SSR (Simple Sequence Repeat) marker fingerprint spectrum of PG7092 strain as well as construction method and application of SSR marker fingerprint spectrum

Abstract

The invention discloses an SSR (Simple Sequence Repeat) marker fingerprint spectrum of a PG7092 strain as well as a construction method and application of the SSR marker fingerprint spectrum. The invention belongs to the technical field of strain detection, the SSR marker fingerprint spectrum of the PG7092 strain can be used for identifying the PG7092 strain, and compared with conventional morphological identification, antagonism tests and fruiting experiments, the SSR marker fingerprint spectrum of the PG7092 strain has the advantages of being short in detection time, high in accuracy and good in repeatability; the time required by detection is only 3-4 days, the time required by a conventional antagonism test is at least 1 week, and the time required by a fruiting test is at least 2 months; the method has the specificity of the PG7092 strain in seven collected pleurotus enorgii strains with different genetic backgrounds, and has a good application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of bacterial strain detection, and in particular relates to an SSR marker fingerprint spectrum of a Pleurotus ostreatus PG7092 bacterial strain and a construction method and application thereof. Background Art

[0002] Pleurotus giganteus (Berk.) Karun. & K.D. Hyde) is a rare edible fungus developed in China. It has a unique taste and flavor, and is as smooth as pig's stomach, so its trade name is "pig's stomach mushroom"; Pleurotus giganteus is rich in nutrients, including polysaccharides, proteins, crude fiber and other nutrients, and has multiple medicinal effects such as anti-inflammatory, anti-tumor, anti-fungal, and liver protection. It is deeply loved by consumers and has a high potential market value.

[0003] However, with the continuous development of the giant Pleurotus ostreatus industry, the problem of "same thing with different names, same name with different things" in the production of giant Pleurotus ostreatus has become increasingly prominent; our team previously collected 20 giant Pleurotus ostreatus strains in China, and found that only 7 of them had different genetic backgrounds, while the other strains were the same thing with different names; this problem not only damages the intellectual property rights of giant Pleurotus ostreatus breeders, but also poses a great risk to producers, creating hidden dangers for the further development of the giant Pleurotus ostreatus industry; in order to protect the rights and interests of breeders and reduce the risks of producers, and promote the healthy, stable and sustainable development of my country's giant Pleurotus ostreatus industry, it is urgent to establish a simple, fast and reliable giant Pleurotus ostreatus strain-specific identification technology.

[0004] With the rapid development of molecular biology and the continuous maturity of DNA sequencing technology, the cost of high-throughput sequencing is also decreasing; DNA molecular marker technology can detect the genetic specificity of Pleurotus eryngii strains at the gene level, and the completion of the whole genome sequencing of Pleurotus eryngii has facilitated the development of SSR markers; SSR molecular markers are an application based on high-throughput sequencing technology, which reduces the cost of SSR marker development and is suitable for the development of molecular markers for whole genome sequencing of Pleurotus eryngii; SSR markers have the advantages of abundant quantity, high accuracy, good stability, quick and easy, etc., and are not only used for molecular marker-assisted breeding, but also can be used for the identification of Pleurotus eryngii strains. Summary of the invention

[0005] The invention provides a PG7092 bacterial strain with short detection time, high accuracy and good repeatability.

[0006] The technical solution adopted by the present invention is as follows: a method for constructing an SSR marker fingerprint of Pleurotus eryngii PG7092 strain, comprising the following steps:

[0007] S1. Mycelial culture: transfer the Pleurotus erythrocytes to a plate of PDA medium, culture at a constant temperature in the dark, and collect the mycelial roots after 7 days;

[0008] S2. Extraction of genomic DNA: using a plant genomic DNA extraction kit, extract the genomic DNA of the mycelium according to the operating steps in the kit; detecting the concentration and purity of the genomic DNA by agarose gel electrophoresis and ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA;

[0009] S3. Detection of SSR molecular markers: PCR amplification of SSR molecular markers was performed on the extracted genomic DNA;

[0010] S4. Electrophoresis detection: Mix the amplified PCR product with the loading buffer, perform electrophoresis, silver stain, color development, and take photos.

[0011] Furthermore, the specific process of extracting the S2 genomic DNA includes:

[0012] S201, taking a certain amount of mycelium and putting it into a centrifuge tube, adding liquid nitrogen and grinding it thoroughly;

[0013] S202, quickly add Buffer LP1 and RNase A to the ground powder, vortex and shake, and leave at room temperature to allow for complete lysis;

[0014] S203, adding Buffer LP2 to the lysate, mixing by inverting, and vortexing for a predetermined time;

[0015] S204, centrifuging at a specific speed for a predetermined time, and transferring the supernatant to a new centrifuge tube;

[0016] S205, add Buffer LP3, mix by inverting;

[0017] S206, transferring all the solution and precipitate obtained in the previous step to the adsorption column loaded into the collection tube, centrifuging at a specific speed for a predetermined time, pouring out the waste liquid in the collection tube, and putting the adsorption column back into the collection tube;

[0018] S207, adding Buffer GW2 to the adsorption column, centrifuging at a specific speed for a predetermined time, pouring out the waste liquid in the collection tube, and putting the adsorption column back into the collection tube;

[0019] S208, repeat step S207;

[0020] S209, centrifuge at a specific speed for a predetermined time, pour out the waste liquid in the collection tube, put the adsorption column into a new centrifuge tube, and leave it at room temperature until it is completely dry;

[0021] S210, dripping Buffer GE in the middle of the membrane of the adsorption column, leaving it at room temperature for a predetermined time, centrifuging it at a specific speed for a predetermined time, and collecting the DNA solution;

[0022] S211. Take the DNA solution and detect the DNA concentration and purity on an agarose gel and a spectrophotometer, respectively.

[0023] Furthermore, the PCR reaction conditions in the detection of the SSR molecular markers in S3 are: 94°C for 5 min, 94°C for 40 s, 60°C for 40 s, 72°C for 1 min, 72°C for 10 min, for 30 cycles.

[0024] Furthermore, the fingerprint map consists of 10 pairs of SSR markers, and the corresponding 10 pairs of SSR marker primer sequences are as follows:

[0025] The forward / reverse primers for PGSSR23 are:

[0026] GTATTTTTGTTCTTTGCCATCCA / TCCCAAAGGTAAAATGTGTCAAC

[0027] The forward / reverse primers for PGSSR24 are:

[0028] TGGATTATACGTTTACGAGACCG / AGCACACCGTTTAGAAGAAATCA

[0029] The forward / reverse primers for PGSSR31 are:

[0030] GACGTAGAATAACATTTCGGCTG / AAGGTGAACTAAAACGCACTCTG

[0031] The forward / reverse primers for PGSSR32 are:

[0032] GTAATGTCCCAATGGTCCTC / CCTACATTGTCATCACCATTTGT

[0033] The forward / reverse primers for PGSSR34 are:

[0034] TACATACCAAACCCCATACAACC / GGATAGTTCTCGATACGAAGGCT

[0035] The forward / reverse primers for PGSSR35 are:

[0036] GCAGTAGATTCTGTGGCTTGAAC / ACTGATTGGGAGTGACAAAAGAA

[0037] The forward / reverse primers for PGSSR46 are:

[0038] CGAGAAAACAAGCTATCGTGAGT / CGATCGTCTGTTGTACCTTTCAT

[0039] The forward / reverse primers for PGSSR68 are:

[0040] GTAGGTTGTGCAGAAGAGATGCT / GCACCTCGATTTGTTGTTATCTC

[0041] The forward / reverse primers for PGSSR86 are:

[0042] ATACATATGCTCGTTGGTCGTCT / GGAGAGAGAGAGAGAAGCCAGTC

[0043] The forward / reverse primers for PGSSR91 are:

[0044] CTGATCGGCTTCCTCATCTAGT / CAGAGTAGTGCCATCTCCAAGTT.

[0045] Furthermore, the electrophoresis detection method in S4 is:

[0046] The amplified PCR product was mixed with the denaturing gel buffer in sequence, and then spotted in the spotting wells of the polyacrylamide gel;

[0047] The specific process of silver staining and color development is as follows: after the electrophoresis is completed, the glass plate is disassembled, the gel plate is washed with deionized water for a predetermined time, then placed in the silver staining solution for a predetermined time in the dark, washed with deionized water for a predetermined time after silver staining, placed in the developer until clear bands appear, washed with deionized water for a predetermined time, and photographed and recorded the band characteristics in the biological macromolecule analyzer.

[0048] The present invention also provides another technical solution:

[0049] Using 10 pairs of SSR marker primers developed from the whole genome of Pleurotus giante, SSR markers were amplified for Pleurotus giante strains. The obtained banding pattern was compared with the banding pattern of Pleurotus giante PG7092 strain. Those with the same banding pattern were Pleurotus giante PG7092 strains.

[0050] After adopting the above scheme, the beneficial effects of the present invention are as follows: the SSR marker fingerprint of the giant ear PG7092 strain of the present invention can be used for the identification of the PG7092 strain. Compared with conventional morphological identification, antagonism test and mushroom fruiting experiment, the present invention has the advantages of short detection time, high accuracy and good repeatability; the detection time is only 3-4 days, while the conventional antagonism test takes at least 1 week, and the mushroom fruiting test takes at least 2 months; the method has the specificity of the PG7092 strain among the 7 collected giant ear strains with different genetic backgrounds, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] The accompanying drawings are used to provide further understanding of the present invention and constitute a part of the specification. They are used to explain the present invention together with the embodiments of the present invention and do not constitute a limitation of the present invention.

[0052] Figure 1 This is the SSR marker fingerprint of Pleurotus erythrorhizome PG7092, where M is a 50 bp ladder DNA marker, numbers 1-10 represent the 10 pairs of SSR marker primers used, and the arrows point to the specific SSR allele combination of Pleurotus erythrorhizome PG7092;

[0053] Figure 2 The amplification pattern of primer PGSSR23 in the seven selected Pleurotus eryngii materials;

[0054] Figure 3 The amplification pattern of primer PGSSR24 in the selected 7 Pleurotus eryngii materials;

[0055] Figure 4 The amplification pattern of primer PGSSR31 in the seven selected Pleurotus eryngii materials;

[0056] Figure 5 The amplification pattern of primer PGSSR32 in the seven selected Pleurotus eryngii materials;

[0057] Figure 6 The amplification pattern of primer PGSSR34 in the seven selected Pleurotus eryngii materials;

[0058] Figure 7 The amplification pattern of primer PGSSR35 in the seven selected Pleurotus eryngii materials;

[0059] Figure 8 The amplification pattern of primer PGSSR46 in the seven selected Pleurotus eryngii materials;

[0060] Fig. 9 The amplification pattern of primer PGSSR68 in the seven selected Pleurotus eryngii materials; Fig.10 The amplification pattern of primer PGSSR86 in the seven selected Pleurotus eryngii materials; Fig.11 This is the amplification map of primer PGSSR91 in the seven selected Pleurotus eryngii materials. DETAILED DESCRIPTION

[0061] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, it should be understood that after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall within the scope limited by the appended claims of the application equally.

[0062] The present invention discloses an SSR marker fingerprint of a Pleurotus eryngii PG7092 strain, which consists of 10 pairs of SSR markers and is developed based on the whole genome of Pleurotus eryngii using SSR marker primers. The amplification band pattern is good and the repeatability is high. The detailed information of the marker primers is shown in Table 1.

[0063] Table 1 Detailed information list of SSR marker primers

[0064]

[0065] The present invention provides an application of the SSR marker fingerprint of the Pleurotus eryngii PG7092 strain, which is to use 10 pairs of SSR marker primers developed from the whole genome of Pleurotus eryngii to amplify SSR markers in 7 Pleurotus eryngii strains with different genetic backgrounds, and to determine the number and relative molecular weight of the allele fragments amplified by the 10 pairs of SSR marker primers in each Pleurotus eryngii strain by comparing with a 50 bp ladder DNA marker and numbering them (Table 2, Appendix Figure 2-11 ); The number combination of different SSR alleles can effectively identify the "PG7092" strain among the collected Pleurotus ostreatus strains (Table 3), and its band type number combination is: 14(1+2+6)41(2+5)(1+5+6)504. The strain that meets this band type combination is the Pleurotus ostreatus PG7092 strain.

[0066] Table 2 Summary of information of all alleles amplified by SSR primers

[0067]

[0068]

[0069] Table 3 Allelic fragment numbers amplified from strain PG7092

[0070]

[0071]

[0072] Sources of 7 Pleurotus gibberellus strains with different genetic backgrounds:

[0073] Strain PG46 (a synonym of Agaricus 1, Agaricus 2, Agaricus 1, Agaricus 2, Agaricus, Agaricus F1 from Shandong Shouguang Edible Fungi Research Institute, Agaricus-1 and Agaricus-2 from Fujian Gutian Edible Fungi Research Institute, c.m0003, c.m0010, c.m0013, c.m0030 from Fujian Agriculture and Forestry University, and Agaricus oleraceus from Chengde Edible Fungi Research Institute in Hebei) was obtained from Longhu Nanke Edible Fungi Company in Haikou City, Hainan Province; strain PG79 was obtained from Longhu Nanke Edible Fungi Company in Haikou City, Hainan Province; strain PG133 was collected from the wild in Danzhou City, Hainan Province; strain PG191 of Agaricus oleraceus was obtained from Guizhou Academy of Agricultural Sciences; strain PG219 was obtained from Fujian Agriculture and Forestry University; strain PG7031 was obtained from Yangzhou University; and strain PG7092 was obtained from Yangzhou University.

[0074] The sequences of 10 pairs of SSR marker primers are as follows:

[0075] The forward / reverse primers for PGSSR23 are:

[0076] GTATTTTTGTTCTTTGCCATCCA / TCCCAAAGGTAAAATGTGTCAAC

[0077] The forward / reverse primers for PGSSR24 are:

[0078] TGGATTATACGTTTACGAGACCG / AGCACACCGTTTAGAAGAAATCA

[0079] The forward / reverse primers for PGSSR31 are:

[0080] GACGTAGAATAACATTTCGGCTG / AAGGTGAACTAAAACGCACTCTG

[0081] The forward / reverse primers for PGSSR32 are:

[0082] GTAATGTCCCAATGGTCCTC / CCTACATTGTCATCACCATTTGT

[0083] The forward / reverse primers for PGSSR34 are:

[0084] TACATACCAAACCCCATACAACC / GGATAGTTCTCGATACGAAGGCT

[0085] The forward / reverse primers for PGSSR35 are:

[0086] GCAGTAGATTCTGTGGCTTGAAC / ACTGATTGGGAGTGACAAAAGAA

[0087] The forward / reverse primers for PGSSR46 are:

[0088] CGAGAAAACAAGCTATCGTGAGT / CGATCGTCTGTTGTACCTTTCAT

[0089] The forward / reverse primers for PGSSR68 are:

[0090] GTAGGTTGTGCAGAAGAGATGCT / GCACCTCGATTTGTTGTTATCTC

[0091] The forward / reverse primers for PGSSR86 are:

[0092] ATACATATGCTCGTTGGTCGTCT / GGAGAGAGAGAGAGAAGCCAGTC

[0093] The forward / reverse primers for PGSSR91 are:

[0094] CTGATCGGCTTCCTCATCTAGT / CAGAGTAGTGCCATCTCCAAGTT.

[0095] Example:

[0096] S1. Mycelial culture: transfer Pleurotus erythrocytes to a plate containing 20 mL of PDA medium, culture in the dark at 28°C, and collect mycelials after 7 days;

[0097] S2. Extraction of genomic DNA: using a plant genomic DNA extraction kit, extract the genomic DNA of the mycelium according to the operating steps in the kit; detecting the concentration and purity of the genomic DNA by agarose gel electrophoresis and UV spectrophotometry, and adjusting the concentration of the sample DNA to 20-30 ng / μL;

[0098] The specific process of extracting genomic DNA from mycelium by the kit method includes:

[0099] S201, take about 100 mg of mycelium and put it into a 1.5 mL centrifuge tube, add liquid nitrogen and grind it thoroughly;

[0100] S202, quickly add 400 μL Buffer LP1 and 6 μL RNase A (10 mg / mL) to the ground powder, vortex for 1 min, and leave at room temperature for 10 min to fully lyse it;

[0101] S203, add 130 μL Buffer LP2 to the lysate, mix by inversion, and vortex for 1 min;

[0102] S204, centrifuge at 12000 rpm for 5 min, and transfer the supernatant to a new centrifuge tube;

[0103] S205, add 1.5 times the volume of Buffer LP3, mix by inverting for 8-10 times;

[0104] S206, transfer all the solution and precipitate obtained in the previous step to the adsorption column loaded into the collection tube, centrifuge at 12000 rpm for 1 min, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube;

[0105] S207, add 500 μL Buffer GW2 to the adsorption column, centrifuge at 12000 rpm for 1 min, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube;

[0106] S208, repeat step S207;

[0107] S209, centrifuge at 12000rpm for 2min, discard the waste liquid in the collection tube, put the adsorption column into a new centrifuge tube, and leave it at room temperature for several minutes until it is completely dry;

[0108] S210, add 50-80 μL of Buffer GE to the middle of the membrane of the adsorption column, let it stand at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 1 minute, and collect the DNA solution;

[0109] S211. Take 2 μL of DNA solution and test the DNA concentration and purity on a 2% agarose gel and a spectrophotometer, respectively.

[0110] S3. Detection of SSR molecular markers: PCR amplification of SSR molecular markers was performed on the genomic DNA extracted above;

[0111] The PCR amplification system was as follows: 25 μL, including 10× Buffer 2 μL, 25 mmol / L MgCL2 2 μL, 10 mmol / L dNTPs 0.6 μL, 5 U / μL Taq DNA polymerase 0.3 μL, 10 μmol / L SSR marker forward primer and reverse primer 0.3 μL each, 20-30 ng / μL DNA template DNA 0.5 μL, ddH2O 19 μL;

[0112] The PCR reaction conditions were: 94°C for 5 min, 94°C for 40 s, 60°C for 40 s, 72°C for 1 min, and 72°C for 10 min, for 30 cycles.

[0113] S4. Electrophoresis detection: Take 1 μL of the PCR product obtained by the above amplification and 1 μL of 2× denaturing gel buffer, mix them in sequence, and spot them in the spotting holes of polyacrylamide gel. The volume percentage of polyacrylamide gel is 20%, and the electrophoresis buffer is 1×TBE; run at a constant voltage of 180V for 90min, silver stain, color development, and take pictures.

[0114] The specific process of silver staining and color development is as follows: after the electrophoresis is completed, the glass plate is disassembled, the gel plate is washed with deionized water for 10-20 seconds, and then placed in the silver staining solution for silver staining in the dark for 5-8 minutes, and then washed with deionized water for 10-20 seconds after silver staining, and placed in the developer until clear bands appear, and then washed with deionized water for 5-8 seconds, and photographed and recorded in the biological macromolecule analyzer; the silver staining solution and developer can be reused 3-4 times.

[0115] The above 10 pairs of SSR marker primers were used to perform PCR amplification on Pleurotus giganteus strains. The number and relative molecular weight of the allele fragments amplified by each SSR marker primer were determined by comparing with the 50 bp ladder DNA marker (see Appendix). Figure 2-11 ) and find the strain with the band type matching the number combination of 03(3+7)26(2+5)502(1+4), then it can be determined that the strain is Pleurotus ostreatus PG7031. To ensure the accuracy of identification, three repeated experiments are required.

[0116] Although the embodiments of the present invention have been shown and described, it is understood by those skilled in the art that various changes, modifications, substitutions and variations may be made to these embodiments without departing from the principles and spirit of the present invention, and the scope of the present invention is defined by the appended claims and their equivalents. In short, if those skilled in the art are inspired by them and design structural modes and embodiments similar to the technical solution without creativity without departing from the purpose of the present invention, they shall all fall within the scope of protection of the present invention.

Claims

1. A method for constructing an SSR marker fingerprint of Pleurotus gibberellus PG7092, characterized in that: The following steps are involved: S1. Mycelial culture: transfer the Pleurotus erythrocytes to a plate of PDA medium, culture at a constant temperature in the dark, and collect the mycelial roots after 7 days; S2. Extraction of genomic DNA: using a plant genomic DNA extraction kit, extract the genomic DNA of the mycelium according to the operating steps in the kit; detecting the concentration and purity of the genomic DNA by agarose gel electrophoresis and ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA; S3. Detection of SSR molecular markers: PCR amplification of SSR molecular markers was performed on the extracted genomic DNA; S4. Electrophoresis detection: Mix the amplified PCR product with the loading buffer, perform electrophoresis, silver stain, color development, and take photos.

2. The method for constructing the SSR marker fingerprint of the Pleurotus ostreatus PG7092 strain according to claim 1, characterized in that: The specific process of extracting the S2 genomic DNA includes: S201, taking a certain amount of mycelium and putting it into a centrifuge tube, adding liquid nitrogen and grinding it thoroughly; S202, quickly add Buffer LP1 and RNase A to the ground powder, vortex and shake, and leave at room temperature to allow for complete lysis; S203, adding Buffer LP2 to the lysate, mixing by inverting, and vortexing for a predetermined time; S204, centrifuging at a specific speed for a predetermined time, and transferring the supernatant to a new centrifuge tube; S205, add Buffer LP3, mix by inverting; S206, transferring all the solution and precipitate obtained in the previous step to the adsorption column loaded into the collection tube, centrifuging at a specific speed for a predetermined time, pouring out the waste liquid in the collection tube, and putting the adsorption column back into the collection tube; S207, adding Buffer GW2 to the adsorption column, centrifuging at a specific speed for a predetermined time, pouring out the waste liquid in the collection tube, and putting the adsorption column back into the collection tube; S208, repeat step S207; S209, centrifuge at a specific speed for a predetermined time, pour out the waste liquid in the collection tube, put the adsorption column into a new centrifuge tube, and leave it at room temperature until it is completely dry; S210, dripping Buffer GE in the middle of the membrane of the adsorption column, leaving it at room temperature for a predetermined time, centrifuging it at a specific speed for a predetermined time, and collecting the DNA solution; S211. Take the DNA solution and detect the DNA concentration and purity on an agarose gel and a spectrophotometer, respectively.

3. The method for constructing the SSR marker fingerprint of the Pleurotus ostreatus PG7092 strain according to claim 2, characterized in that: The PCR reaction conditions for the detection of the SSR molecular markers in S3 are: 94°C for 5 min, 94°C for 40 s, 60°C for 40 s, 72°C for 1 min, and 72°C for 10 min, for 30 cycles.

4. The method for constructing the SSR marker fingerprint of Pleurotus gibberellus PG7092 according to claim 3, characterized in that: The fingerprint map consists of 10 pairs of SSR markers, and the corresponding 10 pairs of SSR marker primer sequences are as follows: The forward / reverse primers for PGSSR23 are: GTATTTTTGTTCTTTGCCATCCA / TCCCAAAGGTAAAATGTGTCAAC; The forward / reverse primers for PGSSR24 are: TGGATTATACGTTTACGAGACCG / AGCACACCGTTTAGAAGAAATCA; The forward / reverse primers for PGSSR31 are: GACGTAGAATAACATTTCGGCTG / AAGGTGAACTAAAACGCACTCTG; The forward / reverse primers for PGSSR32 are: GTAATGTCCCAATGGTCCTC / CCTACATTGTCATCACCATTTGT; The forward / reverse primers for PGSSR34 are: TACATACCAAACCCCATACAACC / GGATAGTTCTCGATACGAAGGCT; The forward / reverse primers for PGSSR35 are: GCAGTAGATTCTGTGGCTTGAAC / ACTGATTGGGAGTGACAAAAGAA; The forward / reverse primers for PGSSR46 are: CGAGAAAACAAGCTATCGTGAGT / CGATCGTCTGTTGTACCTTTCAT; The forward / reverse primers for PGSSR68 are: GTAGGTTGTGCAGAAGAGATGCT / GCACCTCGATTTGTTGTTATCTC; The forward / reverse primers for PGSSR86 are: ATACATATGCTCGTTGGTCGTCT / GGAGAGAGAGAGAGAAGCCAGTC; The forward / reverse primers for PGSSR91 are: CTGATCGGCTTCCTCATCTAGT / CAGAGTAGTGCCATCTCCAAGTT.

5. The method for constructing the SSR marker fingerprint of Pleurotus gibberellus PG7092 according to claim 4, characterized in that: The method of electrophoresis detection in S4 is: The amplified PCR product was mixed with the denaturing gel buffer in sequence, and then spotted in the spotting wells of the polyacrylamide gel; The specific process of silver staining and color development is as follows: after the electrophoresis is completed, the glass plate is disassembled, the gel plate is washed with deionized water for a predetermined time, then placed in the silver staining solution for a predetermined time in the dark, washed with deionized water for a predetermined time after silver staining, placed in the developer until clear bands appear, washed with deionized water for a predetermined time, and photographed and recorded the band characteristics in the biological macromolecule analyzer.

6. The application of the SSR marker fingerprint of the Pleurotus gibberellus PG7092 strain according to claim 4, characterized in that: Using 10 pairs of SSR marker primers developed from the whole genome of Pleurotus giante, SSR markers were amplified for Pleurotus giante strains. The obtained banding pattern was compared with the banding pattern of Pleurotus giante PG7092 strain. Those with the same banding pattern were Pleurotus giante PG7092 strains.

Images