Molecular marker related to salinity tolerance character of grass carp, amplification primer of molecular marker and application of molecular marker in salt-tolerant breeding of grass carp

Abstract

The invention provides a molecular marker related to the salinity tolerance character of grass carp, an amplification primer of the molecular marker and application of the molecular marker in salt-tolerant breeding of the grass carp, and belongs to the technical field of breeding of aquatic animals. The molecular marker related to the salinity tolerance character of the grass carp is obtained by screening through whole genome association analysis (GWAS), and T / C polymorphism exists at the 25391590 site of a chromosome 3 or A / G polymorphism exists at the 9605803 site of a chromosome 10. The molecular marker is remarkably related to the salt tolerance character of the grass carp, two pairs of amplification primers are developed for the molecular marker, selective breeding of the grass carp can be assisted, salinity tolerance parents of the grass carp can be efficiently identified, and the salt tolerance breeding progress of the grass carp is accelerated.

Description

Technical Field

[0001] The invention belongs to the technical field of aquatic animal breeding, and particularly relates to a molecular marker related to a salinity tolerance trait of grass carp and an amplification primer thereof, and an application of the marker in salt-tolerant breeding of grass carp. Background Art

[0002] The development and utilization of saline-alkali waters is considered to be one of the potential ways to promote the sustainable development of aquaculture. China's saline-alkali lands are widely distributed and diverse in types, of which the area of ​​low-lying saline-alkali waters is about 46 million hectares. The saline-alkali water environment is characterized by high alkalinity, high pH and complex ion composition, which significantly affects the growth, survival and reproduction of fish. Conventional freshwater and marine aquaculture economic animals are difficult to be effectively utilized in most saline-alkali waters through transplantation or domestication. Therefore, in-depth research on the adaptation mechanism of fish to saline-alkali environments and the cultivation of excellent salt-alkali tolerant fish species are of great scientific and practical significance for promoting the efficient development of saline-alkali waters.

[0003] Grass carp (Ctenopharyngodon idellus) belongs to the Cypriniformes, Cyprinidae, Leucineae, and Ctenopharyngodon genus. It is the most important freshwater aquaculture economic fish in China, with a history of more than 60 years. Grass carp is widely welcomed in the aquatic market due to its advantages such as fast growth, wide feed sources, rich nutrition, delicious taste and high yield, and is an ideal aquaculture target. However, its aquaculture area is mainly concentrated in freshwater environments. Therefore, the breeding of salt-tolerant grass carp is not only of great scientific research value, but also expected to bring significant economic benefits.

[0004] Traditional breeding methods have improved the salt tolerance of grass carp to a certain extent. However, since the salt tolerance trait is controlled by multiple genes and is affected by a variety of environmental factors, conventional breeding methods have limited efficiency in improving the salt tolerance of grass carp. In recent years, with the rapid development of biological science and technology, molecular design breeding has gradually emerged and made significant progress. Single nucleotide polymorphism (SNP) is one of the most common forms of genetic variation in the genome. Studying SNP sites can reveal genetic differences between individuals and provide an important basis for improving genetic traits. Unfortunately, there is currently no development and report of grass carp milk salt SNP molecular markers. Summary of the invention

[0005] In view of this, the object of the present invention is to provide a molecular marker related to the salinity tolerance trait of grass carp, which is significantly correlated with grass carp milk salt and can be used for the breeding of salt-tolerant grass carp varieties.

[0006] The present invention provides a molecular marker related to the salinity tolerance trait of grass carp, including a first SNP molecular marker and / or a second SNP molecular marker;

[0007] The first SNP molecular marker is a T / C polymorphism at position 99 in the DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 1;

[0008] The second SNP molecular marker is an A / G polymorphism existing at position 182 in the DNA fragment with a nucleotide sequence as shown in SEQ ID NO:2.

[0009] The present invention provides a primer for amplifying a molecular marker related to the salinity tolerance trait of grass carp, including an amplification primer for a first SNP molecular marker and / or an amplification primer for a second SNP molecular marker;

[0010] The amplification primers for the first SNP molecular marker include a forward primer having a nucleotide sequence as shown in SEQ ID NO:3 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:4;

[0011] The amplification primers for the second SNP molecular marker include a forward primer having a nucleotide sequence as shown in SEQ ID NO:5 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:6.

[0012] The invention provides a grass carp salinity tolerance detection kit, comprising the primers.

[0013] Preferably, Premix Ex Taq is also included.

[0014] The invention provides application of the primer or the kit in cultivating salinity-tolerant grass carp.

[0015] The invention provides application of the primer or the kit in detecting the salinity tolerance of grass carp.

[0016] The present invention provides a method for detecting the salinity tolerance of grass carp, comprising the following steps: using the grass carp genomic DNA of the sample to be tested as a template, performing PCR amplification using the primers to obtain a PCR product;

[0017] The genotype of the SNP site in the PCR product is detected, and the salinity tolerance of the grass carp is judged according to the genotype of the SNP site: when the genotype of the first SNP molecular marker is CT and / or the genotype of the second SNP molecular marker is AG, the sample to be tested is a salinity-tolerant grass carp; when the genotype of the first SNP molecular marker is CC or TT and / or the genotype of the second SNP molecular marker is AA or GG, the sample to be tested is a salinity-sensitive grass carp.

[0018] Preferably, the reaction system for PCR amplification is 20 μl, including 10 μl Premix Ex Taq, 8 μl ddH2O, 1 μl 10 μM forward and reverse primers, and 1 μl 50 ng / μl DNA template.

[0019] Preferably, the reaction procedure of the PCR amplification is: 95°C for 5 min; 95°C for 30 s, 52°C for 30 s, 72°C for 50 s, 35 cycles; 72°C for 5 min.

[0020] Preferably, the salinity of the salinity tolerance is not higher than 10.95‰.

[0021] The present invention provides a molecular marker related to the salinity tolerance trait of grass carp, including a first SNP molecular marker and / or a second SNP molecular marker; the first SNP molecular marker is a T / C polymorphism at the 99th position in the DNA fragment of the nucleotide sequence as shown in SEQ ID NO:1; the second SNP molecular marker is an A / G polymorphism at the 128th position in the DNA fragment of the nucleotide sequence as shown in SEQ ID NO:2. The present invention obtains the lowest salinity at which all grass carps die through a salinity tolerance test, and obtains two SNP molecular markers that may be related to the salt tolerance trait through whole genome resequencing. The salt tolerance test shows that the two SNP molecular markers are significantly correlated with salt tolerance under a heterozygous genotype. Therefore, the molecular markers provided by the present invention can be used to carry out breeding and detection of salt-tolerant grass carp.

[0022] The present invention provides a primer for amplifying a molecular marker related to the salinity tolerance trait of grass carp, and two pairs of primers are designed for two SNP molecular markers. The primer pair has strong specificity and can accurately amplify a sequence containing the SNP molecular marker site of the present invention. The primer pair can be used to assist in selective breeding, efficiently identify grass carp salinity tolerance parents, and accelerate the progress of grass carp salt tolerance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a statistical graph of grass carp mortality in different salinity groups under acute salinity stress;

[0024] Figure 2 It is the linear regression prediction model of grass carp mortality after 96 hours of acute salinity stress;

[0025] Figure 3 Manhattan plot for GWAS association analysis related to salinity tolerance in grass carp;

[0026] Figure 4 QQ plot of GWAS association analysis related to salinity tolerance of grass carp;

[0027] Figure 5This is the electrophoresis diagram of the chr3-25391590 locus of grass carp;

[0028] Figure 6 This is the electrophoresis diagram of grass carp chr10-9605803 site. DETAILED DESCRIPTION

[0029] The present invention provides a molecular marker related to the salinity tolerance trait of grass carp, comprising a first SNP molecular marker and / or a second SNP molecular marker; the first SNP molecular marker is the 25391590th position of chromosome 3 of grass carp, specifically, there is a T / C polymorphism at the 99th position in a DNA fragment with a nucleotide sequence as shown in SEQ ID NO:1; the second SNP molecular marker is the 9605803rd position of chromosome 10 of grass carp, specifically, there is an A / G polymorphism at the 182nd position in a DNA fragment with a nucleotide sequence as shown in SEQ ID NO:2.

[0030] The invention provides primers for amplifying molecular markers related to the salinity tolerance trait of grass carp, comprising primers for amplifying a first SNP molecular marker and / or primers for amplifying a second SNP molecular marker; the primers for amplifying the first SNP molecular marker comprise a forward primer having a nucleotide sequence as shown in SEQ ID NO:3 (CAGCGAAGGAGGTGGATCTG) and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:4 (GTCCAGGAGCTTGTTGACTGTC); the primers for amplifying the second SNP molecular marker comprise a forward primer having a nucleotide sequence as shown in SEQ ID NO:5 (GCTAGACATAATGATCAACGCAGT) and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:6 (CACTGTTGTTCATGCTTCTCCTTG).

[0031] The present invention has no special restrictions on the source of the primers, and the primers can be synthesized by artificial synthesis methods known in the art. In the embodiment of the present invention, the primers were commissioned to Yixin Biotechnology (Shanghai) Co., Ltd. for synthesis.

[0032] The invention provides a grass carp salinity tolerance detection kit, comprising the primers.

[0033] In the present invention, the kit preferably also includes Premix Ex Taq, purchased from Takara Biotechnology (Dalian) Co., Ltd.

[0034] The invention provides application of the primer or the kit in cultivating salinity-tolerant grass carp.

[0035] In the present invention, the method for breeding salinity-tolerant grass carp in the application uses the molecular marker as a detection target, screens the genotype of the first SNP molecular marker and / or the second SNP molecular marker, and selects a grass carp variety whose genotype of the first SNP molecular marker is CT and / or whose genotype of the second SNP molecular marker is AG as a parent to carry out breeding work.

[0036] The invention provides application of the primer or the kit in detecting the salinity tolerance of grass carp.

[0037] The present invention provides a method for detecting the salinity tolerance of grass carp, comprising the following steps: using the grass carp genomic DNA of the sample to be tested as a template, performing PCR amplification using the primers to obtain a PCR product;

[0038] The genotype of the SNP site in the PCR product is detected, and the salinity tolerance of the grass carp is judged according to the genotype of the SNP site: when the genotype of the first SNP molecular marker is CT and / or the genotype of the second SNP molecular marker is AG, the sample to be tested is a salinity-tolerant grass carp; when the genotype of the first SNP molecular marker is CC or TT and / or the genotype of the second SNP molecular marker is AA or GG, the sample to be tested is a salinity-sensitive grass carp.

[0039] The present invention has no particular limitation on the method for extracting the grass carp genomic DNA of the sample to be tested, and a genomic DNA extraction method known in the art can be used, such as a commercial kit extraction method. The type of the sample to be tested preferably includes at least one of the following: grass carp tissue, grass carp fins, grass carp blood, etc.

[0040] In the present invention, the reaction system of the PCR amplification is preferably 20 μl, including 10 μl Premix Ex Taq, 8 μl ddH2O, 1 μl 10uM forward and reverse primers, and 1 μl 50ng / μl DNA template. The reaction procedure of the PCR amplification is preferably: 95°C for 5 min; 95°C for 30 s, 52°C for 30 s, 72°C for 50 s, 35 cycles; 72°C for 5 min.

[0041] In the present invention, the method for detecting the genotype of the SNP site in the PCR product preferably includes sequencing the PCR product, and analyzing the genotype of the 99th position of the first SNP molecular marker or the 182nd position of the second SNP molecular marker in the sequencing result.

[0042] In the embodiment of the present invention, the results show that the genotype of the first SNP molecular marker is CT and / or the genotype of the second SNP molecular marker is AG, which is significantly correlated with acute salinity tolerance. The salinity of the salinity tolerance is preferably not higher than 10.95‰, and can be 10%, 10.2%, 10.3%, 10.5%, 10.7%, 10.8% and 10.85%.

[0043] The following is a detailed description of a molecular marker related to the salinity tolerance trait of grass carp and its amplification primers provided by the present invention and its application in salt-tolerant breeding of grass carp in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0044] Example 1

[0045] Experiment on acute salinity tolerance of grass carp

[0046] 1) The grass carp used in this experiment were selected from a random group of one-year-old fish bred in Suzhou Future Aquaculture Farm, totaling 3,000 fish. The fish were of uniform size, intact body surface, healthy and disease-free. Before the experiment, the grass carp were kept in an indoor cement pool for 1 week. The commercial feed was fed regularly at 8:00 and 17:00 every day, and the feeding amount was about 1% to 2% of the fish body weight.

[0047] 2) Based on the results of the preliminary experiment, the salinity range of the grass carp experiment was basically determined to be 10.25‰~11.5‰. On this basis, the experiment set up 6 salinity gradient groups of 10.25‰, 10.5‰, 10.75‰, 11.0‰, 11.25‰, and 11.5‰, with 3 parallels for each gradient, and 10 grass carps of neat size were placed in each parallel. The activity and death of grass carp within 96 hours were observed and accurately recorded, and dead individuals were fished out in time. The salinity of the water body was detected every 12 hours using a portable salinometer, and the salinity of the water body was adjusted with sea crystal (Chuangyi Biotechnology Co., Ltd., Shanghai) to ensure that it was maintained at the set salinity. After the experiment, the 96h half-lethal concentration was calculated using the linear regression method based on the death of grass carp.

[0048] The results showed that the mortality rate of grass carp gradually increased with the increase of salinity. The mortality rate of all salinity groups was 0% at 24h of stress. After 96h of acute salinity stress, the mortality rate of the 11.5‰ group reached 100%, and the mortality rate of the 10.25‰ group was 0% ( Figure 1 ).

[0049] The 96-hour salinity and mortality rate were used as the independent variable and the dependent variable, respectively, and the 96-hour linear regression equation was obtained as follows: Y = 79.5x-820.6, R 2 =0.9799. The median lethal concentration of grass carp under salinity stress for 96 hours is 10.95‰ ( Figure 2 ).

[0050] Example 2

[0051] Mining SNPs associated with salt tolerance in grass carp

[0052] 1) Based on the results of acute salinity tolerance determination of grass carp in Example 1, the lowest concentration that causes death to all grass carps, i.e., salinity 11.5‰, was selected to carry out acute salinity toxicity experiments. 700 grass carps in the temporary holding pond in Example 1 were placed in a pre-configured water body with a salinity of 11.5‰. Individuals died one after another due to their inability to adapt to the salinity level. The experimental individuals were numbered in the order of death, the tail fins were collected and immersed in anhydrous ethanol, and the survival time of each grass carp was accurately recorded. The judgment criteria for grass carp death were: no vitality, no eyeball activity, and no response to glass rod stimulation. The first 100 grass carps that died were assigned to the salinity sensitive group, and the last 100 grass carps that died were assigned to the salinity tolerant group. A total of 200 grass carp samples were sent to Shanghai Paisonno Biotechnology Co., Ltd. for whole genome resequencing, and genotyping was performed using the software GATK to obtain the SNPs and InDel variation information of the samples. Subsequently, plink software was used to perform quality control and filtering on the typing data, and finally the strictly screened typing results were obtained for subsequent analysis.

[0053] 2) The case-control phenotype record format was used, and combined with the genotyping results, the SNP genotype data and phenotype data were analyzed by genome-wide association study (GWAS) using EMMAX software. The significance threshold of the association analysis was set to -log10(1 / N)=8.068, where N is the number of SNPs used for analysis. Sites with p values ​​reaching this threshold were considered to have significant associations. The analysis results were visualized using the ggplot2 package to generate a Manhattan plot ( Figure 3 ) and QQ plot ( Figure 4 ) is used to show the association between SNPs and phenotypes at the genomic level.

[0054] The results showed that there were 6 SNP sites that met the requirements among all SNPs. Through Blast analysis and comparison, according to the physical information and linkage region gene annotation, 2 SNPs that may be related to the salt tolerance trait were preliminarily identified. Their physical positions and sequence information are shown in Table 1. The SNP site Chr3-25391590 in Table 1 is located at position 25391590 of chromosome 3 of grass carp, which is the 99th position of the corresponding sequence in Table 1, and the base at position 99 is C (cytosine) or T (thymine); the SNP site Chr10-9605803 is located at position 9605803 of chromosome 10 of grass carp, which is the 182nd position of the corresponding sequence in Table 1, and the base at position 182 is A (adenine) or G (guanine).

[0055] They are associated with the salt tolerance traits of grass carp and can be used for salt tolerance breeding of grass carp. These loci were analyzed and the results are shown in Table 2.

[0056] Table 1 SNPs associated with salt tolerance in grass carp

[0057]

[0058]

[0059] Table 2 Statistical analysis of genotypes of SNP loci in sensitive and tolerant populations

[0060]

[0061] As shown in Table 2, the genotypes of the above two SNPs loci were significantly different between the sensitive group and the tolerant group (P<0.001), and the chr3-25391590: CT genotype and chr10-9605803: AG genotype were significantly associated with the salt tolerance trait. Therefore, the SNPs markers of the present invention can be used for salt tolerance breeding of grass carp.

[0062] Example 3

[0063] Application of SNP loci associated with salt tolerance of grass carp in grass carp breeding

[0064] Based on the two SNP sites located in Example 2 of the present invention, corresponding primers are developed for molecular marker-assisted selection breeding of salt-tolerant grass carp to obtain new salt-tolerant grass carp germplasm. The primer information is shown in Table 3.

[0065] Table 3 Primer sequences of SNPs related to salt tolerance in grass carp

[0066]

[0067] Randomly select 8 DNA samples from the salinity sensitive group (SS) and the salinity tolerant group (ST) in Example 2 to verify the reliability of the primers, specifically including the following steps: select grass carp genomic DNA as a template, and use the primers shown in Table 3 for PCR amplification. The amplification volume is 20μl, including 10μl Premix Ex Taq, 8μld dH2O, 1μl forward and reverse primers (10uM), and 1μl DNA template (50ng). The amplification conditions are: 95℃5min; 95℃30s, 52℃30s, 72℃50s, 35 cycles; 72℃5min. The PCR product was detected by 0.8% agarose gel electrophoresis, and the qualified product was subjected to Sanger sequencing.

[0068] Figure 5 and Figure 6 The results showed that the primer sequences in Table 3 could specifically amplify the fragments, and after Sanger sequencing, it was found that the amplified fragments contained the target SNP sites, indicating that the designed primer sequences could be used for subsequent genotyping.

[0069] 300 grass carp from the group in Example 1 were randomly selected to carry out an acute salinity stress experiment. The salinity used was the 96h half-lethal concentration of salinity calculated in Example 1: 10.95‰. The salinity of the acute experimental water was 10.95‰, and the stress time was 96h. During the 96h stress period, tail fin tissues of 148 dead individuals and 152 surviving individuals were collected. The genotypes of the two SNP sites located in Example 2 were detected to verify the correlation between the genotype and the salt tolerance trait of grass carp. Specifically, the following steps were included:

[0070] 1) DNA extraction: Use Tiangen DNA extraction kit to extract 300 caudal fin rays of the validation population for later use.

[0071] 2) PCR amplification: The relevant procedures and reaction systems are the same as above, and the qualified products are subjected to Sanger sequencing. The survival rate and mortality rate of the 300 grass carp population are compared according to the Sanger sequencing results. The statistical results are shown in Table 4.

[0072] Table 4 Distribution of salt-tolerant SNP genotypes in a random population of 300 grass carp under acute salinity stress

[0073] name genotype Total number of molecular markers detected Surviving individuals Survival rate Dead individuals mortality rate chr3-25391590 CT 52 49 94.2％ 3 5.8％ chr10-9605803 AG 91 84 92.3％ 7 7.7％

[0074] As can be seen from Table 4, 300 grass carps were used to conduct a 96-h semi-lethal acute salinity stress verification experiment, and a total of 52 individuals with the chr3-25391590 genotype were detected, of which 49 survived and 3 died; 91 individuals with the chr10-9605803 genotype were AG, of which 84 survived and 7 died; therefore, if the genotype of the chr3-25391590 site in the grass carp individual genome is CT or the genotype of the chr10-9605803 site in the grass carp individual genome is AG, its salinity tolerance is higher, and this molecular marker can be used to carry out the breeding of salt-tolerant grass carp.

[0075] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A molecular marker related to salinity tolerance of grass carp, characterized in that: including a first SNP molecular marker and / or a second SNP molecular marker; The first SNP molecular marker is a T / C polymorphism at position 99 in the DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 1; The second SNP molecular marker is an A / G polymorphism existing at position 182 in the DNA fragment with a nucleotide sequence as shown in SEQ ID NO:

2.

2. A primer for amplifying a molecular marker related to the salinity tolerance trait of grass carp according to claim 1, characterized in that: including amplification primers for the first SNP molecular marker and / or amplification primers for the second SNP molecular marker; The amplification primers for the first SNP molecular marker include a forward primer having a nucleotide sequence as shown in SEQ ID NO:3 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:4; The amplification primers for the second SNP molecular marker include a forward primer with a nucleotide sequence as shown in SEQ ID NO:5 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:

6.

3. A grass carp salinity tolerance detection kit, characterized in that: Comprising the primer according to claim 2.

4. The grass carp salinity tolerance detection kit according to claim 3, characterized in that: Premix ExTaq is also included.

5. Use of the primer according to claim 2 or the kit according to claim 3 or 4 in breeding salinity-tolerant grass carp.

6. Use of the primers according to claim 2 or the kit according to claim 3 or 4 in detecting the salinity tolerance of grass carp.

7. A method for detecting the salinity tolerance of grass carp, characterized in that: The following steps are involved: The grass carp genomic DNA of the sample to be tested is used as a template, and PCR amplification is performed using the primers described in claim 2 to obtain a PCR product; The genotype of the SNP site in the PCR product is detected, and the salinity tolerance of grass carp is determined according to the genotype of the SNP site: When the genotype of the first SNP molecular marker is CT and / or the genotype of the second SNP molecular marker is AG, the sample to be tested is a salinity-tolerant grass carp; When the genotype of the first SNP molecular marker is CC or TT and / or the genotype of the second SNP molecular marker is AA or GG, the sample to be tested is salinity-sensitive grass carp.

8. The method according to claim 7, characterized in that: The reaction system of the PCR amplification is 20 μl, including 10 μl Premix Ex Taq, 8 μl ddH2O, 1 μl 10 μM forward and reverse primers, and 1 μl 50 ng / μl DNA template.

9. The method according to claim 7, characterized in that: The reaction procedure of the PCR amplification is: 95°C for 5 min; 95°C for 30 s, 52°C for 30 s, 72°C for 50 s, 35 cycles; 72°C for 5 min.

10. The method according to any one of claims 7 to 9, characterized in that: The salinity of the salinity tolerance is no higher than 10.95‰.

Images