Development and application of multiplex detection primers, probes and multiplex detection biochips for various pear tree diseases

Abstract

The present invention provides the development and application of multiple detection primer probes and multiple detection biochips for various pear tree diseases, and belongs to the field of biotechnology. The present invention constructs an integrated biological detection chip for 4 kinds of bacteria and 2 kinds of viruses for the first time for pears, which can replace the traditional electrophoresis display method and can interpret the test results faster. Regarding the accuracy of the interpretation results. Compared with the traditional electrophoresis results, the virus detection chip developed by the present invention has the characteristics of high sensitivity, strong specificity, strong expandability, convenient operation, low price, intuitive interpretation, high efficiency, etc., which significantly improves the accuracy of the detection and greatly saves high-end human resources and production costs. After the development of this system, it will be applied in some nursery enterprises to provide technical support for the production of non-toxic seedlings and the quarantine of imported seedlings.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to the development and application of multiple detection primer probes and multiple detection biochips for various pear tree diseases. Background Art

[0002] my country's pear planting area accounts for 69.68% of the world's total pear planting area, and its pear output accounts for 67.30% of the world's total pear output, both ranking first in the world. my country is further transforming and upgrading its pear industry, from tall tree orchards to modern dwarf rootstock dense planting orchards. More than 95% of the cultivation of new fruit tree seedlings is completed by tissue culture.

[0003] Pear is a perennial deciduous fruit tree. Its fruit is sweet, juicy and delicious, and is deeply loved by people. Once pear trees are infected with diseases and insect pests, the quality and yield of the fruit will be affected. Through investigation and research, it is found that the viral diseases that harm my country's pears are mainly divided into two categories: bacterial diseases and viral diseases. Among them, the more serious ones are bacterial diseases of branches, flowers and fruits such as apricot fire blight, Asian pear fire blight, pear blossom blight, pear rust water disease, and viral diseases such as pear ring mosaic virus, pear vein yellow virus, apple stem groove virus, and apple rust fruit virus. Early detection is an effective means to achieve early prevention and control of pear tree diseases and insect pests. Summary of the invention

[0004] In view of the technical problems existing in the prior art, the present invention provides the development and application of multiple detection primer probes and multiple detection biochips for various pear tree diseases. The specific pear multiple virus chip detection system integrates the three steps of RT-PCR, DNA hybridization and result determination in one tube, improves the detection efficiency and minimizes the error. The present invention is the first to establish a chip detection system for 4 bacteria and 2 viruses in pears at the same time, replacing the traditional electrophoresis display method, and can interpret the test results faster. The accuracy of the interpretation results is also given the greatest guarantee.

[0005] The first object of the present invention is to provide multiplex detection primer probes for various pear tree diseases, characterized in that the various pear tree diseases include diseases caused by Dickeya fangzhongdai, Erwinia amylovora, Erwiniapyrifoliae, Pseudomonas syringae pv. syringae, Pear stem pitting virus (PSPV), and Pear ring mosaic virus (PRMV), wherein the sequences of the primer probes are shown in SEQ ID NO.1-18 in sequence.

[0006] Preferably, the 5' end of the upstream primer or the downstream primer in the primer probe is modified with biotin.

[0007] Further preferably, the 5' end of the upstream primer in the primer probe is modified with biotin.

[0008] Further preferably, the 5' end of the downstream primer in the primer probe is modified with biotin.

[0009] On the other hand, the present invention also provides a biochip for multiplex detection of various pear tree diseases, characterized in that the biochip is coated with probes shown in SEQ ID NOs. 3, 6, 9, 12, 15 and 18.

[0010] On the other hand, the present invention also provides an application of a biochip for multiplex detection of various pear tree diseases, characterized in that the application comprises the following steps:

[0011] (1) Rapid extraction of pathogenic bacteria nucleic acid:

[0012] Using nucleic acid extraction reagent to break the cells in the pear tissue and extract the nucleic acid of the pathogen;

[0013] (2) Multiplex PCR amplification:

[0014] The viral biological signal is amplified into 2 30 times;

[0015] (3) Hybrid reaction:

[0016] Use specific probes on the biochip to obtain virus signals to identify test results;

[0017] (4) Interpretation of results:

[0018] The biochip results can be directly interpreted by the naked eye or by a reader.

[0019] Preferably, the composite PCR reaction system in step (2) is: 1.25 μL 10X PCR Buffer, 0.03 μL PRMV-F, 0.03 μL PRMV-R, 0.03 μL PSPV-F, 0.03 μL PSPV-R, 0.02 μL Dfan-F, 0.02 μL Dfan-R, 0.03 μL Eamy-F, 0.03 μL Eamy-R, 0.02 μL Epyr-F, 0.02 μL Epyr-R, 0.05 μL Pss-F, 0.05 μL Pss-R, 0.3 μL Taq (2.5 U), 2 μL template, and the rest is supplemented to 12.5 μL with ddH2O.

[0020] Preferably, the composite PCR amplification program in step (2) is: reverse transcription at 45°C for 30 min; pre-denaturation at 94°C for 2 min and then the following cycle reaction: denaturation at 94°C for 15 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, for a total of 30 cycles; after the reaction is completed, extension at 72°C for 7 min.

[0021] Preferably, the hybridization reaction in step (3) comprises the following steps:

[0022] 1) Heat the multiplex RT-PCR amplification products at 95°C for 3 min 30 s in a PCR reaction instrument. When the temperature of the reaction instrument reaches 4°C, take them out and place them in a freezer incubator for later use;

[0023] 2) Take 100 μL HA Buffer to the biochip, and add 5 μL of the multiplex RT-PCR product from step 1), and finally stick the film on it. Place the biochip in a shaker at 55°C and 1000 rpm for 30 min.

[0024] 3) Pour off the hybridization reaction solution, add 200 μL Wash Buffer and wash twice. Let stand for 1 min for the last wash, pour off the Wash Buffer and pat dry on toilet paper;

[0025] 4) Prepare Blocking Reagent and Detection Reagent separately, keep Detection Reagent away from light, take 100 μL Blocking Reagent and add it to the biochip, place the biochip in a shaker, and react at 55°C, 1000 rpm for 5 minutes;

[0026] 5) After the reaction is completed, pour out the reaction solution, wash once with 200 μL Wash Buffer, and pour out the Wash Buffer;

[0027] 6) Add 100 μL C Buffer to wet the biochip, let it stand for 1 min, then pour it out and pat it dry with paper towels;

[0028] 7) Take 100 μL of Detection Reagent and add it to the biochip. Place the biochip in a shaker at 55°C and 0 rpm for 7 min.

[0029] 8) After the reaction is completed, pour out the reaction solution, wash the test plate with tap water, dry it at 55℃, and interpret the results.

[0030] The advantages of the present invention are as follows: The present invention is the first to construct an integrated biological detection chip for 4 bacteria and 2 viruses in pears, which can replace the traditional electrophoresis display method and can interpret the test results faster. Regarding the accuracy of the interpretation results. Compared with the traditional electrophoresis results, the virus detection chip developed by the present invention has the characteristics of high sensitivity, strong specificity, strong expandability, convenient operation, low price, intuitive interpretation, high efficiency, etc., which significantly improves the accuracy of the detection and greatly saves high-end human resources and production costs. After the development of this system, it will be applied in some seedling enterprises to provide technical support for the production of non-toxic seedlings and the quarantine of imported seedlings. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 . Biochip matrix diagram, wherein A is a signal distribution diagram corresponding to each detection position of the biochip of the present invention, and B is a structural diagram of each detection unit of the biochip of the present invention;

[0032] Figure 2 . Amplification results of D.fan / P.ss primer pair;

[0033] Figure 3 . Amplification results of E.pyr / E.amy primer pair;

[0034] Figure 4 . PRMV / PSPV primer pair amplification results;

[0035] Figure 5 . 2 virus sensitivity test results;

[0036] Figure 6 . Test results of sensitivity of 4 kinds of bacteria detection;

[0037] Figure 7 . 2 types of reproducibility test analysis;

[0038] Figure 8 . 4 types of reproducibility test analysis;

[0039] Fig. 9 . Specificity test;

[0040] Fig.10 . Determination of pear tree samples. DETAILED DESCRIPTION

[0041] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand the present invention more clearly.

[0042] Example 1

[0043] The sequences of primers and probes for multiplex detection of six pear tree diseases are as follows:

[0044] Primer and probe sequence information

[0045] (1) PRMV:

[0046] Primers and probe (5'-3') are as follows:

[0047] PRMV-F: CGATACAGGGAACGTCGGAG (SEQ ID NO. 1);

[0048] PRMV-R: CCTACTTCCGGCATGGTTGT (SEQ ID NO.2);

[0049] PRMV-P: GCCATCGGGTCATACAACCT (SEQ ID NO.3);

[0050] Target gene: CP; Product length (bp): 271.

[0051] (2) PSPV:

[0052] PSPV-F: TCCACCTGCAAATTGGGTTG (SEQ ID NO.4);

[0053] PSPV-R:TTTCTGCTTGGGTGGGCAAT (SEQ ID NO.5);

[0054] PSPV-P: TGCTGCCTTCGACTTCTTCT (SEQ ID NO.6);

[0055] Target gene: CP; Product length (bp): 137

[0056] (3) D.fan:

[0057] Dfan-F:TTTCCAACGCGTCCTGTACCA (SEQ ID NO.7);

[0058] Dfan-R: AGGTCAACCACGGATACGTT (SEQ ID NO.8);

[0059] Dfan-P: CCTCTACCGGCGCAGCTAA (SEQ ID NO.9);

[0060] Target gene: gapA; Product length (bp): 313

[0061] (4) E.amy

[0062] Eamy-F: TGAAGAGCTGGCGACCCTGTAT (SEQ ID NO.10);

[0063] Eamy-R: TCGTTTGTCACCAGCATACCG (SEQ ID NO.11);

[0064] Eamy-P: GACTACCTGGCGCAGCGTGGGCT (SEQ ID NO.12)

[0065] Target gene: dnaG; Product length (bp): 327

[0066] (5) E.pyr:

[0067] Epyr-F: TGGCGAGGGGCAAGACGGT (SEQ ID NO. 13);

[0068] Epyr-R: CTTCAGGGTACTGGTCCATAAAC (SEQ ID NO. 14);

[0069] Epyr-P:ACTGGCCTTGACGGTTCTGGGC (SEQ ID NO. 15).

[0070] Target gene: Hrp; Product length (bp): 407

[0071] (6) P.ss

[0072] Pss-F: GATTGCGGTGACAGACGCCTTA (SEQ ID NO.16);

[0073] Pss-R: GTCCAGCCCGTCAGCCGTTG (SEQ ID NO. 17);

[0074] Pss-P: TGGCTACCGGTAACAGTTTGC (SEQ ID NO. 18).

[0075] Target gene: syr; Product length (bp): 208.

[0076] Biochip preparation: Referring to the biochip preparation method in the Apple Virus Chip Reagent Kit (purchased from Juhe Biotechnology Co., Ltd.), the steps of the biochip detection of the present invention include RNA extraction, RT-PCR, hybridization, labeling and testing. All specific probes for the target virus / viroid are commercially synthesized (Sangon Biotech, Shanghai).

[0077] The biochip preparation steps included immobilizing the detection probes on the nylon membrane surface of a standard 96-well flat-bottom cell culture plate (127.4 × 85.1 × 16.1 mm) at a concentration of 50 μM. Each biochip was divided into a 5 × 5 matrix numbered A1-5, B1-5, C1-5, D1-5, and E1-5 and contained a macroarray for simultaneous detection of four viruses and two viroids (e.g. Figure 1 as shown).

[0078] The method of using the biochip includes biotin modification of the 5' end of all downstream primers, and the RT-PCR products obtained by RT-PCR amplification of the upstream primer and the biotin-labeled downstream primer are hybridized with each probe on the nylon membrane and detected by radioautography. Among them, the device used in hybridization and washing is a shaker (WKB-100, China). The infected samples should appear as visible spots at the corresponding positions of the array, while the uninfected samples should not appear, except for four hybridization control spots and one RT-PCR positive control spot.

[0079] Example 2

[0080] Single primer amplification analysis: Amplification analysis was performed according to the PCR primers provided in Example 1, specifically comprising the following steps:

[0081] 1) Virus plasmid construction: Clone the coat protein gene (CP) of PRMV and PSPV, the gapA gene of D. fan, the dnaG gene of E. amy, the hrp gene of E. pyr, and the syr gene of P. ss. Connect the cloned genes with the pUC57 plasmid and transform them into competent cells DH5α cells.

[0082] 2) gDNA extraction: A bacterial genome kit (Cat. No. WH0028, purchased from Beijing Biolab Technology Co., Ltd.) was used to extract total bacterial DNA.

[0083] 3) Single primer PCR reaction system: 1.25μL 10X PCR Buffer, 0.05μL Primer-F, 0.05μL Primer-R, 0.15μL Taq (2.5U), 2μL template, and the rest is supplemented with ddH2O to 12.5μL;

[0084] 4) Single-primer PCR amplification procedure: reverse transcription at 45°C for 30 min; pre-denaturation at 94°C for 2 min and then the following cycle reaction: denaturation at 94°C for 15 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, for a total of 30 cycles; after the reaction, extension at 72°C for 7 min.

[0085] 5) Single primer amplification analysis

[0086] Results Figure 2-4 , the primers were used to detect a variety of important pear pathogens, and the length of the amplified fragment was 300-400 bp, the amplified band was single, and the signal was obvious. This result confirmed that the primers can be further used for biochip detection.

[0087] Example 3

[0088] A composite primer amplification system was constructed based on the single primer detection results of Example 2, and the sensitivity and specificity of the detection method were analyzed using a biochip. Specifically, the following steps were included:

[0089] 1) Multiplex PCR reaction system: 1.25 μL 10X PCR Buffer, 0.03 μL PRMV-F, 0.03 μL PRMV-R, 0.03 μL PSPV-F, 0.03 μL PSPV-R, 0.02 μL Dfan-F, 0.02 μL Dfan-R, 0.03 μL Eamy-F, 0.03 μL Eamy-R, 0.02 μL Epyr-F, 0.02 μL Epyr-R, 0.05 μL Pss-F, 0.05 μL Pss-R, 0.3 μL Taq (2.5 U), 2 μL template, and the rest is supplemented with ddH2O to 12.5 μL;

[0090] 2) Multiplex PCR amplification program: reverse transcription at 45°C for 30 min; pre-denaturation at 94°C for 2 min and then the following cycle reaction: denaturation at 94°C for 15 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, for a total of 30 cycles; after the reaction, extension at 72°C for 7 min.

[0091] 3) Biochip analysis

[0092] The specific probe on the chip is used to obtain the virus signal to identify the test results. The specific biochip detection method includes the following steps:

[0093] 1) Heat the multiplex RT-PCR amplification products at 95°C for 3 min 30 s in a PCR reaction instrument. When the temperature of the reaction instrument reaches 4°C, take them out and place them in a freezer incubator for later use;

[0094] 2) Take 100 μL HA Buffer to the biochip, and add 5 μL of the multiplex RT-PCR product from step 1), and finally stick the film on it. Place the biochip in a shaker at 55°C and 1000 rpm for 30 min.

[0095] 3) Pour off the hybridization reaction solution, add 200 μL Wash Buffer and wash twice. Let stand for 1 min for the last wash, pour off the Wash Buffer and pat dry on toilet paper;

[0096] 4) Prepare Blocking Reagent and Detection Reagent separately, keep Detection Reagent away from light, take 100 μL Blocking Reagent and add it to the biochip, place the biochip in a shaker, and react at 55°C, 1000 rpm for 5 minutes;

[0097] 5) After the reaction is completed, pour out the reaction solution, wash once with 200 μL Wash Buffer, and pour out the Wash Buffer;

[0098] 6) Add 100 μL C Buffer to wet the biochip, let it stand for 1 min, then pour it out and pat it dry with paper towels;

[0099] 7) Take 100 μL of Detection Reagent and add it to the biochip. Place the biochip in a shaker at 55°C and 0 rpm for 7 min.

[0100] 8) After the reaction is completed, pour out the reaction solution, wash the test plate with tap water, dry it at 55℃, and interpret the results.

[0101] Among them, the buffer solution involved in the above detection method refers to the Apple Virus Chip Reagent Kit (purchased from Juhe Biotechnology Co., Ltd.).

[0102] The results are as follows Figure 5-6 As shown, the biochip of the present invention can reach a sensitivity of 10 fg / μL for two viruses and 10 pg / μL for four bacteria, which is similar to the sensitivity of real-time fluorescence PCR.

[0103] Example 4

[0104] 1) Biochip target reproducibility test:

[0105] Positive plasmids were used as test samples for viral targets, and total nucleic acid was used as test samples for bacterial targets for chip reproducibility testing, with each sample repeated 5 times. Figure 7-8 As shown, the biochip of the present invention has excellent reproducibility and can realize repeated detection of results.

[0106] 2) Plant sample specificity test:

[0107] The specificity of the chip samples was tested using gDNA from orchid (1-3), Aspergillus (4-5), Pythium (6-7), Escherichia coli (8-9), potato (10-12), apple (13-16), rose (17-18), and sweet potato (19-20). Fig. 9As shown, the biochip of the present invention has good specificity, and no relevant detection signals appear for other samples. It is further confirmed that the biochip of the present invention can only identify the various pear tree diseases described in the present invention from infected pear tree samples.

[0108] Example 5

[0109] This embodiment provides a method of randomly collecting multiple pear tree samples from the pear orchard of Shandong Dafengyuan Agricultural Co., Ltd. (the pear tree samples have been first tested for pathogens using the reported PCR and PT-PCR methods) according to the operation flow of the chip of the present invention, and using the chip of the present invention to perform pathogen detection. The steps include:

[0110] 1) Rapid extraction of pathogenic bacteria nucleic acid:

[0111] The grinding bag and reagents provided in the kit were used to break the cells in the pear tree tissue to extract the pathogen nucleic acid.

[0112] 2) RT-PCR:

[0113] The pathogen signal is amplified into 2 30 times.

[0114] 3) Hybrid reaction:

[0115] Specific probes on the chip are used to capture viral signals for identification of test results.

[0116] 4) Interpretation of results:

[0117] The biochip results can be directly interpreted by the naked eye or by a reader.

[0118] The results are as follows Fig.10 As shown, sample 1 is positive for E.amy, E.pyr, and P.ss; sample 2 is positive for PSPV and E.amy; sample 3 is negative; and sample 4 is positive for PRMV and D.fan. This result is consistent with the results of PCR and RT-PCR detection of the samples in advance, indicating that the chip of the present invention has 100% detection accuracy.

[0119] The above embodiments are intended to illustrate the essential content of the present invention, but are not intended to limit the protection scope of the present invention. Those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and protection scope of the technical solution of the present invention.

Claims

1. A primer probe for multiple detection of various pear tree diseases, characterized in that: The pear tree diseases include diseases caused by Dickeyafangzhongdai, Erwinia amylovora, Erwinia pyrifoliae, Pseudomonas syringae pv.syringae, Pear stem pitting virus, and Pear ring mosaic virus, wherein the sequences of the primer probes are shown in SEQ ID NO.1-18 in sequence.

2. The primer probe according to claim 1, characterized in that The 5' end of the upstream primer or the downstream primer in the primer probe is biotin-modified.

3. The primer probe according to claim 2, characterized in that The 5' ends of the upstream primers in the primer probes are all modified with biotin.

4. The primer probe according to claim 1, characterized in that The 5' ends of the downstream primers in the primer probes are all modified with biotin.

5. A biochip for multiple detection of various pear tree diseases, characterized in that: The biochip is coated with probes shown in SEQ ID NOs. 3, 6, 9, 12, 15 and 18.

Images