pyroptosis morphology could be observed. ELISA results showed that after overexpression of hsa_CLNS1A_2, the concentrations of inflammatory factors IL-1β and IL-18 were significantly reduced. Western blot was used to detect the expression levels of pyroptosis-related proteins. The results showed that after overexpression of hsa_CLNS1A_2, the protein levels of NLRP3, GSDMD and GSDMD-N were significantly reduced, indicating that overexpression of hsa_CLNS1A_2 could inhibit the pyroptosis of HTR-8 / SVneo cells. Fig. 9 .

[0162] 11. Effect of hsa_CLNS1A_2 interference on pyroptosis of HTR-8 / SVneo cells

[0163] Microscopic observations showed that the number of cells with pyroptosis morphology increased after hsa_CLNS1A_2 interference; ELISA results showed that the concentrations of inflammatory factors IL-1β and IL-18 increased significantly after hsa_CLNS1A_2 interference; Western blot results showed that the levels of NLRP3, GSDMD and GSDMD-N proteins increased significantly after hsa_CLNS1A_2 interference, indicating that hsa_CLNS1A_2 interference can promote HTR-8 / SVneo cell pyroptosis. Fig.10 .

[0164] 12. Effect of overexpression of hsa_CLNS1A_2 on invasion and migration of HTR-8 / SVneo cells

[0165] The Trans-well assay was used to determine the invasion ability of cells, and the results showed that overexpression of hsa_CLNS1A_2 enhanced the invasion ability of HTR-8 / SVneo cells. The wound healing assay was used to detect the migration ability of cells, and the results showed that overexpression of hsa_CLNS1A_2 enhanced the migration ability of HTR-8 / SVneo cells, suggesting that overexpression of hsa_CLNS1A_2 can promote the invasion and migration of HTR-8 / SVneo cells. Fig.11 .

[0166] 13. Effect of hsa_CLNS1A_2 interference on invasion and migration of HTR-8 / SVneo cells

[0167] Trans-well results showed that the invasion ability of HTR-8 / SVneo cells was weakened after interfering with hsa_CLNS1A_2; the results of wound healing experiments showed that the migration ability of HTR-8 / SVneo cells was weakened after interfering with hsa_CLNS1A_2, indicating that interfering with hsa_CLNS1A_2 can inhibit the invasion and migration of HTR-8 / SVneo cells. Fig.12 .

[0168] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0169] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0170] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Application of reagents overexpressing hsa_CLNS1A_2 in the preparation of drugs for the treatment of preeclampsia.

2. The use according to claim 1, characterized in that: The drug inhibits cell apoptosis.

3. The use according to claim 1, characterized in that: The reagent for overexpressing hsa_CLNS1A_2 includes an adenovirus vector.

4. The use according to claim 3, characterized in that: The adenovirus vector is pAAV-IRES-hrGFP.

5. The use according to claim 2, characterized in that: The reagent for overexpressing hsa_CLNS1A_2 also includes a transfection aid reagent.

6. The use according to claim 5, characterized in that: The transfection-assisting reagent is Polybrene.

7. The use according to claim 5, characterized in that: The reagent for overexpressing hsa_CLNS1A_2 also includes complete culture medium.

8. The use according to claim 7, characterized in that: The complete culture medium comprises antibiotics in a volume fraction of 0.8% to 1.2%.

9. The use according to claim 8, characterized in that: The antibiotic is penicillin-streptomycin.

Images